ID: 1017858056

View in Genome Browser
Species Human (GRCh38)
Location 6:158368712-158368734
Sequence CAGGGTATACAGCCTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017858049_1017858056 -3 Left 1017858049 6:158368692-158368714 CCCAGTTATGAAAGCAATTTCAG 0: 1
1: 0
2: 2
3: 25
4: 361
Right 1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG 0: 1
1: 0
2: 2
3: 13
4: 271
1017858050_1017858056 -4 Left 1017858050 6:158368693-158368715 CCAGTTATGAAAGCAATTTCAGG 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG 0: 1
1: 0
2: 2
3: 13
4: 271
1017858047_1017858056 11 Left 1017858047 6:158368678-158368700 CCTCACAGATCCATCCCAGTTAT 0: 1
1: 0
2: 1
3: 6
4: 164
Right 1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG 0: 1
1: 0
2: 2
3: 13
4: 271
1017858048_1017858056 1 Left 1017858048 6:158368688-158368710 CCATCCCAGTTATGAAAGCAATT 0: 1
1: 0
2: 2
3: 7
4: 214
Right 1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG 0: 1
1: 0
2: 2
3: 13
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017858056 Original CRISPR CAGGGTATACAGCCTGGGGA TGG Intronic
900181394 1:1312574-1312596 CAGGGTATGCGGGCTGGGCAGGG - Exonic
900933487 1:5751074-5751096 CAGTGTCTGGAGCCTGGGGAGGG + Intergenic
901378309 1:8855550-8855572 CAGAGTAGGCTGCCTGGGGAAGG + Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
902724163 1:18324041-18324063 CAGGTTGTACAGCCTGGGAGTGG - Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904457016 1:30653945-30653967 CTGAGCATACAGGCTGGGGAGGG - Intergenic
905416788 1:37809074-37809096 CAGGGTATTCTGCTCGGGGATGG - Exonic
906253868 1:44332493-44332515 AAAGGTATAAACCCTGGGGAAGG + Intronic
906806488 1:48783703-48783725 CAGGGGATAGGACCTGGGGATGG - Intronic
907643887 1:56221246-56221268 TTGGGTATTCAGTCTGGGGAAGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
911115078 1:94237927-94237949 CAGGGGTTAGGGCCTGGGGAAGG + Intronic
912195638 1:107394106-107394128 CTGGGCATCCAGCCTGGGCAGGG - Intronic
912982043 1:114383634-114383656 CAGTGTATACTGCTTGGTGATGG + Intergenic
913123659 1:115765486-115765508 CAGGTGTTTCAGCCTGGGGATGG + Intronic
913231633 1:116744966-116744988 CAGGGCATTCAGACTGGGAATGG - Intergenic
913289958 1:117262837-117262859 CTGGGTCTACAGGCTGGGGTGGG - Intergenic
913997859 1:143666045-143666067 GAGGATGTGCAGCCTGGGGATGG + Intergenic
916060740 1:161097084-161097106 CAGAGAACACAGCATGGGGATGG - Intergenic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
917208198 1:172600600-172600622 CAGGGTTTACGTCCTGGGGGAGG + Intronic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
919571360 1:199253018-199253040 CAGTGTACACTGCTTGGGGAGGG - Intergenic
919847723 1:201651978-201652000 GAGGGTAGACTGCCTGGGGGAGG + Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920308543 1:205034287-205034309 CAGGGCACACAGCATGGAGAGGG - Intergenic
921222200 1:212981171-212981193 CAGAGTCTCCTGCCTGGGGAGGG + Intronic
921972010 1:221160100-221160122 TAGGGTTTACAGTCTGGAGAAGG + Intergenic
922549083 1:226480770-226480792 CAGGGTCTCCAGCTTGCGGATGG + Intergenic
922977019 1:229793599-229793621 CAAGGTTCACAGGCTGGGGAAGG + Intergenic
923339659 1:232996498-232996520 CAGAGTAAACAGCATGGGGTGGG + Intronic
923616904 1:235545715-235545737 CTGGGCCTACATCCTGGGGACGG + Intergenic
924143501 1:241050180-241050202 CAGGATAAAAAACCTGGGGAAGG - Intronic
1063366113 10:5491927-5491949 CTGGGTACACTGCCTGTGGAAGG - Intergenic
1063827212 10:9911242-9911264 CAGGGTCTCCAGCTTGTGGATGG + Intergenic
1065334259 10:24639619-24639641 CAAGGAATACTGCCGGGGGAGGG + Intronic
1065386396 10:25137974-25137996 CTGGGTCTACAGCTTGTGGATGG - Intergenic
1066986774 10:42475359-42475381 CAGGGTATAGATGCTGGGGTGGG - Intergenic
1067550486 10:47231103-47231125 CAGGGCATAAAGCCTTTGGAAGG - Intergenic
1069069305 10:63977228-63977250 CAGAGATGACAGCCTGGGGAAGG - Intergenic
1069953988 10:72038610-72038632 CAGCGTCAACAGACTGGGGAAGG + Intergenic
1070126437 10:73625868-73625890 CAGGGGGTAGCGCCTGGGGAGGG - Intronic
1070808989 10:79288077-79288099 GAGGGTATCCAGGCAGGGGAGGG + Intronic
1072277786 10:93839826-93839848 CAGGGTCTACAGCTTGCAGATGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074773024 10:116745483-116745505 CACAGTCTACAGCCTGTGGAGGG - Intergenic
1075099554 10:119496488-119496510 CAGGGTAAACAGGCTTCGGACGG - Intergenic
1076352347 10:129825893-129825915 CAGGCTATCCCACCTGGGGAGGG + Intergenic
1076352366 10:129825943-129825965 CAGGCTATCCCACCTGGGGAGGG + Intergenic
1076627523 10:131831176-131831198 CAGGGAATACAGCCCGAGGCTGG - Intergenic
1077329998 11:1979996-1980018 CGGGGTCTCCAGCATGGGGAGGG + Intronic
1081546232 11:44073811-44073833 CTGGGTTTAAAGCATGGGGAGGG + Intronic
1083422270 11:62560768-62560790 CATGGAAAACAGCCTGGGGAGGG - Intronic
1083513949 11:63238357-63238379 CTGGGTGTACAGTCTGGGCATGG + Intronic
1083741655 11:64714458-64714480 CAGGGTAACCAGACTGGGAAGGG + Intronic
1084486216 11:69449786-69449808 CCGGGTCCACTGCCTGGGGATGG + Intergenic
1084693168 11:70738708-70738730 CAGGGGACATAGCCTGGAGACGG - Intronic
1084710740 11:70842440-70842462 CAGGTTATGCAGCCTGGCCAAGG - Intronic
1085338754 11:75717793-75717815 CAGCTTCTACAACCTGGGGAGGG + Intergenic
1085383708 11:76143316-76143338 CAGGGCATCCAGCCTGGCGCTGG + Intergenic
1085445316 11:76597439-76597461 CTGGGTAGAGAGCCTGGGCAGGG - Intergenic
1086414463 11:86574983-86575005 CAGGTTGTCCAGCCTGGGCAGGG + Intronic
1087671726 11:101114793-101114815 CAAGGAAAACAGTCTGGGGATGG - Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1090247336 11:125225657-125225679 CAGGGTTTCCAGTCTGGGGCTGG + Intronic
1091002086 11:131918198-131918220 GAGGGCTCACAGCCTGGGGATGG - Intronic
1202812975 11_KI270721v1_random:35175-35197 CGGGGTCTCCAGCATGGGGAGGG + Intergenic
1091820191 12:3470462-3470484 CATGGTAGACAGCCTGGGGAAGG - Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1093769644 12:23003665-23003687 AAAGGTGGACAGCCTGGGGAGGG - Intergenic
1094701235 12:32872621-32872643 CAGGGGAACCAGCCTGGGCAGGG - Intronic
1095466250 12:42490661-42490683 CGGGGTGTACAGTCTGGGTAGGG + Intronic
1101998656 12:109543034-109543056 CATGGTATCTAGCCTGGGCAGGG - Intergenic
1103529744 12:121592676-121592698 CAGGGCTTACAGTCTGGTGAAGG - Intergenic
1104744086 12:131200051-131200073 CAGGGTTCACATCCTGGGGCTGG - Intergenic
1104984508 12:132589074-132589096 CAGGCTCTACACGCTGGGGAAGG + Intergenic
1105284170 13:18991359-18991381 AAAGGGATATAGCCTGGGGATGG - Intergenic
1106469618 13:30042771-30042793 CAGGCAGTACAGCCTGAGGAGGG + Intergenic
1108163967 13:47672633-47672655 CAGAGTTTACAGCAAGGGGAGGG + Intergenic
1108691965 13:52867231-52867253 CAGGATGTACAGCCTGGTCAGGG - Intergenic
1109747585 13:66647246-66647268 CAAGCTGTACAGCCTGGGGATGG - Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113220997 13:108102506-108102528 CAGAATATAGACCCTGGGGAAGG - Intergenic
1113808576 13:113123827-113123849 CAGGGGACAGAGGCTGGGGAGGG - Intronic
1121227806 14:92334246-92334268 CAGGATGTCCAGCCTGGAGAGGG + Intronic
1124401725 15:29354310-29354332 CAGGGTCTCCAGCCTGGAGATGG + Intronic
1126534092 15:49741971-49741993 CAAGCTACACAGCCTGGGGATGG - Intergenic
1128260500 15:66229631-66229653 CAGAGTATGCAGCCTCGGAAGGG - Intronic
1128921067 15:71610721-71610743 CACTTTATACAGCATGGGGAAGG - Intronic
1129671765 15:77611657-77611679 CAGGGGATAAAGCCTGAGAAAGG + Intergenic
1130547998 15:84870292-84870314 CTGGGTATACAGGCTGGGAGAGG - Exonic
1130915696 15:88302817-88302839 CAGGGGATGCAGTTTGGGGATGG + Intergenic
1131372251 15:91892396-91892418 CAGGGTACATGGCCTGGGCAGGG - Intronic
1131472447 15:92708850-92708872 CAGGGAGTACAGCCTGGAGGAGG - Intronic
1131538851 15:93259435-93259457 CAGTGTATACAGCATTGGGATGG - Intergenic
1138556331 16:57773041-57773063 CAGGGTCTAGGGCCTTGGGAGGG - Intronic
1139435853 16:66935973-66935995 CCGGGTAGGCAGCCTGGGGTCGG + Intronic
1139438234 16:66949021-66949043 CCGGGTAGACAGCCTCGGGTCGG + Intergenic
1140867250 16:79074063-79074085 GAGTGTATACAGGCTGAGGATGG + Intronic
1143544456 17:7588293-7588315 AAGGGTTGACAGCCTGGGGTAGG + Exonic
1144830649 17:18129286-18129308 CAGGGCATAAAGCCAGCGGATGG - Intronic
1146399467 17:32491906-32491928 CAGGGTGCAGGGCCTGGGGAGGG - Intergenic
1146936927 17:36817825-36817847 CAGTGACTCCAGCCTGGGGAGGG + Intergenic
1146938001 17:36824443-36824465 CATGGTCTCAAGCCTGGGGAAGG + Intergenic
1147669302 17:42167609-42167631 GAGGGTATAGTGCCTGGGGGAGG - Intronic
1149493580 17:57102450-57102472 CAAGGCATACAGCCAAGGGATGG - Intronic
1151360712 17:73587179-73587201 CAGGCTCTAGAGCCTGGAGATGG - Intronic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1152686209 17:81695017-81695039 CCGGCTGCACAGCCTGGGGAAGG + Exonic
1153749818 18:8217621-8217643 CAGTGTAGCCAGCCTGCGGAAGG - Intronic
1155361503 18:25007587-25007609 CTGGGTATGCAACCTTGGGAAGG - Intergenic
1156241789 18:35261946-35261968 CAGGGTATGATGCCTGGGGAAGG + Intronic
1158273531 18:55742193-55742215 CAGAGGACACAGCCAGGGGAGGG - Intergenic
1158294736 18:55983320-55983342 CTGGGTATTCATCCTAGGGAAGG + Intergenic
1158555646 18:58472555-58472577 AAGGATAAAGAGCCTGGGGAGGG + Intergenic
1161031659 19:2060567-2060589 CAGGGTGCACATCCTGGGAAGGG + Intergenic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1161957856 19:7506349-7506371 CAGGGGATGAAGCCGGGGGAGGG - Intronic
1162671410 19:12260650-12260672 CTGGGTTTACATCCTGGGCAAGG - Intronic
1165100483 19:33435882-33435904 CAGTGTTTACAGCCCTGGGAAGG - Intronic
1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG + Intergenic
1166322666 19:42028332-42028354 CAGGGTATACAGGATGGGTTGGG - Intronic
1167214662 19:48156543-48156565 CAGGTCATACAGCCAGTGGATGG + Intronic
925238870 2:2304242-2304264 CAGGGGATACAGTCTGGTGTTGG + Intronic
925707553 2:6701504-6701526 AAGGGCATTCACCCTGGGGAAGG + Intergenic
926627300 2:15102934-15102956 CAGGGTATACAGATTTTGGAGGG + Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
932024448 2:68119511-68119533 CAAGGTAAACAGCCTAGGGCAGG + Intergenic
936088151 2:109483777-109483799 CAGCGCCTGCAGCCTGGGGAGGG - Intronic
936088913 2:109488492-109488514 CAGGGCATAAGGCCTGGGGATGG - Intronic
936324993 2:111497436-111497458 CAGGCTTTGCAGCCTTGGGAAGG - Intergenic
936590281 2:113797029-113797051 CAGGGTATATACCATAGGGAAGG - Intergenic
938201072 2:129373467-129373489 CAGGGGATGCAGCCTGTGGGAGG + Intergenic
940116706 2:150217527-150217549 CAGGGATTAGAGACTGGGGATGG - Intergenic
947459640 2:230292657-230292679 AAGTGTATACAGACTGAGGATGG + Exonic
947469943 2:230392098-230392120 AAGTGTATACAGACTGAGGATGG + Exonic
947524206 2:230868635-230868657 CCAGGTATGCAGGCTGGGGAGGG - Intronic
948928980 2:241118775-241118797 CAGGGCAGACAGCCTGGCCAAGG + Intronic
948997183 2:241587483-241587505 CAGGGTTTCCAGCTTGTGGAGGG + Intronic
1168774253 20:434904-434926 CAGGGCCTCCACCCTGGGGATGG - Intergenic
1169906221 20:10607504-10607526 CAGGGCAGTCAGCCTTGGGAGGG - Intronic
1171892591 20:30729254-30729276 CAGGGCACACAGCCTCGGGCAGG + Intergenic
1175442132 20:58999668-58999690 CAGCCTATATAGCCTGGGGCAGG + Intronic
1175763860 20:61579623-61579645 CAGGGAACACAACCTGGGGCTGG - Intronic
1178237292 21:30857663-30857685 GAGGGTAGAGTGCCTGGGGAGGG - Intergenic
1179438428 21:41377545-41377567 CAGGGTGTGCCTCCTGGGGAGGG - Intronic
1180067672 21:45420737-45420759 CAGGGAAGGCAGCCTGGAGAAGG + Intronic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1180595367 22:16969644-16969666 AAGGGTATTCCGCCTGGGGATGG + Intronic
1180999735 22:19982419-19982441 CAGGCCATGCAGCTTGGGGAGGG - Intronic
1181048827 22:20229113-20229135 CAGGGGACACAGGCTGGGGGAGG + Intergenic
1181860457 22:25813864-25813886 CAGGGTCTGCAGCCGTGGGAAGG - Intronic
1182152057 22:28034729-28034751 CAAGGTATACCTCCTGGCGAGGG + Intronic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183377898 22:37475714-37475736 GAGGGCATGCAGGCTGGGGAGGG - Intronic
1183973973 22:41499536-41499558 CAAGGAACACAGCCTGGGGTAGG - Intronic
1184334690 22:43846167-43846189 CAGTGTCGGCAGCCTGGGGAAGG - Intronic
1184766682 22:46576142-46576164 CAGGGGACCCAGTCTGGGGAGGG + Intronic
1184851005 22:47120581-47120603 CAGGGTAGAAGGCCTGGGGCTGG + Intronic
1185201557 22:49509164-49509186 CAGGGTATCCAGCTTGCAGACGG - Intronic
950004306 3:9681871-9681893 CAGGAACTACAGGCTGGGGAGGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950762801 3:15248700-15248722 TAGAGAATACAGCCTGGGCATGG + Intronic
954133985 3:48573658-48573680 CAGGGAACACTGCCTGGTGAGGG - Intronic
954389978 3:50263664-50263686 CCAGGGATACAGCCTGGGGGAGG + Intergenic
954427696 3:50452077-50452099 CTCGGGGTACAGCCTGGGGAGGG - Intronic
954586080 3:51737934-51737956 GAGGGCATTCAGGCTGGGGATGG - Intergenic
956651916 3:71512227-71512249 CAGGATATAGGGCCTGGCGAAGG + Intronic
957476041 3:80725557-80725579 CAGTGTATACTGCTTGGTGATGG - Intergenic
959366982 3:105473403-105473425 CATGGGATACAGGCTGGAGAAGG - Intronic
961014792 3:123459249-123459271 CTGTGTCTACAGCCTGGGGGAGG + Intergenic
961332828 3:126153176-126153198 CAGGGCACTCAGCCTGGAGATGG + Intronic
961432459 3:126892659-126892681 AAGGGAATACAGTCTGGAGAAGG - Intronic
963662222 3:148141458-148141480 CAGAGATTACAGGCTGGGGAGGG + Intergenic
964811084 3:160665385-160665407 GAGGGGACACAGTCTGGGGATGG + Intergenic
966331929 3:178824204-178824226 TAGTGTATAAAGCTTGGGGATGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966883070 3:184360760-184360782 CAGGGGACACACCCTGGGGTGGG + Intronic
966982981 3:185154399-185154421 CAGTGAATCCAGCCTGGGGTCGG - Intergenic
967683707 3:192395707-192395729 CAGGGTATAAAGCCTGGGGCAGG + Intronic
968541822 4:1171886-1171908 CAGGGGGTACTGCTTGGGGAAGG + Exonic
968757135 4:2422643-2422665 CAGGGTATACACCCAGGAAAAGG - Intronic
969858258 4:10017103-10017125 CAGGGAAGACAGCCTGGAGGAGG - Intronic
970018840 4:11543917-11543939 CAGGGAAAACAACCAGGGGAAGG - Intergenic
975170507 4:71227266-71227288 CAGGGTGTATGGCATGGGGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
981830095 4:148989499-148989521 CTGGAAATAGAGCCTGGGGAAGG + Intergenic
981953977 4:150447551-150447573 CAGGGTCTCCAGCCTGCAGATGG + Intronic
982227569 4:153180436-153180458 CAGGGCACACAGCCTGTGAAAGG + Intronic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986726439 5:10601561-10601583 CAGGACATTCAGTCTGGGGAAGG - Intronic
990389766 5:55307350-55307372 CAGGGCAGACAGCCAGGGGCTGG + Intronic
991643215 5:68775064-68775086 TAGGGAATCCATCCTGGGGAAGG - Intergenic
993902792 5:93595910-93595932 CAGAGTATGCGGCCCGGGGAGGG - Intergenic
994438155 5:99764085-99764107 CAGTGGGTACAGCCTGTGGAAGG - Intergenic
994934354 5:106234653-106234675 CAGGGTAAAAGGCCTGGGCATGG - Intergenic
996302865 5:122008490-122008512 CATGGTTTACTGCCTGGGGTTGG + Intronic
996396997 5:123023089-123023111 CAGGCTATAAGGCCTGGGTATGG - Intronic
996779493 5:127170661-127170683 CAGGGTGATCAGCCTGGTGAGGG - Intergenic
997844693 5:137275983-137276005 CAGTGTGAACAGCCTGGGCAGGG - Intronic
998849339 5:146338804-146338826 CCGGGTATAAAGGCTGTGGAGGG + Intronic
1000343928 5:160298526-160298548 CTGGGCCTACAGTCTGGGGAGGG + Intronic
1000367118 5:160502023-160502045 CAGGGTACACTGCTTGGTGATGG - Intergenic
1000423324 5:161062145-161062167 CAGGGTTTTCAGCTTGGAGATGG - Intergenic
1000802771 5:165749264-165749286 GAAGGTATACAGGGTGGGGAAGG - Intergenic
1001207797 5:169780200-169780222 CAGAGTTTACAGCTAGGGGAAGG - Intronic
1001415118 5:171540192-171540214 CAGGGAAGACAGCCTGGAGGAGG - Intergenic
1001718076 5:173833585-173833607 AAGGGTAGTCAGCCTGGAGAAGG - Intergenic
1001810446 5:174623524-174623546 CAGGCAAGCCAGCCTGGGGAAGG - Intergenic
1001843153 5:174897738-174897760 CAGGTTATACAGCTGGGAGAGGG - Intergenic
1002074755 5:176701618-176701640 GAGGGTAACCAGCCTGGGGATGG - Intergenic
1002184791 5:177449268-177449290 CAGTGTACACAGCCTGGAGGCGG - Intronic
1002640974 5:180630476-180630498 CAGGGTCCACAGGCTGGGGGCGG + Intronic
1002997149 6:2297518-2297540 TAGGGTATACAGGCTGGGCTGGG + Intergenic
1003536790 6:6982307-6982329 GAGGGTATGCAGGCTGGGGCAGG + Intergenic
1004911864 6:20293502-20293524 CAGGCTATAGAGACTTGGGAGGG + Intergenic
1006605095 6:35250370-35250392 CAGGACATACCACCTGGGGATGG + Exonic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1009396919 6:63210937-63210959 GAGGGTATACAGTGTGGAGATGG - Intergenic
1011945205 6:92891345-92891367 CATGTTATACTGCCTGGGGTTGG + Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1013119701 6:107130497-107130519 TAGGGTAAACAGCCTCTGGATGG + Intergenic
1015587075 6:134787094-134787116 CAGAATACACATCCTGGGGATGG + Intergenic
1015706067 6:136088965-136088987 AAAGGCATACAGGCTGGGGATGG - Intronic
1016307207 6:142696805-142696827 CAGGGTAAACAACCTGGGGCAGG - Intergenic
1017001192 6:149999016-149999038 CAGGGTACAGAGCCAGGGGTAGG - Intergenic
1017454404 6:154587535-154587557 AAGGGGATACAGGCTGGGCACGG + Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1018051357 6:160011696-160011718 GAGGGAATCCAGGCTGGGGAAGG - Intronic
1018148573 6:160917558-160917580 TAGGGTAGAGAGGCTGGGGAAGG - Intergenic
1018955893 6:168410543-168410565 AAGGGCAAACAGCCTCGGGACGG - Intergenic
1019983313 7:4637704-4637726 CGTGGGGTACAGCCTGGGGACGG - Intergenic
1020082872 7:5296125-5296147 CCGGGAGTGCAGCCTGGGGACGG - Intronic
1020415947 7:7945917-7945939 TAGGCTGTACAGCCTTGGGAAGG - Intronic
1025211396 7:57021063-57021085 CCGGGAGTGCAGCCTGGGGACGG + Intergenic
1025660557 7:63555784-63555806 CCGGGAGTGCAGCCTGGGGACGG - Intergenic
1026853274 7:73737833-73737855 CTGGGGATACACCCTGTGGAGGG + Intronic
1027685395 7:81274104-81274126 CAGGATATGCAGCCTGGAGTCGG + Intergenic
1029043192 7:97599124-97599146 CAGAGTGTACAGCTTTGGGAGGG + Intergenic
1029216195 7:98951914-98951936 CAGGAGACACAGCCTGGAGAAGG - Intronic
1029576069 7:101404170-101404192 GAGGCAAGACAGCCTGGGGAAGG + Intronic
1030124763 7:106143404-106143426 CATGGTACACATCCTGGGGTAGG + Intergenic
1032107952 7:129050693-129050715 CAGGGAATGAAGCCAGGGGATGG - Intronic
1032849575 7:135782601-135782623 CAGGGAAGACAGCCTTGGCAAGG - Intergenic
1033461453 7:141550893-141550915 CAGGGGAGAGAGCCTGGAGAGGG - Intergenic
1034412064 7:150947042-150947064 CCGGGTCTCCAGCCTGGGGCAGG + Exonic
1034543686 7:151776313-151776335 CGGGGTAGACAGCCAGGGGCCGG - Intronic
1035580136 8:734644-734666 CAAGGTATACAGATTGGGAAGGG + Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037581298 8:20247352-20247374 GGGGGTCTCCAGCCTGGGGAGGG + Exonic
1039275984 8:35934521-35934543 CTGGGTATCCATACTGGGGATGG - Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039826279 8:41176567-41176589 CAGGGTCTCCAGCTTGTGGATGG - Intergenic
1043346110 8:79299769-79299791 CAGGGTATAAAACCCGGGGCAGG - Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1048211272 8:132456269-132456291 CAAGTTGTGCAGCCTGGGGAGGG + Intronic
1049152249 8:141042598-141042620 CAGGGAGTACAGGCTAGGGAAGG - Intergenic
1049285892 8:141775009-141775031 CAGAGAAGTCAGCCTGGGGAGGG + Intergenic
1049399005 8:142416533-142416555 CTGGGTACAAAGCCTGGGGTGGG + Intergenic
1049776218 8:144406582-144406604 CAGAGTCTTCAGCCTGGGGTTGG - Intronic
1050132518 9:2427431-2427453 CAGAGAAGACAGCTTGGGGAAGG + Intergenic
1050312690 9:4369590-4369612 AAGGGCCTACAGCCAGGGGAGGG - Intergenic
1053195261 9:36112670-36112692 CAGTTAATGCAGCCTGGGGAAGG + Intronic
1053857978 9:42357250-42357272 TAAGGGAGACAGCCTGGGGAGGG - Intergenic
1055418822 9:76114139-76114161 TGGGGTATACAGCCTGAAGAGGG + Intronic
1059609102 9:115872697-115872719 CAGTGTATACTGCCTGGGTATGG - Intergenic
1060027791 9:120187584-120187606 CAGGATTCCCAGCCTGGGGAAGG + Intergenic
1060806630 9:126581688-126581710 CAGGATATACAGCCATGGTAAGG - Intergenic
1062088989 9:134664284-134664306 CAGGTTTTACAGTCTTGGGATGG + Intronic
1062330998 9:136044900-136044922 CTGGGTGTTCAGCCGGGGGATGG + Intronic
1062702435 9:137914346-137914368 CAGGGTATGAAGTCTGGGGTGGG - Intronic
1185944115 X:4355386-4355408 GAATTTATACAGCCTGGGGAAGG + Intergenic
1187344018 X:18446681-18446703 CAGGGAATACCGACTGGGGTTGG - Intronic
1187612807 X:20960983-20961005 CAAGCTATGCAGCCTGGGGTTGG - Intergenic
1190507097 X:51137083-51137105 CAGGGTCTCCAGCCTGCAGATGG - Intergenic
1190901447 X:54677905-54677927 CAGTGTATACTGCTTGGTGATGG - Intergenic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1192318231 X:70067863-70067885 CAGGGGGCACAGGCTGGGGAGGG + Intergenic
1193381070 X:80816349-80816371 CAGGGGGTACAGCCTTGGGTAGG - Intergenic
1198934400 X:141890778-141890800 CAGGGTATACAAGATGGAGATGG - Intronic
1199847042 X:151699054-151699076 CAGGCCATAGGGCCTGGGGAAGG + Intronic
1200266593 X:154649470-154649492 CAGGGTTTACATCCTAGGGCAGG + Intergenic