ID: 1017860186

View in Genome Browser
Species Human (GRCh38)
Location 6:158389966-158389988
Sequence GAATCACTTGAACCCACACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 1, 1: 1, 2: 11, 3: 229, 4: 1083}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017860186_1017860190 -4 Left 1017860186 6:158389966-158389988 CCGGGTGTGGGTTCAAGTGATTC 0: 1
1: 1
2: 11
3: 229
4: 1083
Right 1017860190 6:158389985-158390007 ATTCTCCTGCCAGGAGGCGGAGG No data
1017860186_1017860188 -10 Left 1017860186 6:158389966-158389988 CCGGGTGTGGGTTCAAGTGATTC 0: 1
1: 1
2: 11
3: 229
4: 1083
Right 1017860188 6:158389979-158390001 CAAGTGATTCTCCTGCCAGGAGG 0: 1
1: 0
2: 6
3: 54
4: 244
1017860186_1017860189 -7 Left 1017860186 6:158389966-158389988 CCGGGTGTGGGTTCAAGTGATTC 0: 1
1: 1
2: 11
3: 229
4: 1083
Right 1017860189 6:158389982-158390004 GTGATTCTCCTGCCAGGAGGCGG 0: 1
1: 0
2: 5
3: 55
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017860186 Original CRISPR GAATCACTTGAACCCACACC CGG (reversed) Intronic
901016979 1:6237534-6237556 GAATCACTTGAACCCGGAGGCGG - Intergenic
901104120 1:6742007-6742029 GAATCACTTGAACCCGGAGGTGG + Intergenic
901353203 1:8617254-8617276 GAATCGCTTGAACCCAGAGGCGG + Intronic
901389809 1:8937438-8937460 GAATCACTTGAACCCAGGAGTGG - Intergenic
901424159 1:9170684-9170706 GAATCACTTGAACCCAGGAGTGG - Intergenic
901431301 1:9216619-9216641 GAATCGCTTGAACCCAGAGGTGG - Intergenic
901697505 1:11019949-11019971 GAATCACTTGAACCCGGAAGAGG - Intronic
902355606 1:15897274-15897296 GAATCGCTTGAACCCAGAAGTGG - Intronic
902611669 1:17601531-17601553 GAATCACTTGAACCCAGAAGAGG - Intronic
902897643 1:19489906-19489928 GAATCACTTGAACCCAGAGGTGG + Intergenic
903078392 1:20789163-20789185 GAATCACTTGAACCCAGGAGAGG + Intergenic
903085313 1:20852131-20852153 GAATCACTTGAACCCGTAGGCGG - Intronic
903108786 1:21109870-21109892 GAATCGCTTGAACCTAGACGGGG - Intronic
903195364 1:21682785-21682807 GAATCGCTTGAACCCAGGACGGG + Intronic
903264625 1:22150436-22150458 GAATCACTTGAACCCAGGGGAGG - Intergenic
903300464 1:22375189-22375211 GAATCGCTTGAACCCAGAGGTGG - Intergenic
903584570 1:24401781-24401803 GAATCACTTGAACCCAGGCAGGG - Intronic
903837606 1:26215673-26215695 GAATCTCTTGAACCCAGAGGCGG - Intergenic
903851902 1:26312336-26312358 GAATCGCTTGAACCCAGAGGTGG - Intronic
903992684 1:27285122-27285144 GAATCGCTTGAACCCAGAGGCGG - Intronic
904072601 1:27813261-27813283 GAATCACTTGAACCCAGGAGAGG - Intronic
904145256 1:28385701-28385723 GAATCGCTTGAACCCAGAAGCGG - Intronic
904164578 1:28545599-28545621 GAATCACTTGAACCCAGGAGGGG + Intergenic
904179980 1:28659312-28659334 GAATTACTTGAACCCAGAAGGGG + Intergenic
904485338 1:30821188-30821210 GAATCACTTGAACCCGGAAGTGG - Intergenic
904550611 1:31313949-31313971 GAATCACTTGAACCCGGAGGTGG - Intronic
904667001 1:32130696-32130718 GAATCACTTGAACCCCAAGATGG + Intronic
904725723 1:32546354-32546376 GAATCACTTGAACCCAGGAGTGG + Intronic
904949323 1:34223559-34223581 GAATCACTTGAACCCGAACCCGG - Intergenic
905180643 1:36163912-36163934 GAATCCCTTGAACCCAGAGGTGG - Intronic
905378675 1:37544055-37544077 GAATCACTTGAACCCAGAAGTGG + Intronic
905939323 1:41850478-41850500 CAATCAATAGAACCCAAACCAGG + Intronic
906024922 1:42665315-42665337 GAATCGCTTGAACCCAGGACGGG + Intronic
906121700 1:43397337-43397359 GAATCACTTGAACCAAGAGGCGG + Intronic
906310948 1:44754039-44754061 GAATCACTTGAACCCAGAGGTGG - Intronic
906409194 1:45565559-45565581 GAATCGCTTGAACCCAGGCGGGG - Intronic
906446956 1:45909603-45909625 GAATCACTTGAACCCAGGAGGGG - Intronic
906467659 1:46097799-46097821 GAATCACTTGAACCCAGGAGGGG + Intronic
906570314 1:46832414-46832436 GAATCGCTTGAACCCAAGACAGG - Intergenic
906610029 1:47195067-47195089 GAATCACTTGAACCCAGGAGGGG - Intergenic
906623532 1:47305817-47305839 GGATCACTTGAACCCAGAGGCGG - Intronic
906764203 1:48411952-48411974 GAATCACTTGAACCCAGGGTGGG - Intronic
907121339 1:52010779-52010801 GAATCGCTTGAACCCAGAGGTGG - Intergenic
907181114 1:52571244-52571266 GAATCACTTGAACCCGGAGGCGG - Intergenic
907366513 1:53965090-53965112 GAATCACTTGAACCCGGAGGTGG - Intronic
907498114 1:54858722-54858744 GAATCACTTGAACCCAGAAGCGG - Intronic
907545672 1:55258064-55258086 GCAACACCTGAACCCACACCAGG + Intergenic
908218962 1:61984246-61984268 GAATCACTTGAACCCAGGAGGGG - Intronic
908377089 1:63554425-63554447 GAATCACTTGAACCCGGAGGTGG - Intronic
908551615 1:65214196-65214218 GAATCACTTGAACCCGGAGGTGG - Intronic
908707566 1:66976089-66976111 GAATCACTTGAACCCCAGCAGGG - Intronic
908831047 1:68178616-68178638 GAATCACTTGAACCCAGGAGGGG + Intronic
908988711 1:70058095-70058117 GAATCACTTGAACCCAGGATGGG - Intronic
909441894 1:75705766-75705788 GAATCACTTGAACCCGGTGCAGG - Intergenic
909514900 1:76496356-76496378 GAAGCACTTGAACCCATACCGGG + Intronic
909926297 1:81441616-81441638 GAATCACTTGAACCTGAACCTGG - Intronic
910101188 1:83579597-83579619 GAATCGCTTGAACCCACGAGTGG - Intergenic
910325107 1:85997692-85997714 GAATCGCTTGAACCCAGAGGCGG + Intronic
910874444 1:91865113-91865135 GAATCACTTGAACCCAGGAGAGG + Intronic
912073894 1:105848793-105848815 GAATCACTTGAACCCAGGAGAGG - Intergenic
912125990 1:106538746-106538768 GGATCACTTGAACCCAGAAGCGG - Intergenic
912478835 1:109962036-109962058 GAATCGCTTGAACCCAGAGGTGG + Intergenic
912829586 1:112940263-112940285 GGATCACTTGAGCCCAGCCCAGG - Intronic
912830210 1:112945902-112945924 GAATCACGTGAACCCAGAGGCGG + Intronic
912837037 1:113005677-113005699 GAATCGCTTGAACCCAGAGGTGG + Intergenic
912918859 1:113845288-113845310 GAATCACTTGAACCCGAACCTGG - Intronic
913504541 1:119504373-119504395 GAATCACTTGAACCCGGAAGTGG + Intergenic
913973874 1:143438198-143438220 GAATCGCTTGAAACCAAAACCGG + Intergenic
914068261 1:144263805-144263827 GAATCGCTTGAAACCAAAACCGG + Intergenic
914110894 1:144702549-144702571 GAATCGCTTGAAACCAAAACCGG - Intergenic
914264506 1:146026980-146027002 GAATCACTTGAGCCCAAGGCAGG - Intergenic
914735187 1:150409733-150409755 GAATCGCTTGAACCCAGAGGCGG - Intronic
914763663 1:150619183-150619205 GAATCACTTGAACCCAGAGGTGG + Intronic
914774081 1:150720159-150720181 GAATCACTTGAACCCAGAGGGGG - Intronic
914798060 1:150938589-150938611 GAATCACTTGAACCGGGACCTGG - Intronic
915145144 1:153792429-153792451 GAATCACTTGCACCCAGAGGCGG + Intergenic
915217844 1:154352010-154352032 GGATCACTTGAGCCCAGCCCAGG + Intergenic
915377025 1:155405392-155405414 GAATCACTTGAACCCAAGAGGGG + Intronic
915400925 1:155621115-155621137 GAATCACTTGAACCCAGTGGAGG - Intergenic
915516886 1:156418589-156418611 GAATCACTTGAACCCAGGAGGGG + Intronic
915534007 1:156523551-156523573 GAATCACTTGAACCCGGAGGTGG - Intergenic
916067841 1:161150836-161150858 GAATCACTTGAACCCAGGAGGGG + Intergenic
916724316 1:167509276-167509298 GAATCACTTGAACCCAGGATGGG + Intronic
917031675 1:170699821-170699843 GAATCACTTGAACCCAGGAGGGG - Intronic
917074584 1:171191055-171191077 GAATCACTTGAACCCAAGACGGG + Intronic
917190580 1:172414190-172414212 CAAGCACTTCAACACACACCTGG + Intronic
917423393 1:174888581-174888603 GAATCACTTGAACTCCAGCCTGG - Intronic
918020852 1:180688138-180688160 GAATCACTTGAACCCCCAGGAGG - Intronic
918061530 1:181065527-181065549 GAATCACTTGAACCCAGCGGAGG + Intergenic
918460056 1:184767328-184767350 GAATCACTTGAACCCAGAGGTGG - Intergenic
918876969 1:190060079-190060101 GAGTCACTTGAACCCAGAGGCGG - Intergenic
918894080 1:190317082-190317104 GAATCACTTGAACCCAGGAGAGG + Intronic
918996211 1:191763776-191763798 GGGTTACTTGAACCCAAACCTGG - Intergenic
919378524 1:196824343-196824365 GAATCACTTGAACCCAGGAGGGG - Intronic
919388213 1:196948361-196948383 GAATCACTTGAACCCAGGAGGGG - Intronic
919390772 1:196982583-196982605 GAATCACTTGAACCCAGTGGAGG + Intronic
919704709 1:200665365-200665387 GAATCACTTGAACCTGAACCTGG + Intronic
920107555 1:203564927-203564949 GAATCACTTGAACCCAGGAGGGG - Intergenic
920205819 1:204290899-204290921 GAATCACTTGAACCCAGGAGGGG + Intronic
920896251 1:210052573-210052595 GAATCACGTGAACCCAGAGCCGG + Intronic
921020776 1:211233801-211233823 GAATCACTTGAACCCAGGGGGGG - Intergenic
921087380 1:211808255-211808277 GAATCACTTGAACCCGGGCAGGG + Intronic
921304355 1:213780933-213780955 GAATCACTTGAACCCAGAAGGGG + Intergenic
921433172 1:215086232-215086254 GAAGCTCTGGAACCCAAACCAGG - Intronic
921778459 1:219131350-219131372 GAATCACTTGAACCCAGAGGAGG - Intergenic
921903406 1:220471876-220471898 GAATCACTTTAACCCAGAGGTGG - Intergenic
922096975 1:222450841-222450863 GAATCACTTGAACCCGGAGGCGG + Intergenic
922362435 1:224835715-224835737 GAATCACTTGAACCCAGGAGGGG - Intergenic
922509979 1:226157325-226157347 GAATCACTTGAACCCAGGAGGGG - Intronic
922710854 1:227830586-227830608 GAATCGCTTGAACCCAGAGGCGG - Intronic
923012615 1:230100411-230100433 GAATCACTTGAACCCGGAGGCGG - Intronic
923073096 1:230583698-230583720 GAATCACTTGAACCCAGGAAGGG - Intergenic
923113722 1:230914480-230914502 GAATCGCTTGAACCCATGACGGG - Intronic
923181616 1:231525883-231525905 GAATCTCTTGAACCCAGGGCGGG - Intergenic
923560884 1:235040702-235040724 GAATCACTTGAACCCAGGAGGGG + Intergenic
923575859 1:235158327-235158349 GAATCGCTTGAACCCAGAGGCGG + Intronic
923584673 1:235257567-235257589 GAATCACTTGAACCCTGAGGTGG - Intronic
923609019 1:235473000-235473022 GAATCACTTGAACCAGGACCTGG - Intronic
923646699 1:235829114-235829136 GAATCACTTGAACCCGGAGGTGG + Intronic
923708046 1:236361400-236361422 GAATCACTTGAACCCGGAGGTGG - Intronic
924216394 1:241826709-241826731 GAATCACTTGAATCCAGAGGCGG - Intergenic
924230103 1:241955792-241955814 GAATCACTTGAACCCCGAGGTGG + Intergenic
924314522 1:242782039-242782061 GAATCACTTGAACCCAGAGGCGG + Intergenic
924511744 1:244733498-244733520 GAATCACCTGAACCCAGAGGTGG - Intergenic
924558289 1:245135939-245135961 GAATCACTTGAACCCAGAGGTGG - Intergenic
924586637 1:245366442-245366464 GAATCACTTGAATCCAGAGGTGG + Intronic
924920287 1:248621746-248621768 GAATCACTTGAACCCAGGAGGGG + Intergenic
1062872159 10:914705-914727 GAATTGCTTGAACCGAGACCCGG + Intronic
1063190159 10:3686227-3686249 GAATCACTTGAACCCAGGAGGGG - Intergenic
1063213804 10:3905844-3905866 TAATCACTTCAATCCCCACCGGG - Intergenic
1063518054 10:6715551-6715573 GAATCACTTGAACCCAGAGGTGG + Intergenic
1063520890 10:6739606-6739628 GAATCACTTGAACCCAGAGGCGG + Intergenic
1063796252 10:9517004-9517026 GAATCACTTGAACCCAGGAGGGG - Intergenic
1064115081 10:12570862-12570884 GAATAACTTGAACCCAGAGGCGG + Intronic
1064145277 10:12821885-12821907 GAATCACTTGAACCCAAAGGCGG + Intronic
1064193554 10:13227628-13227650 GAATCACTTGAACTCGGAGCGGG + Intronic
1064294002 10:14061362-14061384 GAATCACTTGAACCCGGAGGCGG + Intronic
1064738577 10:18409209-18409231 GAATCACTTGAACCCGGAGGCGG + Intronic
1064767754 10:18692501-18692523 GAATCACTTGAACCCAGGAGGGG - Intergenic
1064785035 10:18885356-18885378 GAATCACTTGAACCCAGGAGGGG + Intergenic
1064976971 10:21126885-21126907 GAATCGCTTGAACCCAGGGCGGG + Intronic
1065022601 10:21512751-21512773 GAATCCAGTGAACCTACACCTGG + Intergenic
1065247932 10:23778027-23778049 GAATCACTTGAACCCGGAGGCGG - Intronic
1065378724 10:25067704-25067726 GAATCACTTGAACCCATAGGCGG + Intergenic
1065700329 10:28419102-28419124 GAATCACTTGAACAAACAGTAGG + Intergenic
1065723485 10:28648448-28648470 GAATCACTTGAACCCAGGAGCGG - Intergenic
1065727951 10:28684412-28684434 GAATCGCTTGAACCCGCGGCGGG - Intergenic
1065801068 10:29353013-29353035 GAATCGCTTGATCCCACAGGTGG - Intergenic
1065833603 10:29637397-29637419 GCATCGCTTGAACCCAATCCTGG + Intronic
1066115589 10:32236569-32236591 GAATCGCTTGAACCCAGAAACGG - Intergenic
1066553631 10:36586858-36586880 GAATCACTTGAACCCAGGATTGG + Intergenic
1066756252 10:38715883-38715905 GAATCACTTGAACCCAGAGGTGG - Intergenic
1067022187 10:42811127-42811149 GAATCACTTGAACCCGGAGGTGG - Intronic
1067094044 10:43286660-43286682 GAATCTCTGGAACCCAGAGCGGG + Intergenic
1067121780 10:43478463-43478485 GAATCACTTGAACCCAGGAGGGG + Intronic
1067370943 10:45681546-45681568 AAATCACTTGAACCCAGGTCAGG - Intergenic
1067388837 10:45844598-45844620 AAATCACTTGAACCCAGGTCAGG + Intronic
1067417228 10:46112354-46112376 AAATCACTTGAACCCAGGTCAGG - Intergenic
1067445428 10:46339962-46339984 AAATCACTTGAACCCAGGTCAGG - Intergenic
1067502642 10:46819242-46819264 AAATCACTTGAACCCAGGTCAGG - Intergenic
1067591946 10:47520771-47520793 AAATCACTTGAACCCAGGTCAGG + Intronic
1067639063 10:48028844-48028866 AAATCACTTGAACCCAGGTCAGG + Intergenic
1067729483 10:48799683-48799705 GAATCACTTGAACCCATAAGGGG + Intronic
1067857375 10:49806418-49806440 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1067874418 10:49991450-49991472 AAATCACTTGAACCCAGGTCAGG - Intronic
1067899621 10:50225326-50225348 GAATCACTTGAACCCCCAGGAGG + Intronic
1068294772 10:55055713-55055735 GAATTGCTTGAACCCAAACTTGG + Intronic
1068380141 10:56242671-56242693 GAATCACTTGAACCCAGAGGTGG - Intergenic
1068825582 10:61435266-61435288 GAATCACTTGAACCCGGAGGTGG - Intronic
1068983529 10:63086145-63086167 GAATCGCTTGAACCCAGGACAGG + Intergenic
1069003105 10:63287833-63287855 GAATCACTTGAACCCAGAAGTGG - Intronic
1069310181 10:67025040-67025062 GAATCACTTGAACCCAGGAGCGG + Intronic
1069448328 10:68494787-68494809 GAATCACTTGAACCCTCAGGAGG + Intronic
1069605484 10:69736372-69736394 GGATCACTTGAGCCCAGTCCAGG + Intergenic
1069770400 10:70895141-70895163 GAATCACTTGAACCCAGGATGGG - Intergenic
1069795362 10:71048389-71048411 GAATCACTTGAACCCAGCGGGGG + Intergenic
1069976950 10:72221644-72221666 GAATCACTTGAACCTGAACCTGG - Intronic
1070031036 10:72677639-72677661 GAATCACTTGAACCCAGGAGGGG + Intergenic
1070136053 10:73695008-73695030 AAATCACTTGAACCCAGGTCAGG + Intronic
1070190305 10:74106006-74106028 GAATCACTTGAATCCAGGCGGGG - Intronic
1070316695 10:75320391-75320413 GAATCACTTGAACCCAGGAGGGG + Intergenic
1070341365 10:75501368-75501390 GAATCATTTAAACACACACCAGG - Intronic
1070379608 10:75868881-75868903 GAATGGCTTGACCCCACCCCTGG + Intronic
1070466954 10:76733235-76733257 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1070477276 10:76841761-76841783 GAATCACTTGAACCCAGGAAGGG + Intergenic
1071050885 10:81448024-81448046 GAATCACTTGAACCCGGAGGTGG - Intergenic
1071132023 10:82405542-82405564 GAATCACTTGAACCCAGGAGGGG - Intronic
1071547702 10:86540839-86540861 GAATCACTTGAACCCAGAGTCGG - Intergenic
1071769729 10:88713851-88713873 GAATCACTTGAACCCAGGAGAGG + Intergenic
1072070458 10:91910245-91910267 GAATCACTTGAACCCGGGACAGG + Intergenic
1072092782 10:92145539-92145561 GAATCGCTTGAACCCGAACCCGG + Intronic
1072101562 10:92234017-92234039 GAATCGCTTGAACCCAGAGATGG + Intronic
1072156760 10:92730753-92730775 GAATCTCTTGAACCCAGAGGCGG - Intergenic
1072234663 10:93443072-93443094 GAATCACTTGAACCCGGAGGCGG + Intronic
1072282297 10:93877766-93877788 GAATCACTTGAACCCAGGATGGG + Intergenic
1072656016 10:97331038-97331060 GAATCACTTGAACCCAGGAGAGG + Intergenic
1072729721 10:97837580-97837602 GAATCACTTGAACCCAGGAAGGG - Intergenic
1072773591 10:98166080-98166102 GAATCACTTGAACCCGGAGGTGG + Intronic
1073019741 10:100433022-100433044 GAATCACTTGAACTTGAACCCGG + Intergenic
1073162133 10:101407498-101407520 GAATCACTTGAAGCCAGAGGCGG - Intronic
1073230459 10:101964923-101964945 GAATCACTTGAACCCAGAGGCGG + Intronic
1073237197 10:102027189-102027211 GAATCGCTTGAACCCAGGACAGG + Intronic
1073263200 10:102206141-102206163 GAATCACTTGAACCCAGAGGTGG + Intergenic
1073304956 10:102495639-102495661 GAATCTCTTGAACCCACAAGGGG + Intronic
1073412394 10:103352682-103352704 GAATCACTTGAACACAGACGAGG + Intergenic
1073434009 10:103505308-103505330 GAATTGCTTGAACCCAGACATGG - Intronic
1073468290 10:103707281-103707303 GAATCACTTGAACCCGGAGGCGG - Intronic
1073831027 10:107384002-107384024 GAATCACTTGAACCCAAGAGAGG - Intergenic
1073923584 10:108487108-108487130 GAATCACTTGAACCCAGGGGTGG + Intergenic
1074132042 10:110588076-110588098 GAATCACTTGAACCCAGGATGGG - Intronic
1074594009 10:114843390-114843412 GAATCGCTTGAACCCAGAGGCGG - Intronic
1074603740 10:114940207-114940229 GAATCACTTGAACCCAGGAGGGG - Intronic
1074901708 10:117822180-117822202 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1074969618 10:118525340-118525362 GAACCTGTTGAACCAACACCAGG - Intergenic
1075051511 10:119185878-119185900 GAATCACTTGAACCCAGGAGTGG - Intergenic
1076167089 10:128291500-128291522 GACACACTGGAACCCACAACAGG + Intergenic
1076418416 10:130309418-130309440 GAATCACTTGAACCCAGGAGAGG - Intergenic
1076704866 10:132295794-132295816 GAATCGCTTGAACCCAGAGGCGG + Intronic
1076906373 10:133364030-133364052 GAATCGCTTGAACCCAGAGGCGG - Intronic
1077276624 11:1714335-1714357 GAATTGCTTGAACCCAAACAAGG - Intergenic
1077277407 11:1720489-1720511 GAATCACTTGAACCCGGAGGTGG - Intergenic
1077953158 11:6984193-6984215 GAATCACTTGAACCCAGAGGTGG - Intronic
1078284858 11:9942153-9942175 GAATCACTTGAGCCCACTCGAGG - Intronic
1078369185 11:10730943-10730965 GAATCGCTTGAGCCCAACCCAGG + Intergenic
1079057577 11:17219878-17219900 GAATCGCTTGAACCCAGGACGGG + Intronic
1079206786 11:18422465-18422487 GAATCACTTGAACCCGGAGGTGG + Intronic
1079499512 11:21086924-21086946 GAATCACTTGAACCTTGAACTGG - Intronic
1080753066 11:35168466-35168488 GAATACCTTGAACCCAGACTAGG + Intronic
1081941156 11:46943461-46943483 GAATCACTTGACCTTACTCCAGG - Intronic
1082750714 11:57012602-57012624 GAATCACTTTACCTAACACCAGG - Intergenic
1083359495 11:62096191-62096213 GAATCGCTTGAACCGAAACCTGG + Intergenic
1083359957 11:62099827-62099849 GAATCGCTTGAACCGAAACCTGG - Intergenic
1083378984 11:62248863-62248885 GAATCGCTTGAACCCAGCCTGGG - Intergenic
1083390100 11:62342668-62342690 GAATCACTTGAACCCAGAAGGGG + Intronic
1083420508 11:62550005-62550027 TAATCACTTGAACCCAGAGGTGG - Intronic
1083453708 11:62763827-62763849 GAATCGCTTGAACCCAGAGGCGG - Intronic
1083463219 11:62828974-62828996 GAATCACTTAAACCCAGAGGTGG + Intronic
1083552803 11:63603004-63603026 GAATCGCTTGAACCCAGAGGCGG + Intronic
1083882719 11:65556438-65556460 GAATCACTTGAACCCAGAAGGGG + Intronic
1084035270 11:66506034-66506056 GAATCGCTTGAACCCAGAGGCGG - Intronic
1084060886 11:66673544-66673566 GAATCACTTGAACCCAGAGGCGG - Intronic
1084866565 11:72062979-72063001 GAATCACTTGAACCTGGAACAGG + Intronic
1085104373 11:73829590-73829612 GGATCACTTGAACCCAGGACCGG - Intronic
1086668943 11:89523109-89523131 GAATCACTTGAACCCGGAGGTGG - Intergenic
1087759628 11:102091788-102091810 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1088557833 11:111080715-111080737 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1089512852 11:119011465-119011487 GAATCGCTTGAACCTGAACCTGG - Intronic
1090024698 11:123157629-123157651 GAATCACTTGAACCCCGAGTGGG + Intronic
1090172330 11:124615922-124615944 GAATTGCTTGAACCCACAGGAGG + Intronic
1090321768 11:125851223-125851245 GAATTACTTGAACCCAGAGGCGG - Intergenic
1090705642 11:129333769-129333791 GAATCACTTGAACCCAGGAGGGG + Intergenic
1090933445 11:131320542-131320564 GAATCACTTGAACCCAGGAGAGG - Intergenic
1091149782 11:133317108-133317130 GAATCACCTGAACCCAGAGGCGG + Intronic
1091267100 11:134279452-134279474 GAATCACTTGAACCCAGGAGGGG - Intronic
1092211632 12:6650161-6650183 GAATCACTTGAACCCGGAGGCGG + Intergenic
1092227428 12:6756960-6756982 GAATCACTTGAACCCAAGCTGGG - Intronic
1092356539 12:7800140-7800162 GAATCACTTGAACCCGTAGGTGG + Intergenic
1092366097 12:7878344-7878366 GAATCACTTGAACCCAGGGCTGG - Intronic
1092460149 12:8679268-8679290 GAATCACTTGAACCGAGAGGGGG - Intergenic
1092863041 12:12736008-12736030 GGATCACTTGAACCCAGCCTGGG + Intronic
1092978724 12:13771959-13771981 AAATCAGTGGGACCCACACCAGG - Intronic
1093159039 12:15723099-15723121 GCATCACTTGAACCCAGCCTGGG + Intronic
1093314565 12:17632462-17632484 GAATCACTTGAACCCAGAGACGG - Intergenic
1094456870 12:30644738-30644760 GAATCACTTGAACCCAGAGGCGG - Intronic
1094577350 12:31699307-31699329 GAATCACTTGAACCCAGAGGTGG + Intronic
1094819665 12:34214572-34214594 GAATCACTGGCACACCCACCAGG + Intergenic
1095095063 12:38142905-38142927 GAATCACTGGCACACCCACCAGG - Intergenic
1095526958 12:43138185-43138207 GAATCACTTGAACCCAGAGGTGG + Intergenic
1096048384 12:48584823-48584845 GAATCACTTGAACCCGGAGGCGG + Intergenic
1096204816 12:49712428-49712450 GAATCACTTGAACCCAGAGGTGG - Intronic
1096265289 12:50117829-50117851 GAATCACTTGAACCCGGAGGCGG - Intronic
1096294365 12:50371203-50371225 GAATCACTTGAACCCTGAGGTGG - Intronic
1096312841 12:50536653-50536675 GAATCGCTTGAACCCAGAAGAGG - Intronic
1096682329 12:53264707-53264729 GAATCGCTTGAACCCAGAGGTGG - Intergenic
1096697776 12:53361423-53361445 GAATCACTTGAACCCGGGACGGG + Intergenic
1097839351 12:64306458-64306480 GAATCGCTTGAACCCAGCCTGGG - Intronic
1097881087 12:64687079-64687101 GAATCTCTTGAACCCAGAGGTGG - Intronic
1098362233 12:69666105-69666127 GAATCACTTGAACCCAGGAGGGG - Intronic
1098456273 12:70678126-70678148 GAATCACTTGAACCCGGGACTGG - Intronic
1098576356 12:72047292-72047314 GAATCACTTGAACCCAGGAGTGG - Intronic
1098602106 12:72344555-72344577 CTATCACTGGAACCCAAACCAGG - Intronic
1098817703 12:75188770-75188792 GAATCACTTGAACCCGGAGTTGG + Intronic
1100192988 12:92212821-92212843 GAATCACTGGAACCCAGAGGCGG - Intergenic
1100421338 12:94436741-94436763 GAATCACTTGAACCCGGAGGAGG + Intronic
1100481582 12:94984440-94984462 GAATCGCTTGAACCCAGAGGCGG + Intronic
1100598169 12:96089422-96089444 GAATCACTTGAACCCGGAGGCGG - Intergenic
1101079102 12:101163589-101163611 AAATCACTTGAACCCAGAGGTGG + Intronic
1101344142 12:103869707-103869729 GAATCGCTTGAACCTGAACCTGG - Intergenic
1101413576 12:104489564-104489586 GAATCACTTGAACCCAGGACGGG - Intronic
1101454887 12:104820727-104820749 GAATCACTTGAACCCAGGAGGGG - Intronic
1101499803 12:105292522-105292544 GGATCACTTGAGCCCAGAGCTGG + Intronic
1101942161 12:109107611-109107633 GAATCACTTGAACCCAGGAGGGG - Intronic
1102051986 12:109869210-109869232 GAATCACTTGAACCCAGGATGGG + Intronic
1102118241 12:110419856-110419878 GAATCACTTGAACCCGGAGGTGG + Intergenic
1102467314 12:113137453-113137475 GAATCACTTGAACCCAGGAGTGG - Intergenic
1102898653 12:116618963-116618985 GAATCACTTGAACCTAGAAGTGG + Intergenic
1103107545 12:118243768-118243790 GAATCACTTGAACCTTGAACCGG - Intronic
1103120301 12:118374294-118374316 GAATCACTTGAACCCGGAGGCGG + Intergenic
1103148102 12:118612653-118612675 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1103296515 12:119891788-119891810 GAATCACTTGAACCCAGAGGTGG - Intergenic
1103350573 12:120280690-120280712 GAATCACTTGAACCCGGAGGGGG + Intergenic
1103350733 12:120281793-120281815 GAATCACTTGAACCCAGGAGTGG + Intergenic
1103720149 12:122969525-122969547 GGATCACTTGAACCCAGCCCGGG + Intronic
1103896538 12:124277337-124277359 GTAACACCAGAACCCACACCTGG - Intronic
1104214461 12:126722561-126722583 GGATCACTTGAGCCCAGATCAGG + Intergenic
1104321308 12:127753999-127754021 GAATCACTTGAACCGGGACGAGG - Intergenic
1104517266 12:129439535-129439557 GAATCACTTGAACCCAGGAGGGG - Intronic
1104888378 12:132125531-132125553 GAATCACTTGAACCCAGGAGGGG - Intronic
1105341356 13:19529029-19529051 GAATCACCTGAACCCAGAGGCGG + Intronic
1105524742 13:21166644-21166666 GAATCACTTGAACCCAGTGGTGG + Intronic
1105774518 13:23645287-23645309 GAATCCCTTGAACCCAGAAGTGG - Intronic
1105868885 13:24486862-24486884 GAATCACTTGAACCCGGGGCGGG + Intronic
1105952776 13:25245790-25245812 GAATCACTTGAACCCAGAGGCGG + Intergenic
1106179886 13:27361594-27361616 GAATCACTTGAACCCAGAGGCGG - Intergenic
1106195696 13:27492211-27492233 GAATCACTTGAACCCGGAGGCGG - Intergenic
1106211564 13:27652777-27652799 GAATCACTTGAACCTGCAAGAGG + Intronic
1106351887 13:28938292-28938314 GAATCACTTGAACCCAGAGGTGG + Intronic
1107071000 13:36269015-36269037 GAATCACTTGAACCATCAGGTGG + Intronic
1107536826 13:41343615-41343637 GAATCACTTGAACCCAGAGGTGG - Intronic
1107997439 13:45874625-45874647 GAATCACTTGAACCCAGGAGTGG - Intergenic
1108109027 13:47047436-47047458 GAATCCCTTGAACCCAGAGGCGG + Intergenic
1108390241 13:49940258-49940280 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1108551814 13:51553771-51553793 GAATCACTTGAACCCAAGAAGGG - Intergenic
1108686210 13:52821113-52821135 GAATCACTTGAACCCGGAGGCGG - Intergenic
1108706018 13:52988302-52988324 GAATCACTTGAACCCGGAGGCGG - Intergenic
1109177099 13:59169501-59169523 GAATCACTTGAACCCAGGAGGGG + Intergenic
1109413054 13:61999239-61999261 GAATCACTTGAAACCAGAAGGGG - Intergenic
1109850791 13:68060260-68060282 GAATCCCTTGAACCCAGAGAAGG + Intergenic
1110212409 13:72988948-72988970 GAATCACTTGAACCCAGGAGGGG + Intronic
1110326257 13:74219042-74219064 GAATCACTTGAACCCAGAGATGG - Intergenic
1110614899 13:77530411-77530433 GAATCACTTGAACCCGGAGGCGG + Intergenic
1111100468 13:83578082-83578104 GAATCACTTGAACTTGAACCCGG + Intergenic
1111293975 13:86256363-86256385 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1111298729 13:86318349-86318371 GAATTGCTTGAACCTCCACCAGG + Intergenic
1111400812 13:87732421-87732443 GAATCACTTGAACCCAGGAGGGG + Intergenic
1111480969 13:88825821-88825843 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1111593579 13:90381480-90381502 GAATCACTTGAACCCAGGAGGGG + Intergenic
1112817993 13:103296062-103296084 GAATCACTTGAACCCAGGAAGGG - Intergenic
1113180057 13:107614862-107614884 GAATCACTTGAACCGAGAGGCGG - Intronic
1114230202 14:20774386-20774408 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1114254919 14:20993560-20993582 GAATCACTTGAACCCAGGAGTGG - Intronic
1114437534 14:22719885-22719907 GAATCACTTGAACCCGGAGGAGG - Intergenic
1114541556 14:23464040-23464062 GAATTGCTTGAACCCAACCCAGG - Intergenic
1114592335 14:23877611-23877633 AAATCACTTGAACCCAGAGGTGG + Intergenic
1114763376 14:25343457-25343479 GAATCACTTGAACACAGAGGTGG + Intergenic
1115097889 14:29660664-29660686 AAGCCAATTGAACCCACACCAGG - Intronic
1115414817 14:33120045-33120067 GAATCACTTGAACCCAACCTGGG - Intronic
1115572500 14:34680177-34680199 GAATCACTTGAACCCGGAGGCGG - Intergenic
1115578439 14:34734211-34734233 GAATCGCTTGAACCCAGACGGGG + Intergenic
1115619787 14:35130569-35130591 GAATCACTTGAACCCAGTGGGGG - Intronic
1115768923 14:36650318-36650340 GAAATACTTGAAAGCACACCAGG - Intergenic
1115820147 14:37205188-37205210 GAATCACTTGAACCCAGAGGTGG - Intronic
1116076798 14:40121098-40121120 GAATCACTTGAACCCAGAGGTGG - Intergenic
1116456754 14:45128247-45128269 GAATCACTTGAACCCAGGAGGGG + Intronic
1117116692 14:52521198-52521220 GAATCACTTGAACCCAGGGTGGG - Intronic
1117599803 14:57363732-57363754 GAATCACTTGAACCCAGGAAGGG - Intergenic
1118345158 14:64934258-64934280 GAATCGCTTGAACCCGCGACAGG + Exonic
1119506734 14:75179581-75179603 GAATCACTTGAACCCAGGAGGGG - Intergenic
1119654981 14:76410869-76410891 GAATCACTTGAACCCAGAAGGGG - Intronic
1119680665 14:76590197-76590219 GAATCACTTGAACCAAGAGATGG + Intergenic
1119900398 14:78254589-78254611 GAATCATTTGAACCCAGAGGTGG + Intronic
1120185298 14:81387802-81387824 GAATCACTTCAACCCAGAAGCGG + Intronic
1120397733 14:83989492-83989514 GAATCACATGAACTTATACCTGG - Intergenic
1121045988 14:90788075-90788097 GAATCACTTGAACCCAGGAGTGG + Intronic
1121209385 14:92196410-92196432 GAATCGCTTGAACCCAGAAGGGG - Intergenic
1121730609 14:96184485-96184507 GAATCACTTGAACCCAGGAGGGG + Intergenic
1122132628 14:99613821-99613843 GAATCACTTGAACCCAGGAGTGG + Intergenic
1123440513 15:20287947-20287969 GAATCACTTGAACCCAGAGATGG - Intergenic
1123634439 15:22289927-22289949 GAATCACTTGAACCCAGAGGCGG - Intergenic
1123818243 15:24001003-24001025 GAATTGCTTGAACCGAGACCTGG - Intergenic
1124428655 15:29586659-29586681 GAATCACTTGAACCCGGGACGGG + Intergenic
1124839992 15:33232722-33232744 GAATCGCTTGAACCCTCGGCGGG + Intergenic
1124949166 15:34300572-34300594 GGATCACTTGAGCCCAGACCAGG + Intronic
1125437366 15:39660973-39660995 GAATCACTTGAACCCAGGGATGG + Intronic
1125557449 15:40598084-40598106 GAATCACTTGAACCCAGGATGGG + Intronic
1125582624 15:40797498-40797520 GAATCGCTTGAACCCAGAGGCGG - Intronic
1125633359 15:41166812-41166834 GAATCACTTGAACCCAGAGGTGG - Intergenic
1125643457 15:41250920-41250942 GAATCACTTGAACCCGGAAGCGG - Intronic
1125644526 15:41260970-41260992 GAATCACTTGAACACACAGGAGG - Intronic
1125664991 15:41423455-41423477 GAATCACTTGAACCTAGAGGCGG - Intronic
1125833709 15:42733362-42733384 GAATCGCTTGAACCCAGGCGGGG - Intronic
1125863788 15:43023501-43023523 GAATCGCTTGAACCCAGAGGCGG + Intronic
1125954919 15:43783846-43783868 GAATCACATGAACCCAGAGGTGG - Intronic
1126036116 15:44547535-44547557 GAATCACTTGAACCCAGGAGTGG - Intronic
1126186562 15:45836312-45836334 GAATCACTTGAACCCGGAAGAGG - Intergenic
1126598191 15:50402721-50402743 GAATCACTTGAACCCAGGAGGGG - Intergenic
1126827135 15:52562961-52562983 GAATCACTTGAACCCAGCGTGGG - Intronic
1126999592 15:54486347-54486369 GAATCACTTGAACCCCCAGGAGG + Intronic
1127270413 15:57396359-57396381 GAATCACCTGAACCCAGAGGTGG - Intronic
1127523952 15:59773645-59773667 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1127913030 15:63434137-63434159 GAATCACTTGAACCCAGGGACGG + Intergenic
1128327834 15:66736755-66736777 GAATCACTTGAACCCAGGGTGGG - Intronic
1128488988 15:68127016-68127038 GAATCACTTGAACCCAGGAGAGG - Intronic
1129013658 15:72446368-72446390 GAATCACTTGAACCCAGGAGGGG - Intergenic
1129320991 15:74774793-74774815 GAATCACTTGAACCCAGGGTGGG + Intergenic
1129420315 15:75419735-75419757 GAATCACTTGAACCCAGGCAGGG + Intronic
1129826194 15:78636649-78636671 GAATCACTTGAAACCAGCCTGGG - Intronic
1130139932 15:81216453-81216475 GCATCACTTCTACCCACCCCTGG + Intronic
1130615570 15:85403764-85403786 GAATCGCTTGAACCACCTCCCGG - Intronic
1130646412 15:85731090-85731112 GAATCACTTGAACCCAGGAGGGG - Intronic
1130976083 15:88776349-88776371 GAATCACTTGAAGCCAGGCATGG + Intergenic
1131166368 15:90144908-90144930 GAATCACTTGAACCCAGAGGCGG + Intergenic
1131253878 15:90848640-90848662 GAATCACTTGAACCCAGGAAGGG - Intergenic
1132338792 15:101065255-101065277 GACTCATCTGCACCCACACCAGG - Intronic
1132529158 16:436395-436417 GAATCCCTTGAACCCACCCCAGG - Intronic
1132682830 16:1150530-1150552 GAATCGCTTGAACTGACACCAGG + Intergenic
1133161066 16:3912123-3912145 GAATCACTTGAACCCAGGAGGGG + Intergenic
1133228972 16:4357445-4357467 GAATCGCTTGAACCCAGAGGAGG - Intronic
1133322069 16:4920548-4920570 GAATCACTTGAATCCAGAGACGG - Intronic
1133383569 16:5350776-5350798 GAATCACTTGAACCCGGAGGCGG + Intergenic
1133494450 16:6303897-6303919 GAATCACTTGAACCCAGGAGGGG - Intronic
1133999394 16:10770781-10770803 GAATCACTTGAACCCGGAGCCGG + Intronic
1134087384 16:11367212-11367234 GAATCGCTTGAACCCAGGGCGGG - Intronic
1134244580 16:12530641-12530663 GAATCGCTTGAACCCAGAAGAGG - Intronic
1134287003 16:12870458-12870480 CAATCACTTGGGCCCACTCCTGG - Intergenic
1134299295 16:12975414-12975436 GAATCGCTTGAACCCAGAGGTGG + Intronic
1134857943 16:17536308-17536330 GAATCACTTGAACCCGGAGGTGG + Intergenic
1134860636 16:17557289-17557311 GAATCACTTGAACCCGGAGGTGG - Intergenic
1135089266 16:19499966-19499988 GAATCACTTGAACCCAGGAGGGG - Intergenic
1135124770 16:19799356-19799378 GAATCGCTTGAACCCAGAGGCGG - Intronic
1135262626 16:20994342-20994364 GAATCACTTGAACCCGGAGGCGG + Intronic
1135333995 16:21585722-21585744 GAATCGCTTGAACCCAGAAGGGG - Intergenic
1135350012 16:21721000-21721022 GAATCACTTGAACCCAGGGGCGG - Intronic
1135373755 16:21927310-21927332 GAATCACTTGAACCCAGGAGTGG + Intergenic
1135496665 16:22957308-22957330 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1135548855 16:23383294-23383316 GAATCGCTTGAACCCAGGACGGG - Intergenic
1135678439 16:24436990-24437012 GGATCACTTGAGCCCAGAGCTGG + Intergenic
1136340028 16:29636873-29636895 GAATCACTAGAACCCAGAGGTGG - Intergenic
1136666129 16:31814697-31814719 GAATCACTTGAACCCAGGAGGGG - Intergenic
1136726424 16:32360985-32361007 GAATCACTTGAACCCAGAGGTGG + Intergenic
1136844666 16:33566497-33566519 GAATCACTTGAACTCAGAGGTGG + Intergenic
1137273954 16:46921259-46921281 GAATTGCTTGAACCAAGACCGGG - Intronic
1137619154 16:49865033-49865055 GAATCACTTGAACCCGGAGGTGG + Intergenic
1138055029 16:53823796-53823818 GAATCACTTGAACCCAGGAGTGG + Intronic
1138197995 16:55068310-55068332 GAATCACTTGAACCCGGAGGTGG + Intergenic
1138371709 16:56532272-56532294 GAATCACTTGAACCCAGGATGGG - Intergenic
1138634424 16:58325643-58325665 GAACCACTTGAACCCGGACACGG + Intronic
1138682363 16:58694674-58694696 GAATCACTTGAACCCAGGAGAGG - Intergenic
1138696427 16:58817805-58817827 GAATCACTTGAACGCAGAGGCGG - Intergenic
1139107474 16:63844435-63844457 GAATCACTTGAACCCAGGATGGG + Intergenic
1139181746 16:64756065-64756087 GAATCACTTGAACCCAGAGGAGG + Intergenic
1139479197 16:67219523-67219545 GAATCACTTGAACCCAGGGGTGG - Intronic
1139556496 16:67714389-67714411 GAATCGCTTGAACCCAGAAGTGG + Intronic
1139685296 16:68598640-68598662 GAATCGCTTGAACCCAGAATGGG + Intergenic
1139760431 16:69180443-69180465 GGATCACTTGAGCCCAGACTGGG - Intronic
1140192394 16:72829090-72829112 GAACCACTTGAACCCTCAACTGG - Intronic
1140207243 16:72943443-72943465 GAATCACTTGAACCCAGAGGCGG + Intronic
1140347594 16:74228937-74228959 GAATCACTTTAACAACCACCTGG - Intergenic
1140445805 16:75026846-75026868 GAATCACTTGAACCCAGAGGCGG + Intronic
1140698411 16:77558461-77558483 GAATCACTTGAACCCAGGAGGGG + Intergenic
1141193830 16:81844407-81844429 GAATCACTTGAACCCATTGTGGG - Intronic
1141650337 16:85389370-85389392 GAATCACTTGAACCCGGGCGGGG + Intergenic
1141717842 16:85736954-85736976 GAATCACTTGAACCCGTAGGTGG + Intronic
1142021179 16:87783668-87783690 GAATCACTTGAACCCAGGAAGGG + Intergenic
1142042706 16:87905444-87905466 GAATCACTAGAACCCAGAGGTGG - Intronic
1203000009 16_KI270728v1_random:156772-156794 GAATCACTTGAACCCAGAGGTGG - Intergenic
1203131609 16_KI270728v1_random:1693173-1693195 GAATCACTTGAACCCAGAGGTGG - Intergenic
1203154834 16_KI270728v1_random:1866795-1866817 GAATCACTTGAACTCAGAGGTGG + Intergenic
1142548793 17:724766-724788 GAATCGCTTGAACCCAGAGGTGG - Intergenic
1142689553 17:1597126-1597148 GAATCACTTGAACCCAGGCGGGG + Intronic
1142797203 17:2317594-2317616 AAATCACTTGAACCCGGCCCTGG + Intronic
1142843820 17:2656008-2656030 GAATCACTTGAACCCAGGGGCGG - Intronic
1142991388 17:3733506-3733528 GAATCACTTGAACCCGGAGGTGG - Intronic
1143021702 17:3920046-3920068 GAATTACTTGAACCCAGGACAGG + Intergenic
1143132012 17:4684786-4684808 GAATCGCTTGAACCAGGACCTGG - Intronic
1143232877 17:5372355-5372377 GAATCACTTGAACCGGGACTCGG + Intronic
1143658297 17:8310242-8310264 GAATCACAGGAACACACACTTGG + Intronic
1143698333 17:8637548-8637570 GAATCGCTTGAACCCAGACAGGG + Intergenic
1143831397 17:9654560-9654582 GAATCACTTGAACCCATAGGTGG + Intronic
1143988343 17:10934982-10935004 GAATCACTTGAACCCGCGAGGGG - Intergenic
1144210024 17:13006280-13006302 GAATCGCTTGAACCCAGAGGCGG + Intronic
1144646407 17:16977282-16977304 GGAACACGTGAACCAACACCAGG - Intergenic
1144715978 17:17436184-17436206 GAATCACTTGAACCCGGAGCGGG + Intergenic
1144735056 17:17550755-17550777 GACACACTCGCACCCACACCTGG + Intronic
1144790982 17:17859161-17859183 GAATCGCTTGAACCCAAAGGCGG - Intronic
1145022758 17:19444405-19444427 GAATCACTTGAACCCAGAGGCGG - Intergenic
1145223316 17:21106960-21106982 GAATCACTTGAACCCAGGAGGGG - Intergenic
1145357795 17:22178635-22178657 GAATCACTTGAACCCAGGATTGG - Intergenic
1145735082 17:27223424-27223446 GGATCACTTGAACCCAGAGGTGG + Intergenic
1146196160 17:30814911-30814933 GAATCACTTGAACCCCCGGGAGG + Intronic
1146273847 17:31502134-31502156 GAATCACTTGAACCCAGGAGGGG + Intronic
1146404367 17:32524648-32524670 GAATCGCTTGAACCCAGAGGCGG - Intronic
1146532686 17:33623345-33623367 GAATCACTTGAACCCGGAGGTGG - Intronic
1147171090 17:38619275-38619297 GAATCACCTGAACCCAGAGGTGG + Intergenic
1147379503 17:40045359-40045381 GAATCACTTGAACCCAGCGGCGG + Intronic
1147398574 17:40164532-40164554 GAATCACTTGAACCCGGAGGTGG - Intronic
1147424323 17:40338618-40338640 GAATCACTTGAACCCGGAGGTGG + Intronic
1147606765 17:41777970-41777992 AAAACACTTCACCCCACACCAGG + Intronic
1147616427 17:41831229-41831251 GAATCACTTGAACCCAGGAGGGG + Intronic
1147623985 17:41887349-41887371 GAATCACTTGAACCCGGAAGCGG + Intronic
1147658923 17:42106710-42106732 GAATCACTTGAACCCAGGAGGGG + Intronic
1147833526 17:43314144-43314166 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1147926381 17:43948606-43948628 GAATCACTTGAACCCAGGAGGGG + Intergenic
1147950362 17:44104215-44104237 GAATCGCTTGAACCCAGAGGCGG + Intronic
1148048121 17:44756532-44756554 GAATCACTTGACCCCAGAGGTGG + Intergenic
1148164126 17:45470539-45470561 GAATCACTTGAACCCGGGACGGG + Intronic
1148248843 17:46056083-46056105 GAATCACTTGAACCCGGAGATGG - Intronic
1148370602 17:47096971-47096993 GAATCACTTGAACCCGGAGGTGG + Intergenic
1148485162 17:47986185-47986207 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1148611802 17:48969617-48969639 GAATCGCTTGAACCCAGACCTGG + Intergenic
1148613710 17:48982982-48983004 GAATCGCTTGAACCCAGAGGTGG - Intergenic
1148625752 17:49067799-49067821 GAATCACTTGAACCCAGAGGCGG - Intergenic
1148658365 17:49306838-49306860 GAATCGCTTGAGCCCACGACAGG - Intronic
1148705092 17:49623094-49623116 GAATCACTTGAACCCAGGAAAGG - Intronic
1148902099 17:50886013-50886035 GAATCACTTGAACCCAGAGGTGG - Intergenic
1148920488 17:51027342-51027364 GAATCACTTGAATCCAGAAGGGG + Intronic
1148939639 17:51197187-51197209 GAATTACTTGAACCCAGAAGGGG - Intronic
1148939911 17:51199527-51199549 GAATCACTTGAACCCAGGAAGGG - Intronic
1149699252 17:58641592-58641614 GAATCACTTGAACCTGAACCTGG - Intronic
1149717747 17:58810292-58810314 GAATCACTTGAACCCAGAGGCGG - Intronic
1149738884 17:59024124-59024146 GAATCACTTGAACCCAGGAGGGG + Intronic
1150043597 17:61889172-61889194 GAATCCCTTGAACCCAGAGGCGG - Intronic
1150071516 17:62154725-62154747 GAATCACTTGAACCCGGAGGCGG - Intergenic
1150095549 17:62371468-62371490 GAATCACTTGAACCCAGGAGGGG + Intronic
1150560465 17:66289873-66289895 GAATCGCTTGAACCATCAGCAGG - Intergenic
1150789814 17:68195096-68195118 GAATCACTTGAACCCAGAGGTGG + Intergenic
1151242572 17:72769630-72769652 GAATCACTTGAACCCAGGAGGGG - Intronic
1151648268 17:75448993-75449015 GAATCACTTGAACCCGGAGGTGG - Intronic
1151716148 17:75832028-75832050 GAATCACTTGAACCCGGAGGCGG + Intronic
1151739786 17:75972556-75972578 GAGTCACTTGAACCCAGAGGCGG + Intronic
1151818776 17:76485492-76485514 GAATCACTTGAACCCAGGACGGG + Intronic
1151884325 17:76914723-76914745 GAATCACTTGAACCCGGAGGTGG - Intronic
1151931976 17:77238201-77238223 GAATCGCTTGAACCCAACCCAGG - Intergenic
1152142669 17:78546816-78546838 GAATCGCTTGAACCCAGAGGCGG + Intronic
1152548297 17:81014273-81014295 GAATCACTTGAACCCAGGATGGG + Intergenic
1152835810 17:82530400-82530422 GAATCACTTGAACTCCAGCCTGG + Intronic
1152852393 17:82645208-82645230 GAATCACTTGAACCCAGGAGGGG + Intronic
1153055904 18:946058-946080 GAATCACTTGAACCCAGGAGTGG - Intergenic
1153058174 18:968517-968539 GAATCACTTGAACCCAGGAGAGG - Intergenic
1153260186 18:3216178-3216200 GAATCACTTGAACTCAGAGGCGG + Intronic
1153355566 18:4131278-4131300 GAATGACATGAGCCCACACATGG - Intronic
1153755346 18:8277022-8277044 GAATCAATTGAACCCAGGCAGGG - Intronic
1154058687 18:11037050-11037072 GACTCACTTGAACCCAGAGGTGG - Intronic
1154164951 18:12007863-12007885 GAATCGCTTGAACCCAGGACGGG - Intronic
1154215014 18:12409252-12409274 GAATCACTTGAACCCAGGAGGGG - Intronic
1155008619 18:21752782-21752804 GAATCTCATGAACATACACCTGG - Intronic
1155212888 18:23618491-23618513 GAATCACTTGAACCCAGAGGCGG + Intronic
1155216729 18:23649815-23649837 GAATCACTTGAACCCAGGAAGGG - Intronic
1155453544 18:25987474-25987496 GAATCGCTTGAACCCAGGACAGG + Intergenic
1155901452 18:31395899-31395921 AAATCACTTGAACGCGGACCAGG + Intronic
1156045892 18:32876994-32877016 GAATGACGTGAACCCGGACCTGG - Intergenic
1156059435 18:33055889-33055911 GAATCACTTGAACCCAGAGGTGG - Intronic
1157941639 18:51935111-51935133 GAATCACTTGAACCCAGAAGGGG + Intergenic
1158280031 18:55814411-55814433 GAATCACTTGAATCCAGAGGCGG - Intergenic
1158350231 18:56557533-56557555 GAATCACTTGAACCCAAGAGCGG + Intergenic
1158496960 18:57964349-57964371 GAATCACTTGAACCCGGGGCAGG + Intergenic
1158525171 18:58206847-58206869 GAATCAATTGCATCCCCACCTGG + Intronic
1158598025 18:58833298-58833320 GAATCACTTGAACCCAGGAGAGG + Intergenic
1158614088 18:58969969-58969991 GAATCGCTTGAACCCAGAGTGGG - Intronic
1159525561 18:69584371-69584393 GAATCGCTTGAACCCAGAGGTGG - Intronic
1160443193 18:78908166-78908188 GAATCTCTTGAACCCAGAGGTGG + Intergenic
1160492361 18:79348894-79348916 GAATCACTTGAACCCGGGACGGG + Intronic
1160537365 18:79602188-79602210 GAATCACTTGAACCCAGGAGTGG - Intergenic
1160736347 19:664130-664152 GAATCGCTTGAACCCTCGGCAGG - Intergenic
1160766344 19:810217-810239 GAATCACTTGAACCTGCAGGCGG + Intronic
1160813425 19:1023955-1023977 GGATCACTTGAATCCAGACTGGG + Intergenic
1161047155 19:2141518-2141540 GAATCACTTGAACCGAGAGGCGG - Intronic
1161305924 19:3567961-3567983 GAATCACTTGAACCTAGAGGCGG - Intronic
1161715164 19:5872106-5872128 GAATCACTTGAACGCAGAGGTGG - Intronic
1161806961 19:6449943-6449965 GAATCGCTTGAACCCAGGGCGGG - Intronic
1161866413 19:6835959-6835981 GAATCACTTGAACTCCCAGGAGG - Intronic
1161996129 19:7712750-7712772 GAATCACTTGAACCCAGGAGGGG - Intergenic
1162157023 19:8685208-8685230 GAATCGCTTGAACCCACGAAGGG - Intergenic
1162211375 19:9094889-9094911 GGATCACTTGAACCCAGAGGCGG - Intergenic
1162280402 19:9692302-9692324 AAATCACTTGAACCCAGAGGTGG - Intronic
1162293551 19:9797068-9797090 GAATCACTTGAACCCGGAGGTGG - Intergenic
1162309484 19:9897239-9897261 GAATCACTTGAACCCAGAGGTGG + Intronic
1162347365 19:10127290-10127312 GAATCCCTTGAACCCAAAGATGG + Intergenic
1162469844 19:10866123-10866145 GAATCACTTGAACCCAGGGGGGG - Intronic
1162507873 19:11097776-11097798 GAATCACTTGAACCCAGAGGTGG + Intronic
1162564903 19:11440531-11440553 GAATCACTTGAACCCGGATGTGG - Intronic
1162811321 19:13165812-13165834 GAATCACTTGAACCCAGAGACGG - Intergenic
1163108927 19:15145820-15145842 GAATCACTTGAACCCAGAGGCGG + Intergenic
1163257108 19:16162975-16162997 GAGTAACTTGAACCCGAACCTGG - Intronic
1163451663 19:17381227-17381249 GAATCACTTGAACCCAGAGGTGG - Intergenic
1163469510 19:17488269-17488291 GAATCGCTTGAACCCAGAGGCGG + Intronic
1163481199 19:17557386-17557408 GAATCACTTGAACCCGGAGGCGG - Intronic
1163714232 19:18864824-18864846 GAATCGCTTGAACCCAGAGGGGG - Intronic
1163873741 19:19848112-19848134 GAATCACTTGAACCCAGGAAAGG + Intergenic
1163919335 19:20274175-20274197 GAATCACTTGAACCCAGGAGGGG + Intergenic
1164048211 19:21561174-21561196 GAATTGCTTGAACCGGCACCCGG - Intergenic
1164115690 19:22216709-22216731 GAATCGCTTGAACCCAGAGAGGG - Intergenic
1164138209 19:22433359-22433381 GAATCACTTGAACCCAGGAGGGG + Intronic
1164146707 19:22517153-22517175 GAATCGCTTGAACCCCCAGAAGG + Intronic
1164170574 19:22721477-22721499 GAATCACTTGAACCCAGCAGGGG - Intergenic
1164251358 19:23479143-23479165 GAATCACTTGAACCCAGGAGGGG + Intergenic
1164312133 19:24055364-24055386 GAATCACTTGAACCCGGAGGTGG - Intronic
1164475648 19:28573851-28573873 GAATCACTTGAACCCAGGAGGGG + Intergenic
1164825679 19:31283244-31283266 GAATCACTTGAACCCGGAGGTGG + Intronic
1164904257 19:31954065-31954087 GAATCACTTGAACCTGGAGCTGG + Intergenic
1164973339 19:32551136-32551158 GAATCACTTGAACCCAGGATGGG - Intergenic
1165050523 19:33138768-33138790 GAATCACTTGAACCCAGAGGCGG - Intronic
1165052248 19:33149233-33149255 GAATCACTTGAACCCGGAGGTGG + Intronic
1165201224 19:34146400-34146422 GAATCACTTGAACCCAGGAGGGG + Intergenic
1165243622 19:34485168-34485190 GAATCACTTGAACCCGGAGGTGG - Intronic
1165413179 19:35674952-35674974 GAATCACTTGAACCCAGGAGGGG + Intronic
1165447809 19:35866282-35866304 CTATGACTTCAACCCACACCTGG + Exonic
1165525272 19:36349139-36349161 GAATCACTTGAACCCAGGAGAGG + Intronic
1165801965 19:38557714-38557736 GAATCACTTGAACCCAGGAGGGG + Intronic
1165870148 19:38966055-38966077 GAATCGCTTGAACCCAGAAGTGG - Intronic
1165955945 19:39502348-39502370 GAATCACTTGCACCCAGAAGTGG - Intronic
1166032905 19:40146484-40146506 GAATCCCTTGAACCCAGAGGTGG - Intergenic
1166070955 19:40387564-40387586 GAATCGCTTGAACCCATATGGGG - Intronic
1166083439 19:40459239-40459261 GAATCACTTGACCCGACAGGCGG + Intronic
1166521744 19:43485642-43485664 GAATCACTTGAACCCGCAGGTGG - Intronic
1166526774 19:43515660-43515682 GAATCACTTGAACCCAGGAGGGG - Intronic
1166527167 19:43519097-43519119 GAATCACTTGAACACCCAGGAGG - Intronic
1166527607 19:43522567-43522589 GAATCGCTTGAACCTCCCCCGGG - Intronic
1166953438 19:46445918-46445940 GAATCACTTGAACCCAGAGGTGG - Intergenic
1167133606 19:47603546-47603568 GAATCGCTTGAACCCAAAAGAGG - Intergenic
1167163870 19:47784889-47784911 GAATCACTTGAACCCAGGAGAGG - Intergenic
1167346771 19:48950738-48950760 GAATCACTTGAACCCGGAGGCGG + Intergenic
1167733923 19:51279620-51279642 GAATCACTTGAACCCAGGAGTGG + Intergenic
1167750708 19:51378255-51378277 GAATCACTTGAACCCAGGAGGGG + Intergenic
1167847263 19:52174679-52174701 GAATCTCTTGAACCCAGGACAGG + Intergenic
1167934098 19:52892277-52892299 GAATCACTTGAACCCGGAGGCGG + Intronic
1168031979 19:53687419-53687441 GAATCACTTGAACGGACAGATGG + Intergenic
1168033180 19:53697788-53697810 GAATCACTTGAACCCAGGAGGGG - Intergenic
1168050708 19:53827520-53827542 GAATCACTTGAACCCAGGAGTGG + Intergenic
1168154870 19:54467608-54467630 GAATCGCTTGAACCCCAGCCTGG - Intronic
1168218123 19:54941280-54941302 GAATCACTTGAACCCAGAGGCGG + Intronic
925218786 2:2121263-2121285 GAATTGCTTGAACCCGGACCCGG - Intronic
925365246 2:3307048-3307070 GAATCACTTGAACCCAGGAGGGG - Intronic
926544732 2:14225627-14225649 GAATCACTTGAACCCAGGATGGG + Intergenic
926571035 2:14530030-14530052 GAATCGCTTGAACCCGGAGCTGG - Intergenic
926919702 2:17928352-17928374 GAATCACTTGAACCCAGGAGGGG - Intronic
927161485 2:20267108-20267130 GAATCACTTGAACCCAGGAAGGG - Intronic
927177464 2:20420702-20420724 GAATCACTTGAACCCAGGAGGGG + Intergenic
927572487 2:24171918-24171940 GAATCGCTTGAACCCAGGACGGG + Intronic
927901039 2:26818574-26818596 CCATCACATGCACCCACACCAGG - Intergenic
928016211 2:27660309-27660331 GAATCACTTGAACCCAGGGGAGG - Intronic
928155679 2:28874216-28874238 GAATCGCTTGAACCCAGAATGGG - Intergenic
928328351 2:30337761-30337783 GAATCACTTGAACCGGGAGCCGG - Intergenic
928357653 2:30634536-30634558 GAATCACTTGAACCCAGGAGTGG + Intronic
928437486 2:31264619-31264641 GAATCGCTTGAACCCAGAGTTGG - Intronic
928548630 2:32350893-32350915 GAATCACCTGAACCCAGAAGGGG + Intergenic
928559348 2:32462866-32462888 GAATCTCTTGAACCCAGACGTGG + Intronic
928590302 2:32808018-32808040 GAATCACTTGAACCCAGGAGGGG - Intronic
928724241 2:34152377-34152399 GAATCACTTGAACCCAGAGGCGG - Intergenic
929106523 2:38370677-38370699 GAATCTCTTGAACCCAGAGGTGG + Intronic
929138340 2:38645738-38645760 GAATCACTTGAACCCGGAGGCGG + Intergenic
929145751 2:38705933-38705955 GAATAGCTTGAACCCAGAGCGGG - Intronic
929153958 2:38772997-38773019 GAATCACTTGAACCCAGGAGGGG - Intronic
929160180 2:38823922-38823944 GAATCACTTGAACCCGGAGGTGG + Intronic
929186188 2:39097649-39097671 GAATCACTTGAGCCCAAGCCTGG - Intronic
929510106 2:42559786-42559808 GAATCACTTGAACCCGGGGCGGG + Intronic
929602777 2:43214904-43214926 GAATCACTTGAACCCGGAGGCGG - Intergenic
929667175 2:43842090-43842112 GAATCACTTGAACCGGCAGGTGG - Intronic
929907854 2:46061948-46061970 GGATCTCTTGAACCCGAACCCGG - Intronic
930075062 2:47399793-47399815 GAATCACTTGAAACCAGGGCGGG + Intergenic
930188847 2:48437309-48437331 GAATCACTTGAACCCAGAGGTGG + Intergenic
930316161 2:49799296-49799318 GAATCACTTGAACCCAGAGAGGG + Intergenic
930816944 2:55608090-55608112 GAATCACTTGAACCCAGAGGTGG - Intronic
931106414 2:59061302-59061324 GAATCACTTGAACCCAGGAGGGG + Intergenic
931279140 2:60773010-60773032 GAATCGCTTGAACCCAGAGGCGG - Intronic
931314108 2:61110758-61110780 GAATCACTTGAACCCAGGAAGGG + Intronic
931340643 2:61397977-61397999 GAATCACTTGAACCCGCTTGGGG + Intronic
931452917 2:62383656-62383678 GAATCACTTGAACCCATAGGCGG - Intergenic
931502898 2:62890046-62890068 GAATCACTTGAACCCAGAGGCGG - Intronic
931793319 2:65685469-65685491 GAATCGCTTGAACCCAGAGACGG + Intergenic
932018396 2:68057237-68057259 GAATCACTTGAACCCAGTAGGGG - Intronic
932243211 2:70174218-70174240 GAATCGCTTGAACCCAGAGGCGG + Intronic
932805052 2:74776342-74776364 GAATCACTTGAACACAGAGGCGG + Intergenic
933555056 2:83821781-83821803 GAATCACTTGAACCCAGGAGTGG + Intergenic
933763728 2:85693449-85693471 GAATCACTTGAACCCGGAGGTGG + Intronic
933787881 2:85858396-85858418 GAATCACTTGAACCCAAGACAGG - Intronic
933937968 2:87221982-87222004 GAATCACTTGAACCCACGGGCGG - Intergenic
934178572 2:89599163-89599185 GAATCGCTTGAAACCAAAACCGG + Intergenic
934288864 2:91673448-91673470 GAATCGCTTGAAACCAAAACCGG + Intergenic
934319549 2:91960131-91960153 GAATCACTTGAACCCAGAGGTGG - Intergenic
934575323 2:95396944-95396966 GAATCGCTTGAACCCAGAGGCGG + Intergenic
934660352 2:96139997-96140019 GAATCACTTGAACCCAGAGGTGG + Intergenic
934699138 2:96424485-96424507 GAATCACTTGAGCCAAGATCAGG + Intergenic
934850759 2:97699515-97699537 GAATCACTTGAACCCAGTAGGGG + Intergenic
935150647 2:100431990-100432012 GAATCACTTGAACCAGCAGGTGG + Intergenic
935164303 2:100556232-100556254 GAATCACTTGAACCCAGGAGGGG + Intergenic
935164747 2:100560857-100560879 GAATCACTTGAACCCAGGAGGGG + Intergenic
935232480 2:101110884-101110906 GAATCACTTGAACTTGAACCCGG + Intronic
935474278 2:103499282-103499304 GAATCACTTGAACCTGGACTGGG - Intergenic
935694188 2:105756891-105756913 GAATCACTTGAACCCAGGAGGGG - Intronic
935955007 2:108367003-108367025 GAATCACTTGAACCCAGGAGGGG + Intergenic
936100857 2:109577823-109577845 GAATCACTTGAACCCAGGAGGGG + Intronic
936111082 2:109665427-109665449 GAATCACTTGAACCCAGAGGTGG - Intergenic
936355172 2:111743794-111743816 GAATCACTTGAACCCAGGGGCGG + Intergenic
936575319 2:113648372-113648394 GAATCGCTTGAACCCACGAGGGG + Intergenic
936803833 2:116300820-116300842 GAATCACTTGAACCAGGACCTGG + Intergenic
936933248 2:117812077-117812099 GAATCACTTGAACCCAGAGGCGG + Intergenic
937456160 2:122043608-122043630 GAATCACTTGAACCCGGAGGTGG - Intergenic
937736850 2:125301770-125301792 GAATCACTTGAACCCAGGAGTGG - Intergenic
937796447 2:126027822-126027844 GAATCACTTGAACCCAGAGGTGG + Intergenic
937943835 2:127312872-127312894 GAATCACTTGAACCCAGGGTGGG + Intronic
937959167 2:127441476-127441498 GAATCACTTGAACCCAGAGGTGG + Intronic
938016316 2:127870225-127870247 GAATCACTTGAACCCAGGGGTGG + Intronic
938172808 2:129096548-129096570 GAATCACTTGAACCCAGGAAGGG - Intergenic
938295675 2:130177607-130177629 GAATCACTTGAACCCAGGAGAGG + Intronic
938382584 2:130844909-130844931 GAATCACTTGAACCCGGAGGTGG - Intronic
938470288 2:131553591-131553613 GAATCCCTTGAGCCCACAAATGG - Intergenic
938570395 2:132557229-132557251 GAATCACTTGAACCCAGGAGGGG + Intronic
939329885 2:140743877-140743899 GAATCACTTGAACCCAGGAGGGG + Intronic
939504414 2:143028330-143028352 GAATCGCTTGAACCCAGAGGGGG - Intronic
939790015 2:146560761-146560783 GAATCGCTTGAACCCGGCCCGGG - Intergenic
940333469 2:152500758-152500780 GAATCACTTGAACCCCAGCGAGG + Intronic
940700077 2:157029589-157029611 GAATCGCTTGAACCCAGAGGCGG - Intergenic
941204246 2:162551794-162551816 GAATCAAATGGACCCACACATGG - Intronic
941371728 2:164673585-164673607 GAATCACTTGAACCCAGGAGCGG + Intronic
941386104 2:164853935-164853957 GAATCACTTGAACCCAGAAGCGG + Intergenic
942350351 2:175046197-175046219 GAATCACTTGAACCCACGAAGGG - Intergenic
942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG + Intergenic
943119696 2:183719830-183719852 GAATCACTTGAACCCCCGGGAGG - Intergenic
943331641 2:186567005-186567027 GAATCACTTGAACCCAGAGGTGG - Intergenic
943952874 2:194153111-194153133 GAATCACTTGAACCAGCAGGCGG + Intergenic
944188038 2:196971442-196971464 GAATCACTTGAACCCAGGAGGGG - Intronic
944260975 2:197676819-197676841 GAATCACATGCAACCACATCTGG + Intergenic
944511561 2:200471070-200471092 GAATCACTTGAACCTGGACCCGG + Intronic
944705130 2:202281212-202281234 GAATCGCTTGAACCCAGAGGTGG - Intronic
944742359 2:202624872-202624894 GAATCACTTGAACCCAGGATGGG - Intergenic
944742595 2:202626877-202626899 GAATCACTTGAACCCGGAAGGGG - Intergenic
944819345 2:203414187-203414209 GAATCACTTGAACCCAGGAGGGG - Intronic
944854488 2:203753438-203753460 GAATAGCTTGAACCCACAGTTGG - Intergenic
945101006 2:206262298-206262320 GAATCACTTGAACCCAGGAGCGG - Intergenic
945107173 2:206327154-206327176 GAATCACTTGAACCCAGAGGTGG - Intergenic
945226951 2:207541130-207541152 GAATAGCTTGAACCCACAGGTGG + Intronic
945434901 2:209808473-209808495 GAATCACTTGAACCCGGAAGCGG + Intronic
946834073 2:223754819-223754841 CAATCACTTGAACCCAGAGGTGG + Intronic
947220404 2:227786322-227786344 GAATCACTGGATTCCAAACCTGG - Intergenic
947477619 2:230465146-230465168 GAATCACTTGAACCCAGGAGAGG + Intronic
947660106 2:231860189-231860211 GAATCGCTTGAACCCAGAGGTGG - Intergenic
947698994 2:232216928-232216950 GAATCACTTGAACCCAGGAGGGG - Intronic
947879168 2:233490249-233490271 GAATCACTTGAACCCAGGACAGG - Intronic
948197210 2:236104803-236104825 GAATCGCTTGAACCGGGACCCGG + Intronic
948382815 2:237562733-237562755 GAATCACTTGAACCCCCTGGAGG - Intergenic
1168742271 20:201844-201866 GAATCACTTGAACCCAGAGGTGG + Intergenic
1168746198 20:243714-243736 GAATCACTTGAACCCAGAGGTGG + Intergenic
1168798977 20:632228-632250 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1169083196 20:2810174-2810196 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1169103605 20:2974512-2974534 GAATCACTTGAACCCAGGAGGGG - Intronic
1169127369 20:3139475-3139497 GAATCGCTTGAACCCACGACGGG - Intronic
1169230473 20:3885304-3885326 GAATCACTTGAAACCAGAGGCGG - Intergenic
1169258809 20:4120341-4120363 GAATCACTTGAACCCAAGAGCGG + Intergenic
1169440369 20:5628756-5628778 GAATCACTTGAACCCAGAAGGGG + Intergenic
1169857260 20:10116536-10116558 GAATCACTTGAACCCAGGAGGGG - Intergenic
1170322463 20:15115315-15115337 GAATCACTTGAACCCAAGGGAGG - Intronic
1170464489 20:16610455-16610477 GAATCACTTGAACCGAGAGGCGG + Intergenic
1170853268 20:20023197-20023219 GAATCGCTTGAACCAGGACCCGG + Intronic
1171526420 20:25815325-25815347 GAATCACTTGAACCCAGGAAAGG + Intronic
1171550407 20:26040560-26040582 GAATCACTTGAACCCAGGAAAGG - Intergenic
1172213944 20:33221240-33221262 GAATCATTTGAACCCAGGCTGGG - Intronic
1172462750 20:35132564-35132586 GAATCACTTGAACCCAAGAGGGG + Intronic
1172492705 20:35353307-35353329 GAATCACTTGAACCCGGAGGTGG + Intronic
1172561284 20:35890793-35890815 GAATCACTTGAACCCGGAGGTGG + Intronic
1172578558 20:36028761-36028783 GAATCACTTGAACCCAGTGGGGG - Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172643781 20:36457466-36457488 GAATCGCTTGAACCAGAACCAGG - Intronic
1172688516 20:36774649-36774671 GAATCGCTTGAACCCGAACCCGG - Intergenic
1173212810 20:41050102-41050124 GAATCACTTGAACCCGGAGGCGG - Intronic
1173315274 20:41937506-41937528 GAATCACTTGCCCCAACAGCAGG - Intergenic
1173518014 20:43678768-43678790 GAATCACTTGAACCCAGAGGCGG + Intronic
1173754448 20:45503248-45503270 GAGTCACTTGAACCCAGAAGCGG - Intergenic
1173954098 20:47017351-47017373 GAATCACTTGAGCCCAGTCTGGG - Intronic
1174057505 20:47808456-47808478 GAATCACTTGAACCCGGAGGCGG - Intergenic
1174307707 20:49626285-49626307 GAATCACTTGAACCCGGAGGCGG - Intergenic
1174373061 20:50106739-50106761 GAATCACTTGAACCTGAACCTGG + Intronic
1174427673 20:50444223-50444245 GAATCACTTGAACCCAGGAAGGG + Intergenic
1174432115 20:50477957-50477979 GAATCGCTTGAACCAGGACCCGG + Intergenic
1174548213 20:51342298-51342320 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1174609041 20:51783930-51783952 GAATCACTTGAACCCAGAATGGG + Intergenic
1174699982 20:52598223-52598245 GAATCGCTTGAACCCAGAAGGGG + Intergenic
1175179686 20:57136687-57136709 GATTCACTTGAACCAATACTTGG - Intergenic
1176182456 20:63757208-63757230 GAATCACTTGAACCCAGAGGCGG - Intronic
1176553982 21:8245112-8245134 GAATCACTGGCACGGACACCAGG - Intergenic
1176572904 21:8428136-8428158 GAATCACTGGCACGGACACCAGG - Intergenic
1176870898 21:14082553-14082575 GAATCACTGGCACACCCACCAGG + Intergenic
1177070730 21:16503490-16503512 GAATCACTTGAACCCAGGAGGGG + Intergenic
1177091066 21:16769236-16769258 GAATCTCTTGAACCCAGAAGTGG - Intergenic
1177146839 21:17415835-17415857 GAATCACTTGAACCCAGGAGGGG + Intergenic
1177201917 21:17966970-17966992 GAATCACTTGAACCCGGATGCGG - Intronic
1177314676 21:19442337-19442359 GAATCGCTTGAACCCAAAGGTGG + Intergenic
1177334103 21:19701241-19701263 GAATCACTTGAACTTGAACCCGG - Intergenic
1177422200 21:20874434-20874456 AAATGACTTGAAGCCACACAGGG - Intergenic
1177889604 21:26789790-26789812 GAATCGCTTGAACCCCCAGGAGG - Intergenic
1177951298 21:27541298-27541320 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1178056308 21:28802641-28802663 GAATCACTTGAACCCAGGAAGGG + Intergenic
1178130594 21:29568473-29568495 GAATCCCTTGTTCCCACAGCTGG + Intronic
1178141937 21:29694209-29694231 GAATCGCTTGAACCCAGAGGCGG - Intronic
1178317719 21:31580666-31580688 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1178642703 21:34358307-34358329 GAATCACTTGAACCCTGGACAGG + Intergenic
1178692229 21:34759685-34759707 GAATCACTTGAACCCGGGCAGGG + Intergenic
1178714432 21:34950647-34950669 GAATCACTTGAAACCAGAGGTGG + Intronic
1178843013 21:36153345-36153367 GAATCACTTGAACCCAGGAGGGG - Intergenic
1179199311 21:39200894-39200916 GAATCACTTGAACCCAGGAGGGG + Intronic
1180307754 22:11143766-11143788 GAATCACTTGAACCCAGAGGTGG - Intergenic
1180546274 22:16505989-16506011 GAATCACTTGAACCCAGAGGTGG - Intergenic
1180828967 22:18887973-18887995 GAATCACTTGAACCCAGGATGGG + Intergenic
1181641041 22:24198769-24198791 GAATCGCTTGAACCCACTGGAGG + Intergenic
1181975823 22:26728977-26728999 GAATCGCTTGAACCCAGAAGGGG - Intergenic
1182314058 22:29431776-29431798 GAATCACTTGAATCGTCTCCGGG - Intergenic
1182323817 22:29496308-29496330 GAATCACTTGAACCCGGGACAGG + Intergenic
1182812411 22:33128585-33128607 GAATCTCTTGAACCCAGAAGTGG + Intergenic
1183100580 22:35581405-35581427 GAATCACTTGAACCCAGGAAGGG - Intergenic
1183129762 22:35822909-35822931 GAATCACTTGAACCCGGAGGTGG - Intronic
1183149387 22:36026176-36026198 GAATCCCTTGAACCCAGAGGTGG + Intronic
1183234530 22:36607462-36607484 GAATCACTTGAGCCCAGCCTGGG - Intronic
1183430902 22:37765191-37765213 GAATCACTTGAACCCAGAGGTGG + Intronic
1183672124 22:39279138-39279160 GAATCGCTTGAACCCAGAGGTGG - Intergenic
1184012270 22:41758018-41758040 GAATTGCTTGAACCCAGAACGGG + Intronic
1185350794 22:50336461-50336483 GAATCACTTGAACCCGCGAGTGG - Intergenic
1185362482 22:50416866-50416888 GAATCACTTGAACCCAGGAAGGG + Intronic
1185424862 22:50762522-50762544 GAATCGCTTGAACCCACGAGGGG - Intergenic
1203258987 22_KI270733v1_random:162150-162172 GAATCACTGGCACGGACACCAGG - Intergenic
1203279058 22_KI270734v1_random:113961-113983 GAATCACTTGAACCCAGGATGGG + Intergenic
949099769 3:129927-129949 GAATCACTTGAACCCAGAGGTGG - Intergenic
949213510 3:1535966-1535988 GAGTCTCTTGCACCCACACCTGG + Intergenic
949452116 3:4197321-4197343 GGATCACTTGAGCCCATACTGGG - Intronic
949500827 3:4678650-4678672 GAGTCACATGACCCCACTCCCGG - Intronic
950009128 3:9710091-9710113 GAATCACTTGAGCCCAGTTCAGG + Intronic
950071791 3:10158534-10158556 GAATCACTTGAACCCAGAGGCGG - Intergenic
950372290 3:12541308-12541330 GAATCACTTGAACCAAGAGGCGG - Intronic
950388204 3:12676208-12676230 GAATCACTTGAACCCCGAGGCGG + Intergenic
951482633 3:23178234-23178256 GAATCACTTGAACCCAGGGGAGG - Intergenic
951552044 3:23883826-23883848 GAATCGCTTGAACCCACGAGGGG + Intronic
951712805 3:25602307-25602329 GAATCGCTTGAACCCAGGCAAGG + Intronic
951909688 3:27736822-27736844 GGATCACTTGAACCCAGAAGGGG + Intergenic
952402843 3:32978845-32978867 GAATCACCTGAACCGAGACGTGG - Intergenic
952494183 3:33901701-33901723 GAATCACTTGAACCCAGGAGGGG - Intergenic
953170432 3:40501961-40501983 GAATCACTTGATCCCAAAGGTGG + Intergenic
953299455 3:41757719-41757741 GAATCACTTGAACCCAGGAAGGG - Intronic
953516918 3:43602422-43602444 GAATCACTTGAACCCAGAGGTGG - Intronic
953618505 3:44512687-44512709 GAATCACTTGAACCCAGGAGGGG - Intergenic
953976510 3:47385588-47385610 GGATCACTTGAACCCAGAGGTGG + Intronic
954018204 3:47714274-47714296 GAATCACTTGAACCCGGAGGCGG + Intronic
954071472 3:48146100-48146122 GAATCACTTGAACCCGGAGGGGG - Intergenic
954182343 3:48891160-48891182 GAATCGCTTGAACCCAGGACGGG - Intronic
954203294 3:49038500-49038522 GAATCACTTGAACCCAGGAGAGG - Intronic
955193177 3:56781332-56781354 GAATCGCTTGAACCCAGAGGTGG - Intronic
955221820 3:57029340-57029362 GAATCACTTGAACCCAGGAGCGG + Intronic
955743852 3:62120661-62120683 GAATCGCTTGAACCCAGAGGTGG + Intronic
955759588 3:62264223-62264245 GAATCACTTGAACCCAGGAGGGG + Intronic
956535833 3:70275298-70275320 GGATCACTTGAGCCCAGCCCAGG + Intergenic
956808885 3:72845393-72845415 GAATCACTTGAACCCAGGAAGGG + Intronic
958194173 3:90221209-90221231 GAATCTCTTGAACCCATAGGTGG + Intergenic
958266529 3:91444119-91444141 GAATCGCTTGAACCCAGAGGTGG + Intergenic
958530677 3:95326620-95326642 GAATCACTTGAACCCGGAAGAGG - Intergenic
958989242 3:100822588-100822610 GAAGCACCTGAATCCAAACCAGG - Intronic
959414359 3:106065659-106065681 GAATCACTTGAACCCGGAGGTGG + Intergenic
959853898 3:111125114-111125136 GAATCACTTGAACCCAGGAAGGG - Intronic
959911756 3:111771435-111771457 GAATCACTTGAACCCAGGAAGGG - Intronic
960050117 3:113231543-113231565 GACTCACTTGACCACAAACCTGG - Intronic
960437222 3:117642518-117642540 GGATCACTTGAACCCACGAGGGG - Intergenic
961578662 3:127859684-127859706 GAATCACTTGAACCCATAGGCGG + Intergenic
961743711 3:129049896-129049918 GAATCGCTTGAACTCAGAGCAGG + Intergenic
962124635 3:132603303-132603325 GCATCACTTGAAGCTACATCAGG + Exonic
962542152 3:136393681-136393703 GAATCGCCTGAACCCACAGCAGG - Intronic
962731298 3:138286029-138286051 GAATCGCTTGAACCTACAGGTGG - Intronic
962798299 3:138867754-138867776 GAATCACTTGAACCCAGGAGGGG - Intergenic
963239284 3:142987063-142987085 GAATCACTTGAACCCAGGGCAGG + Intronic
963812269 3:149789715-149789737 GAATCACTTGAACCCAGGAGGGG - Intronic
963865713 3:150358715-150358737 GAATCACTTGAACCCAGGAGGGG - Intergenic
964060395 3:152514919-152514941 GAATCGCTTGAACCCAGAGGTGG + Intergenic
964305136 3:155331853-155331875 GAATCACTTGAACCCAGGAGGGG - Intergenic
964748148 3:160030903-160030925 GAATCACTTGAACCCCAAAGGGG - Intronic
964895211 3:161587718-161587740 GAATCGCTTGAACCCAGCCTGGG + Intergenic
964954087 3:162330670-162330692 GAATCACTTGAACCCAGGGACGG + Intergenic
965113595 3:164458630-164458652 GAATCACTTGAACCCGGGACAGG + Intergenic
965434494 3:168632213-168632235 GAATCACTTGAACCCAGGAGGGG - Intergenic
965810374 3:172585586-172585608 GAATCGCTTGAACCCCCAGAAGG - Intergenic
966176927 3:177148625-177148647 GAATCACTTGAACCCAGGAGGGG + Intronic
966525028 3:180911273-180911295 GAATCACTTGAACCAGCAGGCGG + Intronic
966711440 3:182977521-182977543 GAATCACTGGAACCCAGAGGAGG - Intronic
966871756 3:184294714-184294736 GAATTACTTGAACCGGGACCTGG + Intronic
966921669 3:184615871-184615893 GAATCACTTGAACCCAGGATGGG - Intronic
967248242 3:187510558-187510580 GAATTGCTTGAACGGACACCTGG + Intergenic
967360171 3:188621745-188621767 GAATCACTTGAACCCAGAGGCGG - Intronic
967616878 3:191580370-191580392 GAATCACTTGAACCCGGGACAGG + Intergenic
968150337 3:196332935-196332957 GGATCACTTGAGCCCAGATCAGG - Intronic
968216726 3:196898088-196898110 GAATCACTTGAACCCAGGAGGGG + Intronic
968326799 3:197824658-197824680 GAATCACTTGAACCCGGGACGGG - Intronic
968526886 4:1063611-1063633 GAATCACTTGAACCCAGAGGTGG + Intronic
969041145 4:4297156-4297178 GATTCACTTGAACCCAGGCGGGG - Intronic
970371190 4:15408183-15408205 GAATCACTTGAACCCAGGGGTGG + Intronic
970508463 4:16756364-16756386 GGATCACTTGAACCCAGAAGTGG + Intronic
970958022 4:21837445-21837467 GAATCACTTGAACCCGGAGGTGG + Intronic
971067396 4:23049317-23049339 GAATCGCTTGAACCCAGAGGCGG - Intergenic
971759903 4:30752218-30752240 GAATCGCTTGAACCCGCAGGCGG - Intronic
971990643 4:33888581-33888603 GAATCACTTGAACCCAGGAGGGG + Intergenic
972391240 4:38615754-38615776 GAATCGCTTGAACCCAAAAGTGG - Intergenic
972542046 4:40047787-40047809 GAATCACTTGAACCCAGGAGGGG + Intergenic
972679283 4:41289847-41289869 GAATCACTTGAATCCAGAGGTGG + Intergenic
972975042 4:44624150-44624172 GAATCGCTTGAACCCAGAGGCGG - Intronic
973826467 4:54711833-54711855 GAATCACTTGAACCTCAACCTGG + Intronic
973871806 4:55174212-55174234 GAATCACTTGAACCCAGGAGGGG - Intergenic
974050848 4:56940136-56940158 GAATCGCTTGAACCCAGAGGCGG + Intergenic
974160704 4:58134172-58134194 GAATCGCTTGAACCCAGAGTGGG + Intergenic
974287406 4:59886647-59886669 GAATCACTTGAACCCAGTAGGGG - Intergenic
974345043 4:60668871-60668893 GAATCACTTGAACCCAGGAGGGG - Intergenic
974347799 4:60704068-60704090 GAATCACTTGAACCCAGGATGGG + Intergenic
975045026 4:69792525-69792547 GAATCACTTGAACCCAAGAGTGG + Intergenic
976420921 4:84842692-84842714 GAATTACTTGAACCCAGAGGCGG + Intronic
976603689 4:86962695-86962717 TCATCACTTGAACCCACAGTTGG - Intronic
976702519 4:87986706-87986728 GAATCACTTGAACCCGGGGCCGG - Intergenic
977587410 4:98788911-98788933 GAATCACTTGAACCCAGGATGGG + Intergenic
977845721 4:101764297-101764319 GAATTCCTTGAACCCACTGCTGG + Intronic
978135314 4:105250777-105250799 GAATCACTTGAACCCGGAGGTGG - Intronic
978505774 4:109454449-109454471 GAATCACTTGAACCCTCAGGTGG + Intronic
978585155 4:110269173-110269195 GAATCACTTGAACCCAGGAGCGG - Intergenic
978789011 4:112641299-112641321 GAATCTCTTGAACCCAGAGGGGG + Intronic
978816702 4:112914533-112914555 GAATCACTTGAACCCAGAGGAGG + Intronic
979651724 4:123141373-123141395 GAATCGCTTGAACCCAGAGGCGG + Intronic
979710057 4:123768951-123768973 GAATCACTTGAACCCTGAGGCGG + Intergenic
979772369 4:124543596-124543618 GAATCACTTAAAACAATACCTGG - Intergenic
979870208 4:125809832-125809854 GAATTGCTTGAACCAAGACCCGG + Intergenic
980288607 4:130814202-130814224 GAATCACTTGAACCCAGAAGGGG + Intergenic
980299356 4:130967063-130967085 GAATCACTTGAACCCAGTGGAGG + Intergenic
981043061 4:140240907-140240929 GAATCGCTTGAACCTGAACCCGG - Intergenic
981072744 4:140561559-140561581 GGATCACTTGAGCCCAGACTGGG - Intronic
981310104 4:143289353-143289375 GAATCACTTGAACCCAGAAGAGG + Intergenic
981417782 4:144513108-144513130 GAATCACTTGAACTTGAACCTGG + Intergenic
981508372 4:145527966-145527988 GAATAACTTGAACCCAGGGCCGG - Intronic
981962726 4:150560896-150560918 GAATCACTTGAACCCAGAAGTGG + Intronic
981999175 4:151006237-151006259 GAATCACTTGAACCCAGAGGCGG + Intronic
982015892 4:151153332-151153354 GAATCGCTTGAACCCAGAGGTGG - Intronic
982199576 4:152947129-152947151 GAATCGCTTGAACCCAGGCAGGG + Intronic
982258857 4:153476044-153476066 GAATCACTTGAACCCAGGAGGGG - Intronic
982464029 4:155707924-155707946 GAATTACTTGAACCGGGACCTGG - Intronic
982565423 4:156979999-156980021 GAAACACTTGAACCCAGAGGCGG - Intergenic
982702701 4:158673214-158673236 GAATCACTTGAACCCGGAGGTGG + Intronic
983308622 4:166026299-166026321 GAATCACTTGAACCCGGACAGGG + Intronic
984150784 4:176127377-176127399 TAATCACTTGAACCCAGAGGTGG - Intronic
984193218 4:176629143-176629165 GAATCACTTGAACCCAGAGGTGG - Intergenic
984483900 4:180341485-180341507 GAATCACTTGAACCAAGAGGTGG + Intergenic
984519831 4:180788341-180788363 GAATCATTTGAACCCAGGACGGG - Intergenic
984557974 4:181238388-181238410 GAATCACTTGAACCCAGCGGGGG - Intergenic
984721404 4:182976537-182976559 GAATCTCTTGAACCCAAAGGCGG + Intergenic
984789640 4:183603649-183603671 GAATCACTTGAACCCAGAGGTGG + Intergenic
984842182 4:184078921-184078943 GAATCGCTTGAACCCACAGGCGG + Intergenic
985165506 4:187090323-187090345 GAATCACTTGAACCCACGAGCGG - Intergenic
985258869 4:188096442-188096464 GAATCACTTGAACCCAGGAGGGG + Intronic
985269996 4:188184767-188184789 GAATCGCTTGAACCCAGGACAGG - Intergenic
986227170 5:5826605-5826627 GAATCACTTGAACCCGGAGGCGG + Intergenic
986271308 5:6233287-6233309 GAAGCACTTGAACCCAACCCGGG - Intergenic
986321909 5:6638249-6638271 GAATCGCTTGAACCCAGAGGTGG + Intronic
987342908 5:16954166-16954188 GAATCTCTTGAACCCAGAAGCGG + Intergenic
987456472 5:18152781-18152803 GAAGCAGTTGAACACACATCCGG - Intergenic
987857674 5:23441841-23441863 GAATCACTTGAACCCAGGAGGGG + Intergenic
987938103 5:24495757-24495779 GAATCACTTGAACCGAACCCAGG + Intronic
988118843 5:26933684-26933706 GAATCGCTTGAACCCAGACCAGG + Intronic
988687152 5:33536221-33536243 GAATCACTTGAACCCAGGGAGGG - Intronic
989059296 5:37394215-37394237 GAATCACTTGAACCCAGGACGGG + Intronic
989223639 5:38998926-38998948 GAATCACTTGAACCCAGAAGAGG + Intronic
989305215 5:39947232-39947254 GAATCACTTGAACCCAGAGGCGG + Intergenic
989559283 5:42832488-42832510 GAATCACTTGAACCCAAGAGGGG + Intronic
989671543 5:43923807-43923829 GAATCACTTGAACCCAGGGTGGG - Intergenic
989682990 5:44051408-44051430 GAAGCACTTGAATCCACAGGAGG - Intergenic
990080833 5:51911617-51911639 GAATCACTTGAACCCGGAGGTGG + Intergenic
990671262 5:58132726-58132748 GAATCACTTGAACCCGGAGGCGG - Intergenic
990782614 5:59383141-59383163 GAAACACTTGAATTTACACCGGG - Intronic
990916348 5:60909864-60909886 GAATCACTTGAACTCAGGACGGG + Intronic
991061818 5:62384147-62384169 GAATCACTTGAACCCGGGGCAGG + Intronic
991278910 5:64887452-64887474 GAATCACTTGAACCCGAAGGCGG - Intronic
991327323 5:65449526-65449548 GAATCACTTGAACCTAACCTAGG + Intronic
991417316 5:66405906-66405928 GAATCACTTGAACCCAGGGCTGG - Intergenic
991434314 5:66581074-66581096 GAATCACTTGAACCCAGGAGGGG - Intergenic
991729698 5:69573270-69573292 GAATCACTTGAACCCAGAGGTGG - Intronic
991806130 5:70428410-70428432 GAATCACTTGAACCCAGAGGTGG - Intergenic
991865259 5:71054604-71054626 GAATCACTTGAACCCAGAGGTGG + Intronic
992234712 5:74697636-74697658 GAATTGCTTGAACCCTCCCCGGG + Intronic
992708325 5:79421690-79421712 GAATCACTTGAACCCGGAGATGG - Intronic
992783043 5:80145254-80145276 GAATCACTTGAACCCAGGGGCGG + Intronic
992900921 5:81294497-81294519 GAATCACTTGAACCCAGGAGGGG + Intergenic
992905665 5:81343091-81343113 GAATCGCTTGAACCCGCCACCGG + Intronic
993000225 5:82373698-82373720 GAATCACTTGAACCCAGGAGGGG - Intronic
993504747 5:88695064-88695086 GAATCGCTTGAACCGGGACCCGG + Intergenic
994522047 5:100852207-100852229 GAATCACTTGAACCCAGGGAGGG - Intronic
994742972 5:103644089-103644111 GAATCGCTTGAACCCCCAGGAGG + Intergenic
994763446 5:103885666-103885688 GAATCACTTGAACCCAGAGGTGG + Intergenic
995453131 5:112324633-112324655 GAATCACTTGAACCCAGGGGCGG + Intronic
995790825 5:115884475-115884497 GAATCACTTGAACCCCAGGCGGG + Intronic
996922789 5:128788545-128788567 GAATCACTTGAACCCGGAGGTGG - Intronic
997025717 5:130058537-130058559 GAATCACTTGAACCCTGAGGTGG + Intronic
997135495 5:131320652-131320674 GAATCACTTGAACCCGGAGGCGG + Intronic
997173453 5:131749477-131749499 GAATCACTTGAACCCGGAAGCGG - Intronic
997520208 5:134518493-134518515 GAATCACTTGAACCCAGGAGGGG + Intergenic
997561228 5:134847785-134847807 GAATCGCTTGAACCCAAAGGCGG - Intronic
997932279 5:138082489-138082511 GAATCACTTGAACACAGAGGTGG + Intergenic
998087522 5:139338628-139338650 GAATCACTTGAACTGGGACCTGG + Intergenic
998118518 5:139557658-139557680 GAATCACTTGAACCCGGAGACGG + Intronic
998418958 5:141966191-141966213 GAATCGCTTGAACCCTCTACCGG + Intronic
998440587 5:142158326-142158348 GAATCACTTGAACTCAGAGGCGG + Intergenic
998841998 5:146264017-146264039 GAATCACTTGAACCCGAAGGAGG + Intronic
999172358 5:149606337-149606359 GCATCAGCTGAACCAACACCGGG + Intronic
999260243 5:150233898-150233920 GAATCGCTTGAACCCACGAGGGG - Intronic
999942048 5:156553355-156553377 AAATCACTTGTTCCCACACTTGG + Intronic
1000057213 5:157617978-157618000 GAATTACTTGAACCCACGTGTGG + Intergenic
1000375205 5:160574344-160574366 GAATCACTTGAACCCGGAGGCGG + Intronic
1000500923 5:162048836-162048858 GAATCACTTGAACCCAGGGGTGG - Intergenic
1000557940 5:162750444-162750466 GAATTAATAGAACCCACAACTGG - Intergenic
1000575935 5:162975387-162975409 GAATCACTTGAACCCAGGAGGGG - Intergenic
1000724041 5:164746381-164746403 GAATCACTTGAACCCAAGGCGGG - Intergenic
1000892494 5:166816182-166816204 GAATCACTTGAACCCGAGACGGG + Intergenic
1000903877 5:166939096-166939118 AAATCACTTGAACCCAGAGCAGG + Intergenic
1001059685 5:168477830-168477852 GAATCACTTGAACCCAGAGGTGG - Intergenic
1001287522 5:170434865-170434887 GAATCACTTGAACCCAGGAAGGG + Intronic
1002150023 5:177220949-177220971 GAATCGCTTGAACCCAGAGGTGG - Intronic
1002354667 5:178616184-178616206 GAATCACTTGAACCCAGGAGGGG - Intronic
1002514724 5:179749212-179749234 GAATCGCTTGAACCCAGAGGCGG - Intronic
1002515306 5:179753754-179753776 GAATCACTTGAACCCGGGCCCGG - Intronic
1002528073 5:179826250-179826272 GAATCACTTGAACCCAGGAGGGG - Intronic
1002614148 5:180439965-180439987 GAATCACTTGAACCCAGGAGGGG + Intergenic
1002775155 6:322349-322371 GACTAACTAGAACCCACACAAGG - Intronic
1003018146 6:2484948-2484970 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1003358032 6:5393568-5393590 GAATCACTTGAACCCGGAGGCGG + Intronic
1003519642 6:6847392-6847414 GAATCACTTGAACCCAGGAGGGG + Intergenic
1003599903 6:7507328-7507350 CAATCACTTGAACCCAGGCATGG + Intergenic
1003733817 6:8855235-8855257 GAATCACTTGAACCCGGGACGGG - Intergenic
1003949102 6:11101825-11101847 GAATCACTTGAACCCAGGAGGGG - Intronic
1004220193 6:13740272-13740294 GAATCACTTGAACCCGGAGATGG + Intergenic
1004355484 6:14926644-14926666 GAATCACTTGAACCCGGAGGCGG + Intergenic
1004361753 6:14977464-14977486 GAATCACTTGAACCCAGAGGTGG - Intergenic
1004700824 6:18077942-18077964 GAATCGCTTGAACCCAGGCGGGG + Intergenic
1004902376 6:20206259-20206281 GAATCACTTGAACCCAGGATGGG - Intronic
1005243998 6:23861351-23861373 GAATCACTTGAACCCAGGGGAGG - Intergenic
1005293170 6:24398856-24398878 GAATCACTTGAACCCGGAGGTGG - Intergenic
1005648492 6:27864960-27864982 GAATCACTTGAACCCAGGAGCGG + Intronic
1005661983 6:28007760-28007782 GAATTACTTGAACTCACCCCAGG - Intergenic
1006112477 6:31756726-31756748 GAATCACTTGAAACCCAACCCGG - Intronic
1006309610 6:33248624-33248646 GTATCACTTGAATGCCCACCGGG + Intergenic
1006381844 6:33703249-33703271 GAATCACTTGAACCCAGGAGGGG - Intronic
1006644194 6:35505022-35505044 GAATCTCTTGAACCCAAGACGGG - Intronic
1007002898 6:38331389-38331411 GAATCACTTGAACCCAGGAGTGG + Intronic
1007147193 6:39647797-39647819 GAATCACTTGAACTGAACCCGGG - Intronic
1007426706 6:41750906-41750928 GAATCACTTGAGCCCGCAGGAGG + Intronic
1007469010 6:42076118-42076140 GAATCTCTTGAACCCAGAGGCGG + Intronic
1007488071 6:42196182-42196204 GAATCACTTGAACCCGGAGGCGG - Intergenic
1007604881 6:43110497-43110519 GAATCGCTTGAACCCAGAGGCGG - Intronic
1007677137 6:43605803-43605825 GAATCACTTGAACCCAGAGGCGG - Intronic
1007796336 6:44351034-44351056 GAATCACCTGAACCCAGAGGCGG + Intronic
1008006921 6:46420629-46420651 GAATCACTTGAACCCAGGAGGGG - Intronic
1008189310 6:48435113-48435135 GAATCTCTTGAACCGGGACCTGG - Intergenic
1008228456 6:48952930-48952952 GAAGCACCTGAACCCATACAAGG + Intergenic
1008862505 6:56166562-56166584 GAATTTCTTGAACCCAGACGCGG + Intronic
1008957863 6:57235374-57235396 GAATCACTTGAACCCAGGAGGGG + Intergenic
1008988683 6:57577514-57577536 GAATCGCTTGAACCCAGAGGTGG - Intronic
1009042337 6:58193990-58194012 GAATCACTTGAACCCAGGAGGGG - Intergenic
1009159100 6:60259505-60259527 GAATCTCTTGAACACACAGAAGG - Intergenic
1009218177 6:60948214-60948236 GAATCACTTGAACCCAGGAGGGG - Intergenic
1009351997 6:62691717-62691739 CAATCACTTGAACCCCCAGGAGG + Intergenic
1009417513 6:63431986-63432008 GAATCACTTGAACCCAGGAGGGG + Intergenic
1009812108 6:68681365-68681387 GAATCACTTGAGCCCAACCTGGG - Intronic
1010231572 6:73539804-73539826 GAATCACTTGAACCCAAAGGTGG - Intergenic
1010448540 6:75976472-75976494 GAATCATTTGAACCCAGAAGCGG + Intronic
1010469188 6:76205857-76205879 GAATCACTTGAACCCAGGAAGGG - Intergenic
1011135061 6:84091314-84091336 GAATCACTTGAACCCAGGAGGGG - Intergenic
1011225698 6:85103445-85103467 GAATCACTTGAGCCCAGAGGCGG + Intergenic
1011278676 6:85655081-85655103 GAATCACTTGAACCCGGAGGCGG - Intergenic
1011611114 6:89151315-89151337 GAATCCCTTGAACCCAGAGGCGG - Intronic
1012256305 6:97036746-97036768 GCTTCACATGAGCCCACACCTGG - Intronic
1012889578 6:104883139-104883161 GAATCACTTGAACCCAGGAGAGG - Intergenic
1012899778 6:104992146-104992168 GAATCACTTGAACCCAAAGGCGG - Intronic
1013000783 6:106020138-106020160 GAATCACTTGAACCCAGGAGGGG + Intergenic
1013019510 6:106198687-106198709 GAATCACTTGAACCCGGAGGTGG + Intronic
1013079060 6:106796518-106796540 GAATCGCTTGAACCCTCCGCCGG - Intergenic
1013121877 6:107148626-107148648 GAATCGCTTGAACCCAGAGGTGG - Intergenic
1013201371 6:107899630-107899652 GAATCACTTGAACCTAGAGTTGG + Intronic
1013324030 6:109026590-109026612 GAATCGCTTGAACCGAAACTGGG - Intronic
1013332818 6:109122712-109122734 GAATCACTTGAACCCAACCCGGG + Intronic
1014628894 6:123765314-123765336 GAATCACTTGAACCCAGGAAGGG - Intergenic
1014803737 6:125806251-125806273 GAATCACTTGAACCCAGGAGGGG + Intronic
1014939455 6:127421383-127421405 GAATTACTTGAACCAGGACCTGG - Intergenic
1015019091 6:128450018-128450040 GAATCACTTGAACCCAGGTTGGG + Intronic
1015370882 6:132451182-132451204 GAATCACTTGAACCCGTAGGCGG - Exonic
1015547607 6:134377427-134377449 GAATCACTTGAACCCAGGAGGGG - Intergenic
1015650212 6:135449134-135449156 GAATCACTTGAACCCAGAGGAGG - Intronic
1015777188 6:136825619-136825641 GAATCACTTGAACCCAGGAGGGG - Intronic
1015960824 6:138647686-138647708 GAATCACTTGAACCCTGAGGTGG - Intronic
1016051200 6:139532512-139532534 GAATCACTTGAACCCAGGAGGGG - Intergenic
1016921518 6:149299482-149299504 GAATCACTTGAACCCAGGAGGGG + Intronic
1016958796 6:149652030-149652052 GAATCACTTGAACCCAGAAGTGG + Intergenic
1016961760 6:149679462-149679484 GAATCACTTGAACCCAGGAGGGG + Intronic
1017142998 6:151208623-151208645 GAATGACTTGAACCCAGAGGCGG - Intergenic
1017811103 6:157984489-157984511 GAATCACTTGAACCCAGGTGGGG - Intronic
1017860186 6:158389966-158389988 GAATCACTTGAACCCACACCCGG - Intronic
1018192008 6:161317419-161317441 GAATCGCTTGAACCCAGAAGAGG - Intergenic
1018801674 6:167227460-167227482 GAATCACTTGATCCCAACTCAGG - Intergenic
1019377828 7:704679-704701 GAATCACTTGAACCCAGGAGGGG + Intronic
1019758861 7:2793793-2793815 GAATCACTTGAATCCAGAGGTGG + Intronic
1019804494 7:3113278-3113300 CCATGACTTGAACCCACATCTGG - Intergenic
1019924564 7:4183545-4183567 GAATCGCTTGAACCGGAACCCGG + Intronic
1019962356 7:4471593-4471615 GAATCGCTTGAACCCAGGACGGG - Intergenic
1020262373 7:6537463-6537485 GAATCACTTGAACCCAGGAGAGG - Intronic
1021489944 7:21208853-21208875 GAATCACTTGAACCCAGGGTGGG - Intergenic
1021599327 7:22349001-22349023 GAATCGCTTGAACCCAGAGGTGG + Intronic
1021687183 7:23198157-23198179 GAATCACTTGAACCCAGGAGAGG + Intronic
1021714723 7:23451328-23451350 GAATCGCTTGAACCCAGAAGCGG + Intronic
1021724178 7:23533661-23533683 GAATCACTTGAACCCGGAGGTGG - Intergenic
1022398561 7:30013948-30013970 GAATCACTTGAACCCGGAGGCGG - Exonic
1022667392 7:32424558-32424580 GGATCACTTGAGCCCAGGCCTGG + Intergenic
1023437158 7:40150582-40150604 GAATCACTTGAACCCAGGTTGGG + Intronic
1023848325 7:44135985-44136007 GAATCTCTTGAACCCAGAAGGGG - Intergenic
1024128926 7:46330270-46330292 GAATCACTTGAACCCAGGAGGGG - Intergenic
1024222221 7:47297872-47297894 GAATCGCTTGAACCCAGAAGTGG - Intronic
1024324761 7:48100992-48101014 GAATCGCTTGAACCCAGGACAGG - Intronic
1024551588 7:50566758-50566780 GATTCACTTGAATTCACTCCTGG - Intergenic
1024922842 7:54578028-54578050 GAATCACTTGAACCCAGAGGTGG + Intergenic
1025171109 7:56757537-56757559 GAATCACTTTAACCCAGAGGCGG - Intergenic
1025191739 7:56900763-56900785 GAATCACTTGAACCCGGAGGTGG + Intergenic
1025246303 7:57320182-57320204 GAATCACTTGAACCCAGGAGGGG - Intergenic
1025299242 7:57804607-57804629 GAATCACTTGAACCCAGTAGAGG - Intergenic
1025680209 7:63676171-63676193 GAATCACTTGAACCCGGAGGTGG - Intergenic
1025700764 7:63818128-63818150 GAATCACTTTAACCCAGAGGCGG + Intergenic
1025984201 7:66433523-66433545 GAATCACTTGAACCCGGAGGTGG - Intergenic
1026008321 7:66617040-66617062 GAATCACTTGAACCTGCAGGCGG - Intergenic
1026213763 7:68329900-68329922 GAATCACTTGAACCCAGGAGAGG + Intergenic
1026235876 7:68527087-68527109 GAATCACTTGAACCCGGAGGGGG - Intergenic
1026285409 7:68958342-68958364 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1026498124 7:70920845-70920867 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1026523711 7:71136993-71137015 GGATCACTTGAAACCAGCCCTGG - Intronic
1026551167 7:71369723-71369745 GAATCACTTGAACCCAGAGGCGG + Intronic
1026667347 7:72354097-72354119 GAATCACTTGAACCCAAGAGGGG + Intronic
1026697422 7:72607303-72607325 GAATCACTTGAACTCAGAGATGG + Intronic
1027174656 7:75895623-75895645 GAATCACTTGAACCCAGAGGTGG - Intergenic
1027199714 7:76055913-76055935 GAATCACTTGAACCCAAGATGGG - Intronic
1027212798 7:76164512-76164534 GAATCACTTGAACCCGGAGGGGG + Intergenic
1027251695 7:76402755-76402777 GAATCACTTGAACCCAGGAGGGG - Intronic
1027587660 7:80077824-80077846 GAATCACTTGAACCCAGGGGCGG + Intergenic
1027663462 7:81015820-81015842 GAATCACTTGAACTCCCAGGAGG + Intergenic
1028082411 7:86594768-86594790 GAATCGCTTGAACCCAGGCTAGG - Intergenic
1028145308 7:87314366-87314388 GAATCACTTGAACCCAGGAGGGG + Intergenic
1028162594 7:87502070-87502092 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1028267441 7:88743841-88743863 GAATCACTTGAACCCAGGAGAGG - Intergenic
1028398080 7:90394138-90394160 GAATCGCTTGAACCCAGAGGCGG + Intronic
1028555220 7:92116182-92116204 GAATTACTTGAACCCAGAGGTGG + Intronic
1028587573 7:92467229-92467251 GAATCACTTGAACCCGGAGGCGG + Intergenic
1029141956 7:98417610-98417632 GACTCACCTGAAGTCACACCTGG - Intergenic
1029183785 7:98724076-98724098 GAATCGCTTGAACCCAGAGGTGG - Intergenic
1029330657 7:99851076-99851098 GAATCACTGGAACCCAGAGGTGG + Intronic
1029352936 7:100028263-100028285 GAATCACTTGAACCCAGGAGGGG + Intronic
1029354574 7:100042229-100042251 GAATCACTTGAACCCAGGAGGGG + Intergenic
1029357456 7:100062785-100062807 GAATCACTTGAACCCAGGAGCGG + Intronic
1029420694 7:100470377-100470399 GAATCACTTGAACCCAGAGGTGG - Intronic
1029595616 7:101536101-101536123 GAATCACTTGAACCTGTCCCAGG - Intronic
1029606768 7:101603743-101603765 GAATCACTTGAACCCAGCGGGGG - Intergenic
1029668334 7:102010305-102010327 GAATCACTTGAACCCAGAGGTGG + Intronic
1029688018 7:102162359-102162381 GAATCACTTGAACCCAGGACGGG - Intronic
1029818152 7:103118099-103118121 GAATCACTTGAACCCAGAGACGG + Intronic
1029990014 7:104954499-104954521 GAATCACTTGAACCCAGGAGGGG + Intergenic
1030003895 7:105096165-105096187 GAACCACTTGAACCCAGAAGAGG + Intronic
1030942243 7:115667565-115667587 GAATCATTTGAACTTAAACCTGG + Intergenic
1031143651 7:117973475-117973497 GAATCACTTGAACCCAGACCCGG + Intergenic
1031312767 7:120219516-120219538 GAATCACTTGAACCCAGGAGCGG - Intergenic
1032297861 7:130658766-130658788 GAATCACTTGAACCCAGGAGGGG - Intronic
1032629546 7:133633629-133633651 GAATCACTTGAACCCGGAGGCGG + Intronic
1032844141 7:135738279-135738301 GAATCACTTGAACCCACAGTGGG - Intronic
1033153128 7:138933876-138933898 GAATCACTTGAACCCAGGAAGGG + Intronic
1033341394 7:140494867-140494889 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1033383435 7:140847065-140847087 GAATCACTTGAACCCAGGAGAGG + Intronic
1033474494 7:141678047-141678069 GAATCGCTTGAACCCAGAGGTGG - Intronic
1033783488 7:144701485-144701507 GAATCACTTGAGCCCAGAGGTGG + Intronic
1033873759 7:145789280-145789302 GAATCGCTTGAACCCAGAAGTGG - Intergenic
1033880674 7:145879739-145879761 GAATCACTTGAACCCAGGAGAGG - Intergenic
1034032764 7:147786183-147786205 GAATCACTTGAACCCAGAGGTGG + Intronic
1034099907 7:148441995-148442017 GAATCTCTTGAACCCAGAGGCGG + Intergenic
1034482941 7:151337057-151337079 GAATCACTTGAACCCGGAGGCGG - Intergenic
1034508098 7:151511732-151511754 GAATCACTTGAACCCGAAGGGGG - Intronic
1034601047 7:152256080-152256102 GAATCACTTGAACCCGCGAGGGG + Intronic
1034837846 7:154369180-154369202 GAATCACTTGAACCCAGAGTTGG - Intronic
1035040478 7:155923216-155923238 GAATCACTTGAACCCCCACTAGG - Intergenic
1035125684 7:156606982-156607004 GGACCACCTGACCCCACACCTGG + Intergenic
1035309953 7:157960917-157960939 GAATCACTTGAACACAGGACGGG + Intronic
1035862712 8:3047118-3047140 GAATCACTTGAACCCAGGAGGGG + Intronic
1036761515 8:11512749-11512771 GAATCACTTGAACCCAGGAGGGG - Intronic
1037951979 8:23024605-23024627 GAATCTCTTGAACCCAGAGGTGG - Intronic
1037982759 8:23266483-23266505 GAATCACTTGAAACCGGAGCCGG + Intergenic
1038094336 8:24291099-24291121 GAATCACTTGAACCCGGAGGAGG - Intergenic
1038437826 8:27548867-27548889 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1038841947 8:31192473-31192495 GAATCACTTGAACCCGGAGGTGG - Intergenic
1038842484 8:31198001-31198023 GAATCGCTTCAACCCACAACTGG - Intergenic
1038867840 8:31458960-31458982 GAATCACTTGAACCCGGAGGCGG - Intergenic
1039072955 8:33662791-33662813 GAATCACTTGAACCCATGAAGGG - Intergenic
1039538057 8:38337340-38337362 GGATCACTTGAAACCATACAAGG + Exonic
1039657051 8:39421523-39421545 GAATCACTTGAACCCAGGAAGGG + Intergenic
1039762811 8:40595994-40596016 GAATCACTTGAACCCAGGAGAGG + Intronic
1040107007 8:43546986-43547008 GACTCCCTGGCACCCACACCAGG - Intergenic
1040586986 8:48753128-48753150 GAATCACTTGAACCCGGAGGTGG + Intergenic
1040883255 8:52231562-52231584 GAATCACTTGAACCCGGAGGCGG - Intronic
1041251675 8:55940461-55940483 GAATCGCTTGAACCCGGCCCGGG - Intronic
1041652170 8:60312111-60312133 GAATCACTTGAACCCAGAGATGG - Intergenic
1042391506 8:68240831-68240853 GAATCACTTGAACCCAGGATGGG + Intergenic
1042449592 8:68929263-68929285 GAATCACTTGAACCCAGGAGAGG - Intergenic
1042826402 8:72984528-72984550 GAATCACTTGAACCCCCAGGAGG + Intergenic
1043369868 8:79578059-79578081 GAATCACTTGAACCCGGAGGCGG + Intergenic
1043459446 8:80444823-80444845 GAATCACTTGAACCCGGAGATGG + Intergenic
1043953861 8:86339603-86339625 GAATCACTTGAACCCAGGAGTGG + Intergenic
1043957434 8:86377171-86377193 GAATCACTTGAACCCAGGAGGGG - Intronic
1044771306 8:95637681-95637703 GAATCTCTTGAACCCAGAGGCGG + Intergenic
1045106821 8:98900747-98900769 GAATCACTTGAACCCAGTGGGGG - Intronic
1045281691 8:100754852-100754874 GAATCACTTGAACCCAGGAGGGG - Intergenic
1045288273 8:100810416-100810438 GAATCACTTGAACCCAGGAGAGG + Intergenic
1045522058 8:102912323-102912345 GAATCACTTGAACCCAGGAAGGG - Intronic
1046371636 8:113316635-113316657 GAATCACTTGAACCCAGGAGGGG - Intronic
1047267855 8:123325181-123325203 GAATCACTTGAACCCAGAGGTGG - Intronic
1047324358 8:123821880-123821902 GAATCACTGGAACCCAGAGGTGG + Intergenic
1047497155 8:125416634-125416656 GATTCACTTGAACCAGCTCCTGG - Intergenic
1047917279 8:129595624-129595646 GAATCACTTGAACCCGGAGGAGG - Intergenic
1047945638 8:129876024-129876046 GAATCACTTGAACCCAGAAGTGG + Intronic
1047964007 8:130032270-130032292 GAATCGCTTGAACCCAAAAAGGG - Intergenic
1047972252 8:130095386-130095408 GAATCACTTGAACCCAGGAGGGG - Intronic
1048299262 8:133239338-133239360 GAGTGACTTGAACCCAGATCTGG + Intronic
1048513796 8:135086621-135086643 GAATCACTTGAAACCAAAGGCGG - Intergenic
1048539036 8:135325676-135325698 GAATCAGTTGCACCCTCACACGG + Intergenic
1049546326 8:143233094-143233116 GAATCACTTGAACCAAGAAGTGG + Intergenic
1049986656 9:957920-957942 GAATCACCTGAACCCGCAGGCGG + Intronic
1050041889 9:1504358-1504380 GAATCACAGGCACCCACCCCTGG + Intergenic
1050304505 9:4294419-4294441 GAATCACTTGAACCCAGGAGGGG + Intronic
1050308647 9:4330852-4330874 GAATCAGCTTAACCCACTCCTGG - Intronic
1050488929 9:6166833-6166855 GAATCACTTTAGCTCACTCCTGG - Intergenic
1050734764 9:8750013-8750035 GAATCGCTTGAACCCAGAGGCGG + Intronic
1050758615 9:9038640-9038662 GAAGCACTTGAACCCAGAGGCGG - Intronic
1051227400 9:14915464-14915486 GAATCACTTGAACCTAGATGTGG + Intergenic
1051763945 9:20501449-20501471 GACTCAGTTAAAACCACACCCGG + Intronic
1052309263 9:27047083-27047105 GAATCCCTTGAACCCAGAGGTGG + Intronic
1052389211 9:27858482-27858504 GAATCACTTGAACCCGGAGGCGG - Intergenic
1052453672 9:28665977-28665999 GAATCGCTTGAACCCAGAGGCGG - Intronic
1052756569 9:32548434-32548456 GAATCACTTGAACCCCCGGGAGG + Intronic
1052920164 9:33959059-33959081 GAATCACTTGAACCCAGAGGCGG + Intronic
1053231942 9:36417596-36417618 GAATCTCTTGAACCCAGAAGTGG - Intronic
1053436761 9:38080706-38080728 GAATCGCTTGAACCCAGAGGTGG + Intergenic
1053794342 9:41711423-41711445 GAATCACTTGAACCCAGGAGAGG + Intergenic
1054150835 9:61603400-61603422 GAATCACTTGAACCCAGGAGAGG - Intergenic
1054182748 9:61923467-61923489 GAATCACTTGAACCCAGGAGAGG + Intergenic
1054470611 9:65534511-65534533 GAATCACTTGAACCCAGGAGAGG - Intergenic
1054655759 9:67665008-67665030 GAATCACTTGAACCCAGGAGAGG - Intergenic
1054769935 9:69074095-69074117 GAATCGCTTGAACCCAGAGGTGG + Exonic
1054900909 9:70368731-70368753 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1055027462 9:71737362-71737384 GAATCGCTTGAACCCTAGCCTGG + Intronic
1055039404 9:71852882-71852904 GAATCACTTGAACCCAAAGGCGG - Intergenic
1055293503 9:74809890-74809912 GAATCACTTGAACCAAGAGGCGG + Intronic
1055385452 9:75757115-75757137 GAATCGCTTGAACCCAGAGGCGG + Intergenic
1055396655 9:75883189-75883211 GAATCACTTGAACCCAGAGGCGG - Intergenic
1055456008 9:76472187-76472209 GAATCACTTGAACCCGAACCCGG + Intronic
1055817589 9:80225370-80225392 GAATCACTTGAACCCAGGAAGGG - Intergenic
1055858206 9:80717549-80717571 GAATCACTTGAACCCAAGACGGG - Intergenic
1056180069 9:84074159-84074181 GAATCACTTGAACCCGAACCCGG - Intergenic
1056304491 9:85275950-85275972 GAATCACTTGAACCCGGAGGCGG + Intergenic
1056525589 9:87440271-87440293 GAATTGCTTGAACCCCAACCGGG + Intergenic
1056638642 9:88351557-88351579 GAATCACTTGAACCCGGAAGGGG + Intergenic
1056803110 9:89707767-89707789 GAATTGCTTGAACCCGGACCCGG - Intergenic
1057102304 9:92374290-92374312 GAATCACTTGAACCCAGGAGGGG - Intronic
1057626936 9:96686454-96686476 GAATCACTTGAACCCGGAGGCGG - Intergenic
1059093376 9:111386049-111386071 GAATCGCTTGAACCCAGCCAGGG - Intronic
1059096798 9:111425097-111425119 GAATCACTTGAACCAGGAGCCGG + Intronic
1059107892 9:111527010-111527032 GAATCACTTGAACCCAGCCGGGG + Intronic
1059552294 9:115241355-115241377 GAATCACTTGAACCTGAAGCAGG + Intronic
1060039662 9:120288963-120288985 GAATCACTTGAACCCAGTGTGGG + Intergenic
1060471817 9:123954352-123954374 GAATCACGTGAACCCAGGCAGGG + Intergenic
1060564870 9:124581502-124581524 GAATCACTTGAACCCAGGAGGGG + Intronic
1060624562 9:125099372-125099394 GAATCACTTGAACCCAGAGGCGG - Intronic
1061121458 9:128645406-128645428 GAATCACTTGAACCAAGCCTGGG + Intronic
1061148461 9:128814867-128814889 GAATCACTTGAACCCAGAGGCGG + Intergenic
1061214325 9:129212287-129212309 GAATCACTTGAACCCAGGAGGGG - Intergenic
1061270834 9:129541074-129541096 GAATCACCTGAACCCAGAGGCGG - Intergenic
1061354460 9:130093900-130093922 GAATCGCTTGAACCCAGAGGTGG - Intronic
1061520366 9:131114122-131114144 GAATCAGTGGTTCCCACACCCGG + Intronic
1061607196 9:131719971-131719993 GAATCGCTTGAACCCAGAAGGGG - Intronic
1061662250 9:132137997-132138019 GAATCACTTGAACCCAAAGGCGG - Intergenic
1061694122 9:132358350-132358372 GAATTGCTTGAACCGAAACCTGG - Intergenic
1061776359 9:132967866-132967888 GAATCGCTTGAACCCAGAGGCGG - Intronic
1062422873 9:136492246-136492268 GAATCACTTGAACACAGAGGCGG + Intergenic
1062456037 9:136639321-136639343 GAATTGCTTGAACCCAGACATGG - Intergenic
1062470196 9:136699643-136699665 GAATCGCTTGAACCCAGAGGCGG - Intergenic
1203748160 Un_GL000218v1:55578-55600 GAATCACTTGAACCCAGGAAGGG - Intergenic
1203475178 Un_GL000220v1:144159-144181 GAATCACTGGCACGGACACCAGG - Intergenic
1185566176 X:1097157-1097179 GAATCACTTGAACCCAGGAGGGG + Intergenic
1185608790 X:1382037-1382059 GAATCGCTTGAACCTTCAACCGG - Intronic
1185718926 X:2366351-2366373 GAATTACTTGAACCCAGAGGTGG + Intronic
1185758402 X:2670658-2670680 GAATCACTTGAACCCAGAGGCGG - Intergenic
1186663963 X:11699759-11699781 GAATCGCTTGAACCCCCAGGAGG + Intergenic
1186865594 X:13717770-13717792 GAAACACTTCAACCCATAACAGG - Intronic
1187338332 X:18400057-18400079 GAATCGCTTGAACCCAGGCGAGG - Intergenic
1187516812 X:19979170-19979192 GAATCACTTGAACCCCCAGAAGG + Intergenic
1187882964 X:23863244-23863266 GAATCACTTGAACCCAGAGGTGG + Intronic
1188968204 X:36580597-36580619 GAATCACTTGAACACGAAACCGG + Intergenic
1188975280 X:36665693-36665715 GAATCACTTGAACACACAGGAGG - Intergenic
1189346977 X:40249213-40249235 GAATCACTTGAACCCAGAAGGGG - Intergenic
1189830161 X:44964359-44964381 GAATCACTTGAACCCAGAAGGGG + Intronic
1189913880 X:45837924-45837946 GAATCGCTTGAACCCAGCCCAGG + Intergenic
1190077958 X:47332651-47332673 GAATCACTTGAACCCAGGAAGGG - Intergenic
1190815896 X:53928893-53928915 GAATCACTTGAACCCAGGAGGGG - Intergenic
1190835676 X:54098709-54098731 GAATCACTTGAACCCAGGAAGGG - Intronic
1190897474 X:54634877-54634899 GAATCGCTTGAACCCCCAGGAGG - Intergenic
1190989972 X:55536700-55536722 GAATCACTTGAACCCAGGAGAGG - Intergenic
1192336723 X:70227621-70227643 GAATCACTTGAACCCGGAGGCGG - Intergenic
1193378120 X:80785940-80785962 GAATCACTTGAACCCAGAAGCGG + Intronic
1193464957 X:81837095-81837117 GAATCGCTTGAATCCAGAGCTGG - Intergenic
1194037803 X:88899917-88899939 GAATCGCTTGAACCCAGAAGGGG + Intergenic
1194728561 X:97427772-97427794 GAATCACTTGAACTTGAACCCGG - Intronic
1195442972 X:104919616-104919638 GAATCACTTGAACCCAGGAGGGG - Intronic
1195598405 X:106719306-106719328 GAATCACTTGAACCCAGGGTGGG - Intronic
1195626964 X:107013936-107013958 GAATCACTTGAACCCAGAGGCGG - Intergenic
1196653596 X:118194040-118194062 GAATCACTTGAACCCAGAGGTGG + Intergenic
1196845955 X:119896895-119896917 GAATCACTTGAAACCAGAGGCGG - Intronic
1197557191 X:127970359-127970381 GAATTGCTTGAACCCAACCCAGG - Intergenic
1197837328 X:130709549-130709571 GAATCACTTGAACCCAGGGATGG + Intronic
1198053588 X:132972581-132972603 GAATCACTTGAAGCCAACCCAGG - Intergenic
1198114169 X:133529354-133529376 GAGTCACTTGAACCCAGAAGGGG - Intergenic
1198188395 X:134278696-134278718 GAATTGCTTGAACCCCCGCCTGG - Intergenic
1198242303 X:134797905-134797927 GAATCGCTTGAACCCAGGCGGGG - Intronic
1198383120 X:136103101-136103123 GAATCACTTGAACCCAGAGTAGG - Intergenic
1198468786 X:136927144-136927166 GAATCACTTGAATCCAGAGGTGG - Intergenic
1199781136 X:151061114-151061136 GAATCACTTGAACCCAGGCGGGG - Intergenic
1200170289 X:154067989-154068011 GAATCACTTGAACCCGGAGGTGG - Intronic
1200413064 Y:2880395-2880417 GAATCACTTGAACCCAGAGGTGG + Intronic
1200825578 Y:7636404-7636426 GAATCACTTGAACCCAAAGTTGG - Intergenic
1200881385 Y:8216294-8216316 GAATCACTTGAACCTAAAGTTGG - Intergenic
1201187081 Y:11415227-11415249 GAATCACTTGAACCCAGAGGTGG - Intergenic
1201292970 Y:12439787-12439809 GAATCTCTTGAACCCAACCCAGG + Intergenic
1201497181 Y:14601187-14601209 AAAACACTTGAACCCACAAGGGG - Intronic
1201564446 Y:15351534-15351556 GAATCGCTTGAACCCAGAAGTGG + Intergenic
1201607498 Y:15803251-15803273 GAATCCCTTGAACCCAGAAGGGG + Intergenic
1201902565 Y:19058441-19058463 GAATCACTTGAACCCAGGAGGGG - Intergenic
1202105573 Y:21360752-21360774 GAATCACTTGAACCCAAAGGAGG - Intergenic
1202147499 Y:21815057-21815079 GAATCACCTGAACCCAGAGGCGG + Intergenic
1202193412 Y:22269712-22269734 GAATCACTTGAACCCAAAGTTGG - Intergenic
1202202052 Y:22363189-22363211 TAATCACTTGAACCCAAAGTTGG + Intronic
1202234479 Y:22694685-22694707 GAATCACTTGAACCCAAAGTTGG + Intergenic
1202308680 Y:23501481-23501503 GAATCACTTGAACCCAAAGTTGG - Intergenic
1202562121 Y:26169107-26169129 GAATCACTTGAACCCAAAGTTGG + Intergenic