ID: 1017831543

View in Genome Browser
Species Human (GRCh38)
Location 6:158134933-158134955
Sequence TCAGCCAATAAGTGTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017831542_1017831543 -3 Left 1017831542 6:158134913-158134935 CCAAGTGAACAAAGGAAACATCA 0: 1
1: 0
2: 6
3: 82
4: 534
Right 1017831543 6:158134933-158134955 TCAGCCAATAAGTGTTGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017831543 Original CRISPR TCAGCCAATAAGTGTTGAGC TGG Intronic
902270073 1:15297603-15297625 TAAGCCACTAAGTTTTGGGCTGG - Intronic
902479318 1:16703154-16703176 TCCCCCAATAAGTGCTGGGCTGG - Intergenic
903212689 1:21827684-21827706 CCAGCCAGTAAGTGTGGGGCAGG + Intronic
903734394 1:25521046-25521068 ACAGCCAATAAGTGGTCAGCTGG - Intergenic
904248652 1:29206478-29206500 TCAGCAAAAATGTGTTGAGCTGG - Intronic
904705829 1:32390000-32390022 TCAGCTAAGAAGTGTTGACATGG + Intronic
905468240 1:38172151-38172173 TAAGCCACTAAGTTTTGGGCTGG - Intergenic
906280578 1:44550508-44550530 TCAGCCCATCACTGTTGAGAGGG - Intronic
907426734 1:54384441-54384463 TCAGCCAACAAATGTTGAGTGGG + Intronic
907911434 1:58830533-58830555 TAAGCCAAAAAGCATTGAGCTGG + Intergenic
909030936 1:70539136-70539158 TAAGCCACTAAGTTTTGAGGTGG - Intergenic
909974586 1:82030102-82030124 TCAGACAATCTGTGTGGAGCTGG + Intergenic
910083114 1:83365586-83365608 TGAGCCAATAATTCTTGGGCTGG + Intergenic
910139642 1:84012858-84012880 TCAGGCCATTAGTGTGGAGCTGG - Intergenic
913221382 1:116663513-116663535 TCACCCAATAAGGGTTGTGGTGG - Intronic
914006935 1:143740320-143740342 TCAGGCAACAAGAGTTGAGACGG - Intergenic
914645755 1:149650810-149650832 TCAGGCAACAAGAGTTGAGACGG - Intergenic
917592858 1:176495084-176495106 TCATCCAATAAGTATTCACCAGG - Intronic
921511127 1:216032139-216032161 TCAGAAAATATTTGTTGAGCAGG - Intronic
1063208658 10:3858351-3858373 ACAGCAAATGAGAGTTGAGCAGG - Intergenic
1071587013 10:86833408-86833430 TCAGACAATATGTGTAGAGATGG + Intronic
1074049462 10:109868818-109868840 GGAGCCAAGAAGTGGTGAGCTGG + Intronic
1098574329 12:72024005-72024027 ACAGTTAATAAGTGTTGATCTGG + Intronic
1101633181 12:106515456-106515478 TCAGCAAATCAGTCTTGATCAGG + Intronic
1103014375 12:117482394-117482416 TAAGCCACTAAGTTTTGAGATGG + Intronic
1106034596 13:26032295-26032317 TAAGCCACTAAGTGCTGAGGTGG - Intergenic
1110051422 13:70905415-70905437 TTAGCCAAAAAGTGTGGAGTGGG - Intergenic
1110683791 13:78348017-78348039 TAAGCCAGTAAGTGTTAAGGTGG - Intergenic
1117293450 14:54356201-54356223 TAAGCCAATAAGTTTTGGACTGG - Intergenic
1120810474 14:88798329-88798351 TCAGCCAATCAGAGTTAACCAGG - Intergenic
1122937526 14:104966971-104966993 CCAGCCAGTAGGTGTGGAGCTGG + Intronic
1126848062 15:52779922-52779944 TCAGACAGTAAATGTGGAGCTGG + Intronic
1127213301 15:56798167-56798189 TAAGCCATTAAGTGTTGGGATGG - Intronic
1131118349 15:89808013-89808035 TGATCCAATTTGTGTTGAGCAGG - Intronic
1132771033 16:1563549-1563571 CCAGACAGTAAGTGTGGAGCTGG + Intronic
1134759581 16:16702242-16702264 AAAGCCCATAACTGTTGAGCAGG + Intergenic
1134986489 16:18656959-18656981 AAAGCCCATAACTGTTGAGCAGG - Intergenic
1137310339 16:47250771-47250793 AGAGCTAATTAGTGTTGAGCAGG + Intronic
1137897669 16:52231812-52231834 ACAGGTAATAAGTGGTGAGCTGG - Intergenic
1141600652 16:85124183-85124205 TTAAACAATAAGTGCTGAGCTGG + Intergenic
1141857998 16:86697889-86697911 TCAGCCAGGAAGTGATGAGATGG - Intergenic
1143656254 17:8295448-8295470 TCAGCCAATCAGCGCCGAGCCGG + Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1151127585 17:71861714-71861736 TAAGCCACTAAGTTTTGAGATGG - Intergenic
1151377438 17:73699850-73699872 TCAGCAAATAATTGTTTTGCTGG + Intergenic
1152026711 17:77814410-77814432 TAAGCCATTAAATGTTGAGGTGG + Intergenic
1168520637 19:57047678-57047700 TGAGCCACTAAGTTTTGAGGTGG + Intergenic
1202713358 1_KI270714v1_random:29060-29082 TCCCCCAATAAGTGCTGGGCTGG - Intergenic
925792298 2:7503313-7503335 TCAGCCAAGAAATATTGAACCGG + Intergenic
926086086 2:10021213-10021235 TAAGCCACTAAGTTTTGAGGTGG + Intergenic
928585209 2:32752941-32752963 TAAGCCACTAAGTTTTGAGTGGG - Intronic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
929057874 2:37894118-37894140 GTAGCCAATGAGTGTGGAGCTGG - Intergenic
929188137 2:39116572-39116594 CCAGCCAATAAGTTTTAAGTAGG - Intronic
930045832 2:47171937-47171959 TCAAACAAAAATTGTTGAGCAGG - Intronic
931804958 2:65795311-65795333 TCATCCAATATTTGTTGAGTTGG + Intergenic
933822059 2:86122243-86122265 TCATCCAATAAGTGGGAAGCAGG + Intronic
936778668 2:116005081-116005103 TAAGCCATTAAGTTTTGAGGTGG - Intergenic
936876760 2:117199608-117199630 TCAGGCAATGAATGGTGAGCTGG + Intergenic
939013427 2:136873930-136873952 TCAGCAAACAAGTGTCAAGCTGG - Intronic
939572527 2:143857315-143857337 TTAGCCACTAAATTTTGAGCTGG + Intergenic
941204650 2:162557010-162557032 TGAGCCACTAAGTGTTGAGGTGG - Intronic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
946720898 2:222606136-222606158 CCAGCCAATCAGTGTGGAGTTGG - Intronic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
947907650 2:233777139-233777161 TCAGTCATTAAGTTTTGAGGTGG + Intronic
948071439 2:235131025-235131047 TAAGCCACTAAGTTTTGAGGTGG - Intergenic
1169457229 20:5762574-5762596 GTACCCAAAAAGTGTTGAGCAGG - Intronic
1171189955 20:23151715-23151737 TAAGCCACTAAGTTTTGAGGTGG - Intergenic
1171984977 20:31653864-31653886 TCAGCCAATGAGGGATGAGTTGG + Intergenic
1172066808 20:32227221-32227243 TCAGTCAAGAAGTATTGACCGGG + Intronic
1172772667 20:37390800-37390822 ACAGCCAGCAAGTGGTGAGCTGG + Intronic
1173118137 20:40265595-40265617 TAAGTCAATAGGCGTTGAGCAGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174625963 20:51914557-51914579 TAAGCCATTAAGTGTTGAGGTGG - Intergenic
1175653402 20:60748540-60748562 TCAACAAAGATGTGTTGAGCAGG + Intergenic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1180234260 21:46447822-46447844 TCTGCAAATGAGTGTTGGGCGGG + Intergenic
1180906651 22:19417664-19417686 TCAGGAAATAAGTGTTGATGAGG + Intronic
1183756505 22:39771358-39771380 TTAGCCAATTACTGTAGAGCTGG - Intronic
1184423253 22:44394120-44394142 GCACCCGATAAGAGTTGAGCAGG + Intergenic
1185300827 22:50079833-50079855 TCAGCAAATGTTTGTTGAGCTGG - Intronic
951464329 3:22985927-22985949 TAAGCCACTGAGTGTTGAGGTGG + Intergenic
953488510 3:43326407-43326429 TCAGCAAACTTGTGTTGAGCAGG + Intronic
960012198 3:112846584-112846606 TCAACAAATAAATGTTGGGCGGG - Intronic
960024098 3:112988681-112988703 TTAGCCAATAAGTGTAGATTGGG - Intergenic
960935531 3:122899098-122899120 ACAGACAAGCAGTGTTGAGCTGG - Intergenic
966889272 3:184395016-184395038 TCAGCTGATGGGTGTTGAGCAGG + Intronic
968861254 4:3172513-3172535 TGAGCCAAAAAGTGCTGCGCTGG - Intronic
969638040 4:8380762-8380784 TCAGGCCATGAGTGTTGTGCAGG - Intronic
972728166 4:41764773-41764795 TCAGCCACTAAGTTTTGGGGTGG + Intergenic
973611881 4:52643825-52643847 TCAGCCAATAAGAGCAGATCTGG + Intronic
975276418 4:72506524-72506546 TCAGCCATTCTGTGGTGAGCTGG - Intronic
976628824 4:87216993-87217015 ACAGCCAATAAGTGGAGATCTGG + Intronic
977169453 4:93742717-93742739 TCAGTCAATAAGTGTTATGTGGG + Intronic
983085728 4:163442068-163442090 TCAGCCTATGAGTGTTGACTTGG - Intergenic
988795812 5:34652803-34652825 TGAGCCAATTAGTGTTTTGCAGG + Intergenic
991093135 5:62712064-62712086 TCAGCCAATCATTTTTCAGCTGG - Intergenic
992245849 5:74821780-74821802 TAAGCCAATATGTTTTGGGCTGG - Intronic
992428299 5:76681545-76681567 ACAGAAAATAAGTGTTGAGAAGG + Intronic
995229901 5:109747912-109747934 ACAGCAAATAAGTGTTGATAAGG - Intronic
995571035 5:113482408-113482430 TCAGATAATAAGTGTTGACAAGG - Intronic
997043277 5:130282358-130282380 TTAGCCACTAAGTTTTGGGCTGG + Intergenic
999131478 5:149286845-149286867 ACAACCAGTAAGTGTGGAGCTGG + Intronic
1001115243 5:168933942-168933964 TCAACCAATACTTCTTGAGCAGG + Intronic
1001719994 5:173849095-173849117 TAAGCCACTAAGTTTTGAGATGG - Intergenic
1002781513 6:370240-370262 CCAGCCAAAAAATGGTGAGCTGG - Intergenic
1003369534 6:5510828-5510850 TGAGCCAATGAGAGATGAGCTGG + Intronic
1004735374 6:18400678-18400700 TCAACAAATATCTGTTGAGCAGG + Intronic
1005763209 6:28986569-28986591 TCAGTCAATACTTGTTGAACGGG + Intergenic
1014975808 6:127881120-127881142 CCAGTGAATAAGTGTTGAGATGG - Intronic
1017831543 6:158134933-158134955 TCAGCCAATAAGTGTTGAGCTGG + Intronic
1020705123 7:11534599-11534621 GCAGCCACTAAGTTTTGAGGTGG + Intronic
1021015615 7:15527545-15527567 CAAGCCAACAAGTGTTGATCTGG + Intronic
1021897999 7:25255695-25255717 TCAGCCAAAAAGGGTGGGGCGGG + Intergenic
1023280105 7:38560468-38560490 TCAGCCACTAAGTTTTGGGATGG + Intronic
1027299946 7:76821784-76821806 TGAGCCAATAATTCTTGGGCTGG + Intergenic
1027998677 7:85462585-85462607 TAAGCCAATAAGTTTTGGGGTGG + Intergenic
1028605281 7:92648666-92648688 TCATCCAATACGTATTGAACTGG - Intronic
1031523875 7:122800201-122800223 TGAACCAATAAATGTTGAGTAGG - Intronic
1033153607 7:138937487-138937509 TCAGCCATAAAGTTGTGAGCAGG - Intronic
1033502728 7:141968542-141968564 GCAGCAAAGAAGTGTTGAGCAGG + Intronic
1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG + Intergenic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1037788450 8:21916962-21916984 TCAGTAAATAATTGTTGAGGCGG - Intergenic
1038052635 8:23827913-23827935 TCAGCCACTCAGGGTAGAGCTGG - Intergenic
1038352344 8:26788708-26788730 TCAGCCAATAAGAGTGAAGCTGG + Intronic
1038552161 8:28479681-28479703 TCAGTAAATTACTGTTGAGCTGG + Intronic
1039292672 8:36113371-36113393 TCAGCCAATCCGTATTGATCAGG + Intergenic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1044804981 8:95996919-95996941 TAAGCTACTAAGTGTTGAGCCGG + Intergenic
1045182207 8:99796600-99796622 TAAGTCAATAAGTGTTGGGATGG - Intronic
1046179862 8:110630492-110630514 TAAGCCAATAAGTTTTGGCCTGG + Intergenic
1046217981 8:111174488-111174510 TCAGCCACTAACTTTTGTGCTGG + Intergenic
1046669672 8:117043888-117043910 TTATTCAATAAGTGTTGAGGAGG + Intronic
1047237450 8:123054379-123054401 TAAGCCAGTAAGTTTTGAGCTGG + Intronic
1052863942 9:33453717-33453739 TCAGCCACTGAGTGCTGATCCGG + Intergenic
1057454234 9:95193045-95193067 GCAGCCAACAAGAGTTGAGGTGG + Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1059549224 9:115211717-115211739 TCAGCCACTAGGTTTTGGGCTGG + Intronic
1060837892 9:126770963-126770985 ACAGCTAATAAATGTGGAGCTGG - Intergenic
1060985485 9:127816857-127816879 TCAGCCAATAACTGTGGGGATGG + Intronic
1196712955 X:118782374-118782396 TCAGCTAATAAGTGTAGAAATGG - Intronic