ID: 1017840767

View in Genome Browser
Species Human (GRCh38)
Location 6:158221003-158221025
Sequence GTCCTCCGGCCTCACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017840764_1017840767 -6 Left 1017840764 6:158220986-158221008 CCTGGCCATTGTCTCTGGTCCTC No data
Right 1017840767 6:158221003-158221025 GTCCTCCGGCCTCACTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017840767 Original CRISPR GTCCTCCGGCCTCACTGTGT TGG Intergenic
No off target data available for this crispr