ID: 1017859148

View in Genome Browser
Species Human (GRCh38)
Location 6:158379104-158379126
Sequence GCATAGGTGTGATGTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017859139_1017859148 25 Left 1017859139 6:158379056-158379078 CCAGTTAGGAGGCTGCTGGAGCC 0: 1
1: 4
2: 4
3: 43
4: 349
Right 1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG 0: 1
1: 0
2: 1
3: 8
4: 131
1017859143_1017859148 4 Left 1017859143 6:158379077-158379099 CCGTCTGGGAGAGAGTCCAGGCT 0: 1
1: 0
2: 2
3: 21
4: 185
Right 1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG 0: 1
1: 0
2: 1
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017859148 Original CRISPR GCATAGGTGTGATGTGAAAC TGG Intronic
900692853 1:3992220-3992242 TCATAGGGGTGATGTCAAAGGGG + Intergenic
904259593 1:29280677-29280699 GTGTATGTGGGATGTGAAACTGG + Intronic
905972855 1:42154433-42154455 GCAGAGGTGGGATTTGAACCAGG + Intronic
908146357 1:61248802-61248824 GCATAGGCGTTATGTGGAATTGG - Intronic
908851765 1:68384019-68384041 GAGTATGTGTGATGTGAAATGGG + Intergenic
909682027 1:78302453-78302475 GCAGATGTGTGTTTTGAAACTGG + Intergenic
911770469 1:101734299-101734321 GCAGAGGTGGGATATGAACCAGG - Intergenic
912393449 1:109321000-109321022 GCAGAGCTGGGATGTGAAACTGG - Intronic
912884030 1:113450210-113450232 GCATAATTGTGAAGTGAAAAAGG + Intronic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
913321780 1:117593809-117593831 GCACAGCTGTGATGTGAAGGTGG + Intergenic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
915969238 1:160341951-160341973 GTATAGGTGAAATGTGAAATGGG - Intronic
916978738 1:170110916-170110938 GAATAGGTGTGATGTGGTGCTGG + Intergenic
921621501 1:217330603-217330625 GCAAAGAGATGATGTGAAACTGG - Intergenic
922418927 1:225446669-225446691 GCAGAGGTGAGATGTGACCCTGG - Intergenic
924946772 1:248851720-248851742 GCATGGGTGTGACCTGAGACTGG - Intronic
1063487241 10:6431153-6431175 GCATAGACCTGATTTGAAACCGG + Intronic
1064241239 10:13631394-13631416 GCAGAGCTGAGATGTGAAGCTGG - Intronic
1065310213 10:24408476-24408498 GGAAAGGTGTGATGTGACTCAGG - Intronic
1067156907 10:43789787-43789809 GCATAACTGTGAAGTGAAAAAGG - Intergenic
1068580238 10:58731034-58731056 GCAAAGATGTTATCTGAAACTGG - Intronic
1070204122 10:74238952-74238974 GCATAAGTATCATTTGAAACTGG - Intronic
1070473185 10:76804034-76804056 ACAAAAGTGTGATGAGAAACAGG - Intergenic
1075574442 10:123568688-123568710 GCATAGCTGGGACTTGAAACCGG - Intergenic
1075976083 10:126696577-126696599 GCATGGGTGTGATCTGAGTCTGG + Intergenic
1080803284 11:35628977-35628999 TGATAGGTGTGAACTGAAACTGG - Intergenic
1081137812 11:39460779-39460801 GCATAGGTATTACATGAAACAGG - Intergenic
1084012801 11:66362109-66362131 GTATAGGTGTGTGGTGAAGCAGG + Intronic
1085755331 11:79197121-79197143 GCAAAGGTGTGACTGGAAACAGG + Intronic
1087611432 11:100438649-100438671 GGATAGCTTTGATGTAAAACAGG + Intergenic
1087708339 11:101520940-101520962 GCAAAGGAATGATCTGAAACTGG + Intronic
1090398992 11:126436374-126436396 GCATGGGTGTGCTGGGAACCTGG - Intronic
1092189552 12:6508661-6508683 GCAAAAATGTGATGTGAAACAGG + Intronic
1092265393 12:6976832-6976854 GCAAAGGAGTGCTGTGAAAAGGG + Exonic
1092959146 12:13579354-13579376 GCATAGCTGGGATCTGAATCAGG - Intronic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1095400105 12:41804547-41804569 GCAGAGGAGTGATGTGGAAAAGG - Intergenic
1096448109 12:51713006-51713028 GCATAATTGTGAAGTGAAAAAGG - Intronic
1099580151 12:84435822-84435844 GCATGGATGTGATTAGAAACTGG - Intergenic
1102382326 12:112477695-112477717 GCATTGATGTAATCTGAAACAGG - Exonic
1103192657 12:119015423-119015445 GCAGAGGAGTGATATGGAACTGG - Intronic
1105543992 13:21338794-21338816 ACAAAGGTGTCATGTGACACTGG - Intergenic
1109683989 13:65788471-65788493 GCATAATTGTGAAGTGAAAAAGG - Intergenic
1117217678 14:53568621-53568643 GGATAAGTATGCTGTGAAACTGG - Intergenic
1118915152 14:70096554-70096576 GTGGAGCTGTGATGTGAAACTGG - Intronic
1120062739 14:80003126-80003148 GAAAAGGTGTGATGGAAAACTGG + Intergenic
1121740373 14:96247780-96247802 GCAGAGGTAAGATGTGAACCAGG - Intronic
1124157230 15:27236620-27236642 GAACAGGTGTATTGTGAAACTGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124696459 15:31868580-31868602 GCCTAAGTGAGATGAGAAACTGG - Intronic
1129869850 15:78933201-78933223 GCAGAGCTGGGATGTGAACCAGG - Intronic
1133854437 16:9536438-9536460 GGAGAGGTGTGAGCTGAAACTGG + Intergenic
1135498446 16:22973007-22973029 CCAAAAGTGTGATGTGAAAAGGG - Intergenic
1138367971 16:56498769-56498791 GCATAGGTGAGGTGAGAAAAGGG - Intronic
1140810605 16:78573510-78573532 GCAGAGGAGTGATGTGACAAAGG - Intronic
1148689196 17:49517019-49517041 GCATAGGGGTGGTGAGAAAAGGG + Intergenic
1148772364 17:50074769-50074791 GCATAGCTGGGATTTGAACCAGG - Intronic
1157831957 18:50864276-50864298 GCATAGGTGGTATGTGAACTTGG + Intergenic
1164925971 19:32130203-32130225 GCACAGGTGTGAATTGCAACTGG - Intergenic
1166739348 19:45104655-45104677 TCACAAGTGTGATGTGAAACAGG - Intronic
1168589311 19:57619375-57619397 GCATAGGGGAAAGGTGAAACAGG - Intronic
925665834 2:6254746-6254768 GCATGGATGTGATGTGGAATTGG - Intergenic
928338975 2:30425014-30425036 GCACATGCGTGATGTGAAAGGGG - Intergenic
929217901 2:39435984-39436006 CCTCAGGTGTTATGTGAAACTGG + Intronic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
934546207 2:95218820-95218842 GCATAGGTGTGGAGAGAAATTGG + Intronic
937239400 2:120450611-120450633 GCACAGGTTTGCTGTGAACCAGG - Intergenic
937266684 2:120620472-120620494 GCATATGTGTGATGTAAGATAGG - Intergenic
938622581 2:133071878-133071900 GCAGAGGTGGGATCTGAAACAGG - Intronic
939950989 2:148472453-148472475 GCATAGGTCTGATGTGCAGCTGG + Intronic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
942560796 2:177216528-177216550 GCATAATTGTGAAGTGAAAAAGG + Exonic
946119397 2:217496371-217496393 GCAGAGCTGTGATTTGAACCTGG - Intronic
948172157 2:235912766-235912788 GCAAGTGTGTGAGGTGAAACTGG - Intronic
1170094055 20:12625546-12625568 GAATAGGAGTGGGGTGAAACTGG + Intergenic
1173953119 20:47008726-47008748 GCAAGGGTGGGATGTGAATCTGG - Intronic
1179843578 21:44093924-44093946 GCATAGGCGTGCTGTGAGGCGGG + Intronic
1180777696 22:18499759-18499781 GCATGGGCTTTATGTGAAACAGG - Intergenic
1184421298 22:44384336-44384358 GGAGGGGTGAGATGTGAAACAGG + Intergenic
949641921 3:6046107-6046129 TGATAGGTGATATGTGAAACAGG + Intergenic
953720794 3:45353298-45353320 GCAAAAGAGTGATGAGAAACAGG - Intergenic
955961302 3:64343863-64343885 GCAGAGGAGGGATGAGAAACAGG - Intronic
957293355 3:78306161-78306183 GCAAAGGGGTGATCTGAAACTGG + Intergenic
958923417 3:100131486-100131508 GCAGAGGTGTGATGTGAACCAGG + Intronic
961077250 3:123993404-123993426 AAATAGGTGTGAAGTGACACGGG - Intergenic
961830911 3:129622633-129622655 GCAGAGCTGGGATGTGAACCTGG + Intergenic
964509483 3:157435626-157435648 GCATAGGAGTGAAGTGAGATAGG - Intronic
964657203 3:159080770-159080792 GCAAAGGTGAGATTTGAACCTGG + Intronic
965325023 3:167292259-167292281 GAATAAGTGTGATGTGATGCTGG - Intronic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
966974428 3:185071804-185071826 GCATAGGTGTGGTGTGTCCCTGG - Intergenic
969243926 4:5920249-5920271 GCAGAGGTGGGATTTGAACCTGG - Intronic
973608324 4:52609660-52609682 GATTAGGTGTGATGTAAAACAGG + Intronic
975922044 4:79402953-79402975 GGAGAGGGGTGATGAGAAACTGG - Intergenic
977428210 4:96896743-96896765 GCATAATTGTGATTTTAAACTGG - Intergenic
977918188 4:102616317-102616339 GCATAGGTGGGATGTGTGGCTGG + Intronic
979386260 4:120068309-120068331 GCATGGGTGTGATAGGTAACAGG + Intergenic
981805892 4:148714780-148714802 GCATATGTGTGTTGAGAAATGGG - Intergenic
982870808 4:160576597-160576619 GAATAGGTGTGATGTGGTGCTGG - Intergenic
983562844 4:169118184-169118206 GCACATGTGTGATGTGGAGCTGG - Intronic
989954705 5:50344030-50344052 TCATAGATGTGATGTGAAGTGGG + Intergenic
990875990 5:60486503-60486525 TCATTGGTGTGATCTGAAAGGGG + Intronic
993199272 5:84791642-84791664 GGACATGTGTAATGTGAAACTGG - Intergenic
993567475 5:89492646-89492668 GCCCAGGTGTGAGGTGAAAGCGG + Intergenic
996016026 5:118534744-118534766 ACATTGGAGTGATGAGAAACTGG - Intergenic
998005288 5:138652684-138652706 GCTTAGTGGTGATGAGAAACGGG + Intronic
998682268 5:144482147-144482169 GCATAGGAGAGAGGAGAAACAGG - Exonic
999395647 5:151225455-151225477 GGAAAGGTGTGCTGTGAAAACGG + Intronic
1001079519 5:168656931-168656953 GCAGAGATGTGATTTGAACCAGG - Intergenic
1001098697 5:168796390-168796412 GAACAGGTGTGGTGGGAAACAGG + Intronic
1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG + Intergenic
1002375959 5:178789353-178789375 GCAAAGGGCTGATGTGAGACTGG - Intergenic
1006184024 6:32170309-32170331 GAATAGGTGTGATGTTATAATGG + Intronic
1009499444 6:64392331-64392353 GAATAGGTGTGGTGTGATGCTGG - Intronic
1012394882 6:98785042-98785064 GAAGAGGTGGGAGGTGAAACTGG + Intergenic
1014310286 6:119791727-119791749 ACTTAGGTGTGGTGTAAAACTGG - Intergenic
1017049136 6:150374211-150374233 GCATAAGTTTCATGTGACACAGG + Intronic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1019445925 7:1071327-1071349 GCATTGGTGAGTGGTGAAACCGG + Intronic
1024936259 7:54714999-54715021 GCATAGGTGTGATGTTGCATTGG - Intergenic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1030584496 7:111400707-111400729 GCTTAGGTGTGAGGTTAAAAAGG + Intronic
1030942919 7:115677893-115677915 GAATAGGTGTGCTATGAGACAGG + Intergenic
1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG + Intergenic
1037541826 8:19879586-19879608 GCAGAGCTGAGATGAGAAACAGG - Intergenic
1037764940 8:21766830-21766852 GCATAGGTGTGATGTGCATGAGG - Intronic
1039770998 8:40686728-40686750 CCAGAGTTGTGATTTGAAACTGG - Intronic
1041398765 8:57419282-57419304 GCATAAGCGGGAGGTGAAACGGG + Intergenic
1041490265 8:58425452-58425474 GCATTGATGTCATCTGAAACAGG + Intronic
1042756401 8:72218077-72218099 GCATAGGTGTGGTGAGAAGTAGG - Intergenic
1044837064 8:96306061-96306083 GCATAGGTGTTCTGTGGCACAGG + Intronic
1048340624 8:133536108-133536130 GCAGAAGTGTGATTTGAACCCGG + Intronic
1061642468 9:131969981-131970003 GCATAGGAGGGAGGTGAAAGAGG + Intronic
1061877357 9:133551090-133551112 GCATCGGTGTGATGGGAGGCAGG - Intronic
1188322476 X:28756908-28756930 GCAGAGGTGGAATGTGAAAAGGG - Intronic
1188387086 X:29574743-29574765 GCAAAGGGATGATCTGAAACTGG - Intronic
1193949594 X:87781119-87781141 GAATAAGTGTGATGTGATGCTGG - Intergenic
1197039792 X:121922879-121922901 GCATAGTTGTGATCCAAAACTGG - Intergenic
1198234002 X:134719000-134719022 GCCCAGGTGTGAGGTGAAAAGGG - Intronic
1199551397 X:149065425-149065447 GCAGAGCTGGGATGAGAAACTGG - Intergenic