ID: 1017840764

View in Genome Browser
Species Human (GRCh38)
Location 6:158220986-158221008
Sequence GAGGACCAGAGACAATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017840764_1017840771 10 Left 1017840764 6:158220986-158221008 CCTGGCCATTGTCTCTGGTCCTC No data
Right 1017840771 6:158221019-158221041 GTGTTGGCTGTGTCCTCTCACGG No data
1017840764_1017840772 18 Left 1017840764 6:158220986-158221008 CCTGGCCATTGTCTCTGGTCCTC No data
Right 1017840772 6:158221027-158221049 TGTGTCCTCTCACGGCCACAAGG No data
1017840764_1017840773 21 Left 1017840764 6:158220986-158221008 CCTGGCCATTGTCTCTGGTCCTC No data
Right 1017840773 6:158221030-158221052 GTCCTCTCACGGCCACAAGGTGG No data
1017840764_1017840767 -6 Left 1017840764 6:158220986-158221008 CCTGGCCATTGTCTCTGGTCCTC No data
Right 1017840767 6:158221003-158221025 GTCCTCCGGCCTCACTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017840764 Original CRISPR GAGGACCAGAGACAATGGCC AGG (reversed) Intergenic
No off target data available for this crispr