ID: 1017833882

View in Genome Browser
Species Human (GRCh38)
Location 6:158158789-158158811
Sequence AATGAGAAGCTCTATGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017833882 Original CRISPR AATGAGAAGCTCTATGTGGA CGG Intronic
901073137 1:6533861-6533883 AATTAGAGGCTATATGTGAAGGG - Intronic
901515287 1:9741186-9741208 AGTGTGACTCTCTATGTGGATGG - Exonic
902583339 1:17423104-17423126 AATGAGAGGCTCAGTGTGGTAGG + Intronic
902840901 1:19073302-19073324 AATGGGAATATCTATGTGGCGGG - Intergenic
904064074 1:27734886-27734908 AGAGGGAAGCTCTATGTGGAAGG + Intronic
904317688 1:29676471-29676493 AATGAGGATCTCTATGTGGGAGG - Intergenic
904917139 1:33978225-33978247 AATGAGATGCTCAATGTGGTGGG - Intronic
906684501 1:47754939-47754961 AATGAGCAGCTAGCTGTGGAAGG + Intergenic
908047787 1:60190320-60190342 AATGTGATCCTCAATGTGGAAGG + Intergenic
908378796 1:63574276-63574298 AATGAGAGGTTCTATGAGGCAGG + Intronic
909231346 1:73094071-73094093 AATGAGAATCTCTGTGTGTGAGG - Intergenic
909281568 1:73761568-73761590 AAAGAGAAGCACTATGGGCATGG + Intergenic
909691850 1:78417447-78417469 AATGCCAAGCTCTGTGAGGAAGG + Intronic
909733456 1:78925979-78926001 AATGGTAAGCACTATGTTGAGGG - Intronic
911967302 1:104384953-104384975 AATGAGAGGTTCTAAGAGGAGGG - Intergenic
912149326 1:106837833-106837855 AATGTGAAGATTAATGTGGAGGG + Intergenic
912394891 1:109334999-109335021 AATGATTAGCTCTAACTGGATGG + Intronic
917171765 1:172184510-172184532 AATGAGCAGCACAATCTGGAGGG + Intronic
918422034 1:184373905-184373927 AATGATAAGTTTTATGTGGTAGG - Intergenic
918427451 1:184425207-184425229 ACTGAGATGGTGTATGTGGAAGG + Intronic
919909316 1:202101119-202101141 AGAAAGAAGCTCTATGTTGAGGG - Intergenic
921533250 1:216311443-216311465 AATGAGAAACACCAAGTGGATGG - Intronic
921791528 1:219295925-219295947 AATGAGTAGGTCAATGTGGCTGG - Intergenic
922169353 1:223142280-223142302 AATGAGATGATCTGTTTGGACGG - Intronic
923358489 1:233183967-233183989 TAAGAGAAGCCCTAGGTGGATGG - Intronic
1062931062 10:1352996-1353018 AATGAGAGGTTCTAAGAGGAGGG - Intronic
1065165352 10:22970985-22971007 AATGAAAAGATTTCTGTGGATGG - Intronic
1068130140 10:52886364-52886386 AATGAGAAGGTCTATTTACATGG - Intergenic
1070266014 10:74903957-74903979 ACTGAGATACTCCATGTGGATGG + Intronic
1071371290 10:84954135-84954157 AATGTGGAGCTCTATCAGGAAGG - Intergenic
1072320034 10:94240161-94240183 ACAGAGAAGCTCTATTTGTATGG + Intronic
1073451249 10:103610734-103610756 AATGAGATGATTTATGTGGGGGG - Intronic
1073902266 10:108236318-108236340 AATGAGAAATTTGATGTGGAAGG + Intergenic
1074019338 10:109566619-109566641 AATGAGAAGTTCTAAGAGGTGGG - Intergenic
1074732348 10:116392540-116392562 AATCAGAAACTCTATGGGTAGGG + Intergenic
1074908966 10:117890077-117890099 AATGAGATGGTCACTGTGGATGG + Intergenic
1078554954 11:12317039-12317061 AAAGAGAAACTCTATGAGGTTGG - Intronic
1078936234 11:15952788-15952810 AATGAGAAGTTTTATGTGTGAGG - Intergenic
1079010244 11:16822241-16822263 AGTGAGAAACTCTTTGTGGCAGG - Intronic
1081446686 11:43137683-43137705 AATGAGAAGAGTTATATGGATGG + Intergenic
1082271892 11:50181133-50181155 AATCAGAAGCTCTATATTTAAGG + Intergenic
1084367696 11:68713417-68713439 AATGGGAAGCTCCATCAGGATGG + Intronic
1085989161 11:81819899-81819921 AATGATCAAATCTATGTGGAAGG - Intergenic
1086976038 11:93134045-93134067 AATGAGAATCTCTATGTGTTGGG - Intergenic
1087256353 11:95958960-95958982 AGTGAGAAGGTCTATGTTCAGGG - Intergenic
1087858501 11:103123778-103123800 AATGAGAAACGCTGTGTGGAAGG - Intronic
1087882794 11:103438431-103438453 AATTAGAAGCACTATTTGCAAGG + Intronic
1088084646 11:105962247-105962269 AATGATAAGTTATTTGTGGAGGG + Intronic
1088283648 11:108163481-108163503 AAGTAGAAACTCTATGTAGATGG + Intronic
1088612559 11:111591879-111591901 AATGAGAATTTCAAGGTGGAAGG - Intergenic
1089491487 11:118886891-118886913 AATGAGATGGTCCACGTGGACGG - Intronic
1091977822 12:4840079-4840101 AATGATAAACTCTATATGAAAGG + Intronic
1092414736 12:8281707-8281729 AATGAGAGGTTCTAAGAGGAGGG + Intergenic
1095509541 12:42935434-42935456 AATGAGAAGTTCTCTGTCCACGG - Intergenic
1100144428 12:91659929-91659951 AATGAGAAGAAATATATGGAAGG + Intergenic
1100664659 12:96738137-96738159 GATGAGGAGCCCTATTTGGAAGG + Intronic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1102045543 12:109828048-109828070 ACTGAGGAGCTCTTTGTGCAAGG + Intronic
1102116405 12:110406393-110406415 AATGAGAGGTTCTAAGAGGAGGG + Intergenic
1102142627 12:110628120-110628142 AAGGAGAAGCTCTCTCCGGATGG - Intronic
1102998338 12:117366360-117366382 AATCAGAAGCCCTGGGTGGACGG - Intronic
1106069871 13:26399435-26399457 AATCAGAAACTCTGTGAGGAGGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1108586211 13:51872007-51872029 TATTAGAAGCTCTGTGTGCATGG - Intergenic
1111841141 13:93453048-93453070 AATGATAAGCTCTATTTGCATGG + Intronic
1116702092 14:48256826-48256848 AATGAGAAGTTCTAAGAGGTGGG + Intergenic
1117479215 14:56126389-56126411 AGTGAGAAGCATTATGCGGATGG - Intronic
1118866179 14:69705448-69705470 AATGAGAAGCTCTAGGGGTGAGG + Intronic
1119461101 14:74804449-74804471 GTTAAGTAGCTCTATGTGGAGGG - Intronic
1120133353 14:80834037-80834059 AATGAGCAACTCCATTTGGAGGG + Intronic
1120552958 14:85893597-85893619 AATGACAGGCACTTTGTGGATGG - Intergenic
1120594181 14:86413745-86413767 GATGATAAGCTCCATTTGGAAGG + Intergenic
1121030320 14:90653249-90653271 AACGACAAGCTCTATGAAGATGG + Intronic
1122041266 14:98989251-98989273 AATGAGAGGTTCTAAGAGGAGGG - Intergenic
1123772060 15:23538879-23538901 AATGGGCAGCTGGATGTGGAAGG - Intergenic
1125400273 15:39294997-39295019 AATAATAAGCTCTCTGTGGGAGG + Intergenic
1128155942 15:65392034-65392056 GATGGGATGCTCTCTGTGGACGG - Intronic
1130467920 15:84201909-84201931 AATGAAGAGCTCTGTGGGGAGGG + Intergenic
1130496346 15:84471633-84471655 AATGAAGAGCTCTGTGGGGAGGG - Intergenic
1130590212 15:85206507-85206529 AATGAAGAGCTCTGTGGGGAGGG + Intergenic
1132418181 15:101639865-101639887 AATGAGAGCCTCTGTGTGCACGG + Intronic
1134754370 16:16653117-16653139 TATGAGAAGATCTTGGTGGAAGG + Intergenic
1134991691 16:18705917-18705939 TATGAGAAGATCTTGGTGGAAGG - Intergenic
1135859020 16:26038120-26038142 AATGAGGAGGACCATGTGGATGG - Intronic
1142170493 16:88619575-88619597 AATGAGCAGCTCTTTCTGGGGGG + Intronic
1142898402 17:2996865-2996887 AATGAGAAACTCAGTGTGAAGGG + Intronic
1143132270 17:4686442-4686464 AAGCAGAAACTCTATGTAGATGG - Intronic
1144083231 17:11783616-11783638 AGTCAGAAGCTCTAGGTGAAAGG - Intronic
1146018427 17:29252159-29252181 CATGAGACGCTCAATGTGGTAGG - Exonic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1149018799 17:51939220-51939242 AAAGAGAAGCTCTATTAGTATGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155303450 18:24455209-24455231 AATCAGGAATTCTATGTGGATGG - Intergenic
1156942516 18:42786695-42786717 AATGAGGAGCTCTATGTGACTGG - Intronic
1158121885 18:54057579-54057601 AATGAAAAGCACGATGTGTAAGG + Intergenic
1159675290 18:71276872-71276894 AATGTCAATCTTTATGTGGACGG - Intergenic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1164255562 19:23525124-23525146 AATCACAATCTCAATGTGGATGG + Intergenic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1165527602 19:36369213-36369235 ATTGAGAACCTCTATGTGTTGGG + Intronic
1166776391 19:45315464-45315486 GTGGAGAAGCTCTCTGTGGAAGG - Exonic
1167714156 19:51130348-51130370 AATGAGAAGCCCTACTTGCAAGG + Intronic
926301814 2:11610326-11610348 AATGTGCAGCTCTCTGAGGAGGG - Intronic
926463818 2:13165649-13165671 AATGAGAAGTTCTAAGAGGCAGG + Intergenic
928327964 2:30335041-30335063 AAAGAGAGGCTCTCTGTGGAAGG + Intergenic
929270856 2:39970383-39970405 AATCAGAACCTCTATGGGTAAGG - Intergenic
932433359 2:71688522-71688544 CTTGAGATGCTCTATGTGGCAGG + Intergenic
932888101 2:75565256-75565278 AATCAGAATCTCTATGAGTAGGG + Intronic
934737516 2:96697394-96697416 AATTAAAAGGTCTATGTGAAAGG + Intergenic
935685243 2:105677220-105677242 AAAGAGAAGTTGTATGTGGCCGG - Intergenic
936914911 2:117630379-117630401 AAGGAGGGCCTCTATGTGGACGG - Intergenic
937820921 2:126308989-126309011 AATGAGAAGCTCTGCTTAGAGGG - Intergenic
938735859 2:134186160-134186182 AAAGAGCAGTTCAATGTGGAAGG + Intronic
940512117 2:154628945-154628967 GATGAGAAGCTCTCTGAAGAAGG + Intergenic
941159348 2:162018395-162018417 AATGAGAAAATGTATGTGGCTGG - Intronic
944266787 2:197735945-197735967 AATGGGAAGTTCTTTGTGCATGG + Intronic
944278726 2:197870444-197870466 AATGAGAATCTCTTGGTGTAGGG + Intronic
947574400 2:231261114-231261136 AAAGAGAAGCTAGATGTGCAAGG - Intronic
1170101022 20:12699728-12699750 AAGAAGATGATCTATGTGGATGG + Intergenic
1170658772 20:18316067-18316089 AAGGAGAAGCCCTATGTGTGCGG + Exonic
1170755552 20:19202587-19202609 AATGAGAAGATATAGGTCGAAGG - Intergenic
1171435316 20:25117613-25117635 AATAAAAAGCTCTATTTAGATGG + Intergenic
1173317488 20:41958208-41958230 AATGAGCAGCTCTAGGCTGAAGG - Intergenic
1173418843 20:42882738-42882760 GATGAGAAGTTCTATGTGAATGG - Intronic
1173446955 20:43127741-43127763 AAAGAGAAACTCTTTTTGGAAGG + Intronic
1173862402 20:46292683-46292705 AATGAGAAGTTCTGTGTGACTGG - Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178085253 21:29105698-29105720 TCTTAGAAGCTCTGTGTGGAAGG + Intronic
1178293301 21:31387524-31387546 AAGGAGAGGCTGTATATGGATGG + Intronic
1183861902 22:40676440-40676462 AAAAAGAAGCTCTTTGTGGCAGG - Intergenic
952181894 3:30925522-30925544 AAGGAGACGCTCACTGTGGATGG + Intergenic
953834090 3:46328215-46328237 AATGAGAGGTTCTAAGAGGAGGG + Intergenic
956630042 3:71307684-71307706 CATTAGAAGCTCCATGGGGATGG - Intronic
960189947 3:114691919-114691941 AATGAAAAGCTCCTTGGGGAAGG - Intronic
960449506 3:117789210-117789232 AATGAGATAGTATATGTGGAAGG + Intergenic
961129966 3:124456960-124456982 AATGTGATGATCTATGAGGAAGG - Intronic
961221922 3:125207930-125207952 AAGGAGATGCCATATGTGGAAGG - Intronic
961489600 3:127245368-127245390 AGTGAGAGGCTCCATGTGGGTGG - Intergenic
961566191 3:127764849-127764871 AATGAGCTCCTCTATGTGGGGGG - Intronic
962218754 3:133545411-133545433 AGAGGGAAGCTCTACGTGGAAGG - Intergenic
962422012 3:135237418-135237440 AATGCAAAGCTCTGTGTGGAAGG + Intronic
963490098 3:145988984-145989006 AATGTGATCCTCTATGTTGAAGG + Intergenic
964134639 3:153330781-153330803 AATGGGTAGATCTATCTGGAGGG - Intergenic
965088983 3:164138839-164138861 AATGAAAAGCACTAGATGGAGGG + Intergenic
965556992 3:170028737-170028759 GATGAGAAGCGCTATTTCGAAGG + Intergenic
966196666 3:177320656-177320678 AATGAGGAGCACAATTTGGAGGG + Intergenic
966943235 3:184760001-184760023 CATGGGAAGTTCCATGTGGAAGG + Intergenic
967146879 3:186613787-186613809 AATGAGATAATCTATGTGAATGG - Intronic
967833778 3:193943880-193943902 AATGAGCAGCTGTATGGGGATGG + Intergenic
968389432 4:177125-177147 GATGACAAGCTCATTGTGGAAGG - Intergenic
968993649 4:3931426-3931448 AATGAGAGGTTCTAAGAGGAGGG - Intergenic
970693329 4:18644860-18644882 AAGAAGAAGACCTATGTGGATGG - Intergenic
972004230 4:34078609-34078631 AAAGAGAAGGACTATGTGGATGG + Intergenic
972008190 4:34138822-34138844 AAAGAGAAGCTTTCTTTGGAGGG - Intergenic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
974283865 4:59838338-59838360 ACTGAGAAACTCTCTGAGGAGGG - Intergenic
974570301 4:63637668-63637690 TATGAGAAGATTTCTGTGGAAGG - Intergenic
976106852 4:81628098-81628120 AATGAGAATCTCTGAGTGGTTGG - Intronic
976285390 4:83365990-83366012 AATGAGAAACTATAAGTTGAAGG - Intergenic
976382572 4:84416714-84416736 AATGATTAGCTCTATGTTGTAGG + Intergenic
976961625 4:90983009-90983031 AATGAGAAGGTCTAAGGAGAGGG - Intronic
976978037 4:91187390-91187412 AATGAGAAATTTTATTTGGACGG - Intronic
978606284 4:110483321-110483343 AATCAGAAGCTCTGTGTTTAAGG + Intronic
980115636 4:128676615-128676637 AATGAAAAGCTCTATGTTAGAGG - Intergenic
980829353 4:138111171-138111193 AATGAAAATCTCTATTTGTAAGG - Intergenic
981715285 4:147746082-147746104 AATAAGAAGCACTTTGTGGCAGG - Intronic
981820683 4:148883665-148883687 AATGAGAAGAGATATGTGAATGG + Intergenic
981958897 4:150511865-150511887 GATGAGAAGTTCTCTGTGGTGGG - Intronic
983302100 4:165939096-165939118 GATCAGAAGCTCTATGTGCATGG + Intronic
984101659 4:175494778-175494800 ATTGAGCCGCTCTATGGGGAAGG + Intergenic
986342539 5:6803149-6803171 AATGGGATGCACTAGGTGGAGGG + Intergenic
990720609 5:58691520-58691542 AATTAAAAGATCTGTGTGGAAGG + Intronic
990795854 5:59540038-59540060 AATCAGAAACTCTAGGTGGAAGG - Intronic
992246221 5:74826354-74826376 AATTAGAAGCTCTGTGTGTATGG + Intronic
992451669 5:76881570-76881592 AATGAGAAGTTCTAAGAGGCGGG + Intronic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993120464 5:83768060-83768082 AATCAGAAGCTGTATGTGGAGGG - Intergenic
993320451 5:86463128-86463150 GACTAGAAGCTGTATGTGGATGG + Intergenic
993338335 5:86689866-86689888 AATCAGAAACTCTATGGGTAGGG - Intergenic
994712171 5:103279290-103279312 AAGAAGAGGCTCTATGGGGATGG + Intergenic
995189368 5:109304247-109304269 AACCAGAAGCTCCTTGTGGATGG - Intergenic
995997054 5:118313556-118313578 AATGATGAGCACTATGTAGATGG + Intergenic
997166249 5:131662661-131662683 AATGAGAAGCTGTGCATGGAAGG - Intronic
999517701 5:152317559-152317581 AATCAAAAGCTGCATGTGGAAGG + Intergenic
999622246 5:153485386-153485408 AATGACATGCTCCATGTGAAGGG - Intergenic
1000356055 5:160396941-160396963 AATCAGAATCTCTATGGGTAGGG - Intronic
1001322551 5:170694672-170694694 AAAAAGAACCTCTCTGTGGATGG - Intronic
1002915016 6:1522092-1522114 ATTGAGAATCTCTATGTGCCAGG + Intergenic
1007168836 6:39848001-39848023 AATGAGAAGCTCTACTAGGGTGG - Intronic
1007308312 6:40924368-40924390 AAAGAGAAGCTCCATGCTGAAGG - Intergenic
1008329870 6:50232081-50232103 AATGAGATGTTGTATGTGGTAGG - Intergenic
1012148254 6:95713534-95713556 AATGAGAAGAGTTATGAGGATGG + Intergenic
1015554619 6:134448773-134448795 AATGAGGCTCTCTATATGGAAGG - Intergenic
1015569169 6:134604264-134604286 GAAGAGAAGCTCTGTGGGGATGG + Intergenic
1016478022 6:144449775-144449797 ATCGAGAAGCTCTGTGGGGAGGG + Intronic
1016580636 6:145626099-145626121 ATTGAGAGCCTCTATGTGCAAGG - Exonic
1016833161 6:148452789-148452811 AGTGATAAGCTCTGTGTGTATGG - Intronic
1017270186 6:152495085-152495107 AATGAGAGGTTCTAAGAGGAGGG - Intronic
1017833882 6:158158789-158158811 AATGAGAAGCTCTATGTGGACGG + Intronic
1018084223 6:160288234-160288256 AATGAGAAGTTCTAAGAGGCGGG + Intergenic
1018287004 6:162251344-162251366 CCTGAGAATCTCTATGTTGAAGG - Intronic
1020371919 7:7441660-7441682 AATCAGAAACTCTGGGTGGAGGG - Intronic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021022844 7:15625213-15625235 AATAAAAAGGTGTATGTGGAGGG - Intronic
1022177774 7:27888496-27888518 ATTTAGAAGCTCTATCTGAATGG - Intronic
1022543291 7:31159984-31160006 ATAGAGAAACTCTATGTGGAAGG - Intergenic
1022601882 7:31768623-31768645 AAAGAGAAGCTATAGATGGAAGG - Intronic
1023570226 7:41564238-41564260 AAGGAGAAGGTCTTTGAGGAAGG + Intergenic
1023669995 7:42565735-42565757 AATGAAAAGCTGTATGTGAATGG - Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1029896166 7:103987692-103987714 AATGAGAATCTTTAAGTGGAAGG - Intronic
1030636317 7:111953336-111953358 AATGAGAAGAGCTAAGAGGATGG + Intronic
1031073323 7:117187047-117187069 AACAAGATGCTCTATGTGAAGGG + Intronic
1032279210 7:130487235-130487257 AATGAGATGATATATGTGAAAGG + Intronic
1032876727 7:136045965-136045987 AATGTGAAGCAATATGTAGAGGG + Intergenic
1034457105 7:151176526-151176548 GATGAGAAGCTCTATGTTCAGGG + Intronic
1037198065 8:16216131-16216153 AATGATAAGTTATATCTGGAAGG + Intronic
1037219376 8:16499215-16499237 AATAAAAAGCTTTTTGTGGAAGG - Intronic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1039165386 8:34673689-34673711 AAAGACCAGCTTTATGTGGAAGG + Intergenic
1039535026 8:38302155-38302177 TAAGAGAAAATCTATGTGGAGGG + Intronic
1039752770 8:40493478-40493500 AATGAGAAGCTCTGACTGAAGGG + Intergenic
1039758622 8:40549948-40549970 AATGACAAGCTCAATATGGCAGG - Intronic
1039997833 8:42549626-42549648 GATGAGAAGAGCTCTGTGGATGG + Intronic
1040578269 8:48673629-48673651 GATGAGAAACCCAATGTGGATGG - Intergenic
1041154845 8:54974571-54974593 AATGAGAACATGTATGTGGAGGG + Intergenic
1041337312 8:56800855-56800877 AATGTGAACATCTTTGTGGAGGG - Intergenic
1042280295 8:67049088-67049110 AATGAGCAGCTTCATGTTGATGG + Intronic
1042520317 8:69704617-69704639 AATGGGAAGAGCTAGGTGGATGG + Intronic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1043298139 8:78692704-78692726 AATTAGAAGCTCAATGTTGGAGG - Intronic
1043745311 8:83868174-83868196 CAGAAGAAGCTCTGTGTGGAAGG - Intergenic
1043780385 8:84326919-84326941 AATAGGAAGTTCTATGAGGAAGG + Intronic
1044278131 8:90325715-90325737 AATGGGAAACTATATGTGTAAGG - Intergenic
1046607249 8:116385027-116385049 ATTTAGAAGCTCTGTTTGGATGG - Intergenic
1047050106 8:121101471-121101493 AATGAAAAACCCTATTTGGAAGG - Intergenic
1047569523 8:126082872-126082894 AACCTGAAGCTCTATGTGAAAGG - Intergenic
1047694566 8:127390654-127390676 AATGAGATGATCTATGTTGAAGG - Intergenic
1047829273 8:128613570-128613592 AATGAGAAGTTCTAAGAGGCAGG + Intergenic
1047832198 8:128647049-128647071 ACTTATGAGCTCTATGTGGACGG + Intergenic
1047836667 8:128701193-128701215 AATTTGAAACTCTAAGTGGATGG + Intergenic
1049999480 9:1061268-1061290 GATGAAAAGCGTTATGTGGATGG - Intergenic
1050000577 9:1073104-1073126 AAAGAGAAGCTATAAGGGGAAGG - Intergenic
1050265552 9:3885668-3885690 AATGAGAAGCCCCATGTGAATGG + Intronic
1055336839 9:75240250-75240272 GGTGAGAAGATCTTTGTGGAAGG + Intergenic
1056880825 9:90391834-90391856 AATGAGAACCTCTGAGTGGTGGG + Intergenic
1056923891 9:90815864-90815886 AATTATCACCTCTATGTGGAAGG - Intronic
1056928052 9:90851407-90851429 AAACAGAGGCTCTTTGTGGAGGG + Intronic
1057975017 9:99596156-99596178 AATGGGAAGCTCTATAATGAAGG - Intergenic
1059538409 9:115106094-115106116 AATGTGAAGCTCTATGTTAGAGG + Intronic
1059863186 9:118487116-118487138 AATGAGAAGTTCTAAGAGGCGGG + Intergenic
1060226477 9:121794383-121794405 AATGAGAGGTTCTATGAGGCAGG - Intergenic
1060577876 9:124714280-124714302 TATGAGAAGAGTTATGTGGATGG + Intronic
1060920218 9:127415120-127415142 AATGAGAGGTTCTATGAGGCTGG + Intergenic
1062727287 9:138082752-138082774 AAGGACAAGCACTAGGTGGAAGG - Intronic
1187567306 X:20464074-20464096 ACTGAGAAGCTTAATGTGGTTGG + Intergenic
1188552970 X:31381765-31381787 AATGAGAAGTTCTAAGAGGCAGG - Intronic
1188613300 X:32125966-32125988 AATCAGAAGCTCTATGGCTAGGG + Intronic
1189070224 X:37855966-37855988 AATGAGAAGATAAATGTGCAAGG - Intronic
1190639130 X:52465988-52466010 CATGATAAGCTCTTTGTTGATGG - Intergenic
1192245419 X:69367818-69367840 TAGGAGAAGGTCTATGTGAAAGG - Intergenic
1192285447 X:69730196-69730218 AATGAGAGGGTCTTTGAGGATGG + Intronic
1192589029 X:72344658-72344680 AATGGGAAGCTCTTGGGGGAGGG - Intronic
1192794663 X:74417007-74417029 ACTGAGAACCTCTATGTGTCAGG - Intergenic
1194974194 X:100376792-100376814 AATGAGAAGCTACATGAAGAAGG + Intronic
1196703677 X:118698247-118698269 TATGAGAGGCTCTCTATGGAGGG - Intergenic
1197328822 X:125128074-125128096 AAGGACAAGCTTTTTGTGGAGGG - Intergenic
1197883639 X:131194839-131194861 AATGAGATAATGTATGTGGAAGG + Intergenic
1200749644 Y:6933233-6933255 AATGAGTATCTCTATGTGCTTGG + Intronic
1201406329 Y:13653747-13653769 CATGAAAAGCTCTAGGTGGGAGG - Intergenic