ID: 1017859762

View in Genome Browser
Species Human (GRCh38)
Location 6:158384671-158384693
Sequence ATTAGCCAGCTGTCTAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017859757_1017859762 17 Left 1017859757 6:158384631-158384653 CCTTTCCTGAGGCCAAGTATTTG 0: 1
1: 0
2: 0
3: 18
4: 285
Right 1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1017859758_1017859762 12 Left 1017859758 6:158384636-158384658 CCTGAGGCCAAGTATTTGAATTT 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1017859759_1017859762 5 Left 1017859759 6:158384643-158384665 CCAAGTATTTGAATTTGTTTGAC 0: 1
1: 0
2: 2
3: 29
4: 303
Right 1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017859762 Original CRISPR ATTAGCCAGCTGTCTAAATT GGG Intronic
900709798 1:4106578-4106600 ATTTCCCAGCTGACTGAATTCGG - Intergenic
902557890 1:17257766-17257788 AGTGGCCAGCTGTGGAAATTTGG + Intronic
902977918 1:20102189-20102211 ATTTTCCAGGTTTCTAAATTTGG + Intergenic
902989073 1:20173480-20173502 ATTCTCCAGCTGCCTAAGTTTGG - Intronic
903548663 1:24142773-24142795 TATAGCCAGCTGTCTGAACTGGG - Intronic
905103142 1:35543431-35543453 ATTAGTCATCTGCCTCAATTTGG + Intronic
905122931 1:35695633-35695655 ATTTCCCAACTGTCTAAAGTTGG + Intergenic
905601479 1:39255875-39255897 ATTAGCTAGAAGTCTAAATCAGG + Intronic
906864957 1:49408027-49408049 ATAAGTCAGTTGTCTAAATGGGG - Intronic
906919186 1:50045884-50045906 TTTATCTAGCTGTGTAAATTTGG + Intergenic
908213717 1:61929613-61929635 ATTTGTTAGCTGTCTAACTTTGG - Intronic
909046604 1:70718144-70718166 ATTTGCCAGCTGTGTAAACTTGG - Intergenic
909185540 1:72481360-72481382 ATTAGCCAGTTATATAAATTTGG + Intergenic
912718140 1:111996719-111996741 ATTCACCAGCTGTGTGAATTTGG + Intergenic
912769336 1:112448597-112448619 TCTAGCAAGCTGTCTGAATTGGG - Intronic
915617582 1:157051350-157051372 ATTAGCCTTCAGTCTAAAATTGG - Intergenic
916924393 1:169502614-169502636 ATTAGTCAGCTTTCTACATATGG - Intergenic
920442977 1:205993851-205993873 AGTAACCAGCTGTGTGAATTAGG - Intronic
920878814 1:209861434-209861456 ACTAGCCAGTTGTTTAACTTTGG - Intergenic
920920865 1:210296230-210296252 ATTAGCCAGTAGTCTGAACTGGG + Intergenic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
924268947 1:242312424-242312446 ATTAACCAGCTGTGTATATGAGG - Intronic
924335637 1:242984584-242984606 ATTAGCCAGCAGACTAACTTGGG - Intergenic
1065834884 10:29647839-29647861 AGTATCTAGCTTTCTAAATTGGG - Intronic
1066715960 10:38286346-38286368 ATTAACCAGCTGTGTATATGAGG + Intergenic
1067998020 10:51298192-51298214 ATTTGCCACCTGTGCAAATTTGG - Intronic
1068583018 10:58764179-58764201 AATAGCCAGTTGCCTACATTAGG + Intronic
1068590771 10:58850706-58850728 ATTTGCCACCTGTATAAAATGGG - Intergenic
1071771408 10:88732943-88732965 ATTTGCAAGCTGGGTAAATTTGG + Intronic
1073056463 10:100706411-100706433 ATTCACTAGCTGTGTAAATTTGG + Intergenic
1074665010 10:115712268-115712290 ATTGGTCTGCTTTCTAAATTTGG - Intronic
1076277120 10:129210541-129210563 AATCGCAAGCTGTCTAAATGTGG + Intergenic
1077046078 11:545843-545865 ATTCTCCAGCTGTGTGAATTGGG + Intronic
1078073624 11:8136765-8136787 ATTTCCTAGCTGTCTAAAATAGG - Intronic
1080751099 11:35151156-35151178 ATGAGCCAGGTGTTTAAAGTGGG + Intronic
1080943541 11:36946251-36946273 ATTTACCAGCTCTGTAAATTTGG - Intergenic
1086673657 11:89577598-89577620 ATTAACTAGCTATATAAATTTGG - Intergenic
1089400293 11:118160533-118160555 ATTAGCCAACTGTATGACTTTGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093520311 12:20042429-20042451 ATTAAGCAGCTTTCTAAATGTGG + Intergenic
1097762076 12:63477879-63477901 ATTCTCCAGCAGTCTAAAATGGG - Intergenic
1100952289 12:99864650-99864672 AATTGCCAGCTGTCTGATTTGGG + Intronic
1101298634 12:103453956-103453978 ATTATCCAGGTGTTTAAAATTGG - Intronic
1101419572 12:104539044-104539066 ATTTGCCAGCTGTGTAACCTTGG - Intronic
1102216144 12:111162678-111162700 AGTAGGTAGGTGTCTAAATTAGG - Intronic
1105893031 13:24695551-24695573 ATTATCCACCTGTCTTAGTTCGG + Intronic
1106346576 13:28885491-28885513 ATTCACCAGCTGTCTAACCTTGG - Intronic
1107007160 13:35625835-35625857 ATTATCCAGGTTTCTAATTTTGG - Intronic
1107598909 13:41992641-41992663 ATTTGCTAGCTGCCTAAATGTGG - Intergenic
1110171589 13:72507037-72507059 ATTGGCTAGCTGTCTACATTTGG + Intergenic
1110209596 13:72955954-72955976 AAAAGCCTGCTGTATAAATTTGG - Intronic
1115313138 14:31999435-31999457 ACTAGCCAGCTGTGTGAATTTGG - Intergenic
1117877341 14:60267390-60267412 ATTAGTCAGCTGCCTAATGTTGG + Intronic
1117997802 14:61494275-61494297 ATTAGAAATCTGCCTAAATTTGG + Intronic
1119706229 14:76784299-76784321 GTTAGTCAGGTGCCTAAATTAGG - Intergenic
1122488846 14:102099627-102099649 ATTAGCTAGCTGTTTTAATGTGG - Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1128051002 15:64664635-64664657 ATTCTCCAGCTGTCTCAACTCGG + Intronic
1128914914 15:71551042-71551064 ATGAGCCACCTGTCATAATTAGG + Intronic
1131192920 15:90331612-90331634 AGTAGCCAGCTTTTAAAATTGGG - Intergenic
1131468524 15:92675004-92675026 ATAATCCAACTGTCTAATTTTGG + Intronic
1134767064 16:16769109-16769131 ATCAGCCTGTCGTCTAAATTAGG + Intergenic
1136393487 16:29979645-29979667 ATTTGCCAGCTGCCTGTATTGGG - Intronic
1138055175 16:53825344-53825366 ATTTGCCAGCTGTGTGACTTTGG + Intronic
1145857560 17:28176561-28176583 ATAAGCCAGATGTTAAAATTAGG + Intronic
1158953703 18:62521392-62521414 GTGAGCCAGCTGTCTAGATCTGG - Intergenic
1159437335 18:68435950-68435972 ATTAGAGAACTGTCTAAATTTGG - Intergenic
1164265389 19:23611015-23611037 ATTCACCTGCTGTTTAAATTCGG + Intronic
1166256676 19:41611118-41611140 ATTTGACAACTGTCAAAATTGGG + Intronic
925906295 2:8541458-8541480 AGCAGCCAGATGTCCAAATTTGG - Intergenic
929635141 2:43511971-43511993 ACTAGCCAAGTGTTTAAATTAGG - Intronic
929946897 2:46378493-46378515 ATTAACAAGCTGTATGAATTAGG - Intronic
933125151 2:78595414-78595436 ATTAACCAGCTTTGTAATTTTGG + Intergenic
939524648 2:143277658-143277680 ATTATCCAGCTGATTAAAATGGG - Intronic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
942508050 2:176664848-176664870 TCTAGCCAGCTGTCTAATTCTGG + Intergenic
943148804 2:184083153-184083175 ATTTGCCAATTGTGTAAATTTGG - Intergenic
943368284 2:186985203-186985225 ATTAGCCACCTGTCATTATTTGG + Intergenic
947396034 2:229687784-229687806 ATTAGCCTTATGTCTAAATTTGG - Intronic
1168829742 20:839214-839236 ATTAATCAGCTGTGTAATTTTGG + Intronic
1169828657 20:9797815-9797837 ATTAGGCACCTGTGTATATTAGG + Intronic
1177715220 21:24831769-24831791 ATTACTTAGCTGTCTAAATTTGG + Intergenic
1182161363 22:28125201-28125223 AGTAGCCAGCTCTCTAATGTTGG - Intronic
949691435 3:6644384-6644406 ATTCCCCAGATGTCTATATTTGG + Intergenic
951402460 3:22250556-22250578 ATGAGCCAGCTATGTAATTTGGG + Intronic
952045525 3:29314261-29314283 ATCAGCCAGCTAGCTAACTTTGG + Intronic
952214475 3:31263559-31263581 ATTTGCCTGCTTTTTAAATTGGG - Intergenic
953071661 3:39526708-39526730 ATTAGCAATCTCTATAAATTAGG - Intronic
955677551 3:61464497-61464519 ATTACCTAGCTGTTTAAATCAGG - Intergenic
959817244 3:110688878-110688900 ACTAACCAGCTGTGTAATTTTGG - Intergenic
960399470 3:117178658-117178680 TTTATCCTGCTGTCTAAAGTTGG - Intergenic
960634864 3:119774804-119774826 ATTTGCCAGTTTTTTAAATTGGG + Intergenic
964727201 3:159825811-159825833 CTTAGCCCCCTGTCTAAATAAGG - Intronic
965319457 3:167233713-167233735 TATAGACAGCTATCTAAATTTGG + Intergenic
968112689 3:196062104-196062126 ATTAGCCAGGTGGCTGAAGTGGG + Intronic
970689711 4:18608597-18608619 ATTAGACGGATGTCTAAAGTTGG + Intergenic
975752309 4:77536472-77536494 ACCAACCAGCTGTATAAATTTGG + Intronic
976654740 4:87476764-87476786 ATTAACTAGCTGTGTGAATTAGG - Intronic
976826746 4:89268832-89268854 TTTGGCAAGCTCTCTAAATTCGG + Intronic
977637022 4:99311167-99311189 ATTTATCAGTTGTCTAAATTTGG + Intronic
977806302 4:101302239-101302261 ATTAGCCAGCTGTGTAACCAGGG + Intronic
979241482 4:118450699-118450721 ATTAGCCAGCGGACTAACTTGGG + Intergenic
979647090 4:123082427-123082449 ATTAGCCAGCTGTATTTATGTGG + Intronic
983087128 4:163460827-163460849 ATTAGCCTGTCGTCTACATTAGG + Intergenic
983675230 4:170284548-170284570 ATTAGCTAGCTGTCTACTTATGG + Intergenic
983784173 4:171711450-171711472 ATTAGCAATTTGCCTAAATTGGG + Intergenic
984451215 4:179905431-179905453 ATTTCCCAGCTTTCTAAAGTTGG - Intergenic
984920566 4:184760805-184760827 TTTAGCCTCCTGTCTGAATTAGG + Intronic
985295158 4:188429515-188429537 ATTTGAAACCTGTCTAAATTTGG + Intergenic
985380532 4:189390042-189390064 ATTTACTAGCTATCTAAATTAGG - Intergenic
986433820 5:7708557-7708579 ATTTACCAGCTGTGTAATTTGGG - Intronic
990927361 5:61042648-61042670 ATTATCTATCTGTCTAAATTTGG - Intronic
991454715 5:66790278-66790300 ATTAGATAGCTGTATAAACTTGG + Intronic
992662100 5:78971966-78971988 ATTAGACACCTATCTACATTGGG + Intronic
997093612 5:130885567-130885589 ATTAGCCACCAGTTTACATTTGG + Intergenic
997164359 5:131642963-131642985 ATTATCCAGTTGTCTGATTTTGG - Intronic
998561540 5:143176736-143176758 ATTAGGCAGAGGTCTACATTTGG + Intronic
998698538 5:144669295-144669317 ATTTACCAGCTGTGTAAGTTTGG + Intergenic
998698826 5:144673559-144673581 ATTTGCCACATGGCTAAATTTGG - Intergenic
999343632 5:150795749-150795771 ACGAGCCAGCTGTGTGAATTTGG + Exonic
999505028 5:152185813-152185835 ATTTTCCAGCTGTGTAAACTTGG - Intergenic
999641804 5:153680051-153680073 ACTAGCTAGCTGTATAACTTTGG - Intronic
1000767068 5:165305337-165305359 AGAAGGCAGCAGTCTAAATTGGG - Intergenic
1001336645 5:170803097-170803119 TAAAGCCAGCTGTCTAAATACGG - Intronic
1002410541 5:179071547-179071569 ATTAGACACCTGTGTATATTTGG + Intronic
1002878089 6:1228770-1228792 ATTAGCTAGCTGTCATAATGGGG - Intergenic
1003561248 6:7182403-7182425 AATAGCCAGCTGTGTGAATGAGG - Intronic
1009535105 6:64872365-64872387 ATTAGGCAGCTTGCTAAATGTGG - Intronic
1009715913 6:67395089-67395111 ATTAGCATGCAGTTTAAATTAGG + Intergenic
1010922912 6:81706262-81706284 AGTAGCCTGCTGTATGAATTAGG + Intronic
1011836244 6:91434758-91434780 ATTTACCAGCTGTTTAACTTTGG - Intergenic
1015994224 6:138981226-138981248 ATTAGCCAGGTGTTGAATTTGGG - Intronic
1016680776 6:146827209-146827231 ATTAGGCTGCTGTCTAAAAGGGG + Intergenic
1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG + Intronic
1021435368 7:20607356-20607378 ATTAGCTATCTGTTTACATTAGG - Intergenic
1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG + Intergenic
1023545640 7:41315485-41315507 ATTTGCCTGCTGTATAAATGGGG + Intergenic
1026439355 7:70430498-70430520 ATTTGCCAGCTGTGTAACTTTGG - Intronic
1028903377 7:96125777-96125799 ATTTTCCACATGTCTAAATTTGG + Intronic
1029137302 7:98382705-98382727 ATTAGCAAGCTATCAAACTTTGG + Intronic
1029651131 7:101892910-101892932 CTTAGCCAGCTGTCTGAAGAAGG - Intronic
1031507747 7:122607407-122607429 ATTAGTGAGTGGTCTAAATTTGG - Intronic
1032381663 7:131490243-131490265 GTTAGCCAGGTGTTTCAATTAGG - Exonic
1032411465 7:131696207-131696229 ATTAACCAGCTGTGTGATTTTGG - Intergenic
1033460114 7:141539274-141539296 CTGAGCCATCTGTTTAAATTAGG - Intergenic
1037122240 8:15302644-15302666 ATTAGACAGCTCTCTAAAAAGGG + Intergenic
1038200980 8:25412494-25412516 ATAACCCAGCTTGCTAAATTAGG + Exonic
1045339165 8:101236399-101236421 AGGAGCCAGCTCTCTAACTTGGG + Intergenic
1045639758 8:104235349-104235371 ATTAGTCAACTGTGTGAATTGGG + Intronic
1046783684 8:118242879-118242901 ATTATCCAGATTTCTAATTTTGG - Intronic
1047683910 8:127284054-127284076 GCTAACCAGCTGTATAAATTTGG - Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1048911177 8:139136626-139136648 ATTAGGCAGCTGTGTAGATTAGG + Intergenic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050493946 9:6219575-6219597 ATTGACCAGCTGTGTAATTTTGG + Intronic
1051992832 9:23174115-23174137 ATGAGCTAGCTGTATAACTTGGG + Intergenic
1053029069 9:34758762-34758784 ATTAGGCAGCTCTCTATACTGGG + Intergenic
1055357646 9:75454070-75454092 TTTTGCCAGCTGCCTAGATTGGG + Intergenic
1056095218 9:83246140-83246162 ATTAGCATGATTTCTAAATTGGG - Exonic
1056304435 9:85275439-85275461 AGTAACCAGCTGTGTAAACTTGG - Intergenic
1057526673 9:95809094-95809116 ATGATCCAGCTGTAGAAATTGGG - Intergenic
1186650776 X:11557862-11557884 ATTAGCCTGCAGTATAACTTTGG - Intronic
1186841675 X:13490469-13490491 ATTTGCCAGCTGTGCAAATTTGG - Intergenic
1186976429 X:14911473-14911495 ACTAGCCAGCTGTGTGATTTTGG + Intronic
1192592572 X:72372722-72372744 ATTTGCTAGCTGTATAATTTGGG + Intronic
1196054129 X:111336618-111336640 ATGAGCCAGCTGTGTATCTTCGG - Intronic
1196984969 X:121259144-121259166 GTTACCCAGTTTTCTAAATTGGG + Intergenic
1197051010 X:122059858-122059880 ATCATGCAGCAGTCTAAATTAGG - Intergenic
1197968903 X:132094389-132094411 ATTGGCCAACTTTCTCAATTTGG - Intronic
1198649741 X:138849226-138849248 ATTAGGAAGCTGTCTACCTTAGG - Intronic
1198892266 X:141410903-141410925 ATTAGCTAGCTGCATAATTTGGG + Intergenic
1201924490 Y:19269769-19269791 ATTAGGCAGCTTTTTAAACTCGG + Intergenic
1202389198 Y:24352529-24352551 ATTAGCCAGCGGACTAACTTGGG + Intergenic
1202481589 Y:25317595-25317617 ATTAGCCAGTGGACTAACTTGGG - Intergenic