ID: 1017858461

View in Genome Browser
Species Human (GRCh38)
Location 6:158373018-158373040
Sequence CTGTCTGAGCAGTGTTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017858461_1017858463 14 Left 1017858461 6:158373018-158373040 CCAACTTAACACTGCTCAGACAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1017858463 6:158373055-158373077 AAAGTAGGTCATGAGTAGAGTGG No data
1017858461_1017858462 -1 Left 1017858461 6:158373018-158373040 CCAACTTAACACTGCTCAGACAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1017858462 6:158373040-158373062 GAAAACTTGAAGATTAAAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 325
1017858461_1017858466 20 Left 1017858461 6:158373018-158373040 CCAACTTAACACTGCTCAGACAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1017858466 6:158373061-158373083 GGTCATGAGTAGAGTGGGATGGG No data
1017858461_1017858465 19 Left 1017858461 6:158373018-158373040 CCAACTTAACACTGCTCAGACAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1017858465 6:158373060-158373082 AGGTCATGAGTAGAGTGGGATGG 0: 1
1: 0
2: 5
3: 14
4: 214
1017858461_1017858464 15 Left 1017858461 6:158373018-158373040 CCAACTTAACACTGCTCAGACAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1017858464 6:158373056-158373078 AAGTAGGTCATGAGTAGAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017858461 Original CRISPR CTGTCTGAGCAGTGTTAAGT TGG (reversed) Intronic
904324530 1:29719658-29719680 CTGTCTCACCATTGTCAAGTGGG - Intergenic
907287702 1:53392652-53392674 CTGGCTGGGCAGTGTTGTGTGGG - Intergenic
908450368 1:64248296-64248318 CTGTCTGAGCAGGGTTGAGGCGG + Intronic
920724367 1:208420004-208420026 CTGTCTGAGCACTGTGCAGTGGG + Intergenic
923017926 1:230141228-230141250 CCTTCTGCGCAGTGTTAAGATGG - Intronic
923420798 1:233813015-233813037 CTGTCTGAGGTGAGATAAGTAGG - Intergenic
1067251318 10:44589302-44589324 CTGTCTGATCAGTTATAAATGGG - Intergenic
1072315932 10:94203141-94203163 ATGTCTGAGCTCTGGTAAGTAGG + Intronic
1072453243 10:95555802-95555824 CTTTCTGATTAGTGTTGAGTGGG - Intronic
1074443179 10:113496648-113496670 TTGTCTGAACAGTGATGAGTTGG + Intergenic
1074539487 10:114352802-114352824 CTGTCGGAGCAGTGGAAAGGGGG - Intronic
1074960628 10:118442125-118442147 CTGTCTAAGATGTTTTAAGTAGG - Intergenic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1078170343 11:8924777-8924799 CTGTCAGAGCTGTGTGAAGGAGG - Intronic
1079206448 11:18419184-18419206 CTGTAAGAGCAGAGTTGAGTAGG - Intronic
1079457311 11:20648047-20648069 CTGTGTTTGCAGTGTGAAGTGGG - Intronic
1081829578 11:46096831-46096853 CTATTTGACCAGTGTTGAGTGGG - Intronic
1088176933 11:107063811-107063833 CGGACGGAGCAGTTTTAAGTTGG + Intergenic
1090883787 11:130858361-130858383 ATGTCTCAGCACTTTTAAGTGGG + Intergenic
1099535930 12:83844540-83844562 CTGTCTCAAAAGTGTTATGTTGG - Intergenic
1099712483 12:86244921-86244943 GTGTCAGTGCAGTATTAAGTGGG + Intronic
1100320008 12:93481897-93481919 CAGTCTGTGCTGGGTTAAGTAGG - Intronic
1101169982 12:102081597-102081619 CTGTCTCTGCAGTGTTTTGTGGG + Intronic
1103583263 12:121932387-121932409 CTGTCTTGAAAGTGTTAAGTAGG + Intronic
1107098298 13:36560315-36560337 CTGTCTGCACAGTGTGAAGGAGG - Intergenic
1107572288 13:41675694-41675716 CTGTCCGAGCTGTGTTAGGTTGG + Intronic
1110883260 13:80599825-80599847 CTGTCAGGGCAGTGGTAAATGGG + Intergenic
1110913306 13:80990683-80990705 CTGTCTCATAAGTGTTAACTAGG + Intergenic
1112204253 13:97308536-97308558 GGGTATGAGCAGTGTTAAATGGG - Intronic
1114255700 14:20999696-20999718 CTGTCTCCTCAGTGTCAAGTGGG + Intronic
1114882479 14:26803937-26803959 CTGTCTAAGAAATGATAAGTAGG - Intergenic
1115262709 14:31470056-31470078 CTGACTGACCAGCTTTAAGTTGG - Intergenic
1115983154 14:39076347-39076369 CTGTCTGAGATGAGTTAAGCAGG - Intronic
1116139251 14:40968567-40968589 CTGTCTGAGGAGGGGTATGTAGG + Intergenic
1119215969 14:72869238-72869260 ATGTGGGATCAGTGTTAAGTTGG - Intronic
1124515391 15:30363095-30363117 CTATCTGAGCTGTGTAAAGAGGG + Intronic
1124727531 15:32167634-32167656 CTATCTGAGCTGTGTAAAGAGGG - Intronic
1128291693 15:66483082-66483104 CTGGCTCAGCAAGGTTAAGTAGG - Intronic
1129627580 15:77218838-77218860 CAGTCTGTGCAGTGTGAAATGGG - Intronic
1130416487 15:83699254-83699276 CTGTTTGAGTCATGTTAAGTTGG - Intronic
1140240406 16:73194721-73194743 CTCTCAGAGCAGTGTGAATTGGG - Intergenic
1141725399 16:85784833-85784855 CAGCATGATCAGTGTTAAGTAGG - Intronic
1142930582 17:3280980-3281002 CTGACTGTGCAGTGTTTAGGTGG + Intergenic
1144424517 17:15129420-15129442 CTGTCTTAGCTGTCTTATGTGGG - Intergenic
1146498577 17:33344704-33344726 ATGTGTGAGCAGGGTTAAGTGGG - Intronic
1149017138 17:51921156-51921178 CTGTATGAGCAGTGGTTAGATGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1159982731 18:74805674-74805696 CTGTTTGATCATTGTTAGGTGGG + Intronic
1163528425 19:17835301-17835323 ATGTCTGAGCAGTACCAAGTGGG - Intronic
1164572370 19:29383694-29383716 CTGTCTGAGCAGTTTGAGTTGGG - Intergenic
925293582 2:2763849-2763871 CTGGCTGAGCAGTCATAGGTGGG - Intergenic
933229991 2:79796159-79796181 CTGTCCTAACAGTGTTAAGACGG - Intronic
935075005 2:99732788-99732810 CTGTCTGGGGAGTGTTAATTTGG - Intronic
935148622 2:100413864-100413886 CTGGTTAAGCAGAGTTAAGTGGG - Intronic
937566049 2:123290241-123290263 CTGTGTGTGCAGAGTTAACTGGG - Intergenic
937932485 2:127218106-127218128 CTGTCTGAGCAGTGGGCAGGAGG + Intronic
944634055 2:201657270-201657292 CTGTGTGATCAGTGCAAAGTTGG + Intronic
944922026 2:204424795-204424817 CAGTCATAGCAGTGTTAAGAGGG + Intergenic
945436446 2:209824245-209824267 CCTTCTGAGCTGTCTTAAGTAGG + Intronic
945606182 2:211935331-211935353 GAGTCTGAGTAGAGTTAAGTAGG + Intronic
946204197 2:218091630-218091652 CTCTCTGTGCAGTGTTCATTTGG + Intergenic
1169911332 20:10649993-10650015 CTGTCCGAGGAGTGTTCAGCTGG - Intronic
1172315233 20:33948849-33948871 CAGTCTGGGCAGGGTTCAGTGGG - Intergenic
1173430548 20:42983618-42983640 TTGTCTCAGGAGTGTGAAGTGGG - Intronic
1175459810 20:59144005-59144027 CTGTGTGAACAGAGTTAAATGGG - Intergenic
1183002685 22:34874761-34874783 CTGTCTGTGCATTGTACAGTGGG - Intergenic
1184203721 22:42987021-42987043 CTGTCTGAGGGGTGTTAGTTAGG - Intronic
952777823 3:37063203-37063225 CTGTGTGAGTAGTGTTTAGAGGG + Intronic
954065673 3:48104079-48104101 CTGACTGACCAGCTTTAAGTTGG + Intergenic
954904996 3:54053919-54053941 CTGTCTGCTCAGTGCTATGTTGG - Intergenic
955320163 3:57968617-57968639 CTGACTGAGCAGCTTCAAGTTGG - Intergenic
958425484 3:93974012-93974034 ATGTCTCAGCAGTGTTTACTAGG - Exonic
962999007 3:140658920-140658942 CAGTTAAAGCAGTGTTAAGTGGG + Intergenic
965466892 3:169040957-169040979 CAGTCTTAGCAATGTTAAGAAGG - Intergenic
966248394 3:177834440-177834462 TGGCCTAAGCAGTGTTAAGTAGG + Intergenic
967665445 3:192166482-192166504 CTGTCTTACCAGTTTTAAATGGG + Intronic
970103970 4:12559255-12559277 CTGACTGACCATTGTTAAGGAGG + Intergenic
973072987 4:45888434-45888456 CAGTGGGAGCAGTGTTAAGAGGG - Intergenic
980104424 4:128574164-128574186 CTGTCTGATAATGGTTAAGTGGG + Intergenic
980312429 4:131149526-131149548 GTGACAGAGCATTGTTAAGTAGG + Intergenic
984983510 4:185305051-185305073 CTGTATCAGCACTGCTAAGTGGG + Intronic
989198934 5:38743699-38743721 TTGTCTGAGCAGAGATAACTAGG - Intergenic
989504621 5:42213336-42213358 TTGTTTATGCAGTGTTAAGTTGG - Intergenic
990305997 5:54494390-54494412 CTGGCTGACCAGATTTAAGTTGG - Intergenic
990640427 5:57777656-57777678 ATTTCTGAGAAGTGTTAACTTGG + Intergenic
993837406 5:92832633-92832655 CTGCTAGAGCAGTGTTAAGAGGG - Intergenic
994130848 5:96226056-96226078 CTGTCTGAGAAGTGCAAGGTGGG - Intergenic
998941612 5:147289096-147289118 CTGTATGTGCAGTGTCAAGGGGG + Intronic
999051524 5:148528993-148529015 CTGTCTCAAAAGTGTTAGGTTGG - Intronic
999705043 5:154264835-154264857 CTCTCTGAGAACTGCTAAGTGGG - Intronic
1000573889 5:162951864-162951886 CTTTATGAGCAGTGTGAAATCGG - Intergenic
1004038234 6:11946157-11946179 CTTTCTGAGCAATGTTTATTTGG + Intergenic
1004543348 6:16572882-16572904 CTATCTTGGCAGAGTTAAGTGGG + Intronic
1008316022 6:50042249-50042271 CTCTCTGACCAGTGTCAATTTGG - Intergenic
1011238053 6:85239450-85239472 GTTTCTGTGCAGTGTTAAGTTGG - Intergenic
1017084205 6:150698724-150698746 ATGTCTGGGCAGGGTTAGGTGGG + Intronic
1017858461 6:158373018-158373040 CTGTCTGAGCAGTGTTAAGTTGG - Intronic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1026797585 7:73376374-73376396 CTGTCTGAGCTACTTTAAGTCGG - Intergenic
1028620628 7:92823698-92823720 CTGTCTGAGTCGTTTCAAGTTGG - Intronic
1032097867 7:128948417-128948439 CTCCCTGAGCAGTGTGAACTTGG + Intronic
1032265841 7:130369307-130369329 ATCCCTGAGCTGTGTTAAGTAGG + Intergenic
1037747358 8:21657099-21657121 CTTTATGAGCAGTGTTAAGATGG + Intergenic
1039136167 8:34325096-34325118 CTTTCTGAGCAATGTTTTGTAGG - Intergenic
1045914276 8:107447624-107447646 CTGCCTGTGCAGTTTTAAGTGGG - Intronic
1052308308 9:27036618-27036640 CTGTTTGAGCAGTGTTCATCTGG + Intronic
1057053050 9:91940294-91940316 CTGTCTGGGGACTGTTAAGTAGG + Intronic
1057181842 9:93034778-93034800 CTGCTTGAGCAGTGTTACCTGGG + Intronic
1058146794 9:101421426-101421448 CAGTCTTAGCAGTGGTAGGTTGG - Exonic
1060721713 9:125983996-125984018 GTTTCTGAGCAGTGTCATGTGGG + Intergenic
1186770629 X:12814698-12814720 CTATCTCAGCAGTGGTAGGTAGG - Intronic
1189602630 X:42643620-42643642 CTGTCTGAGTATTGATAAGTAGG + Intergenic
1189798319 X:44667741-44667763 CTGTCAGAGCAGTGCTTAGAGGG - Intergenic
1189991247 X:46597211-46597233 CTATGTGAGCAGTGGAAAGTGGG - Intronic
1192263091 X:69520325-69520347 CTGTGGAAGCAGTGTTATGTTGG - Intronic
1193042657 X:77019958-77019980 CTGTCTGGGCTGGGTTCAGTGGG - Intergenic
1193150286 X:78117796-78117818 CTGCCTGAAGAGTGTTAACTGGG + Intronic
1198401069 X:136268844-136268866 TACTCTGGGCAGTGTTAAGTAGG + Intergenic
1200232527 X:154451174-154451196 CTGTCTGAGCAGGGCTAGCTAGG - Intergenic