ID: 1017860186

View in Genome Browser
Species Human (GRCh38)
Location 6:158389966-158389988
Sequence GAATCACTTGAACCCACACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 1, 1: 1, 2: 11, 3: 229, 4: 1083}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017860186_1017860189 -7 Left 1017860186 6:158389966-158389988 CCGGGTGTGGGTTCAAGTGATTC 0: 1
1: 1
2: 11
3: 229
4: 1083
Right 1017860189 6:158389982-158390004 GTGATTCTCCTGCCAGGAGGCGG 0: 1
1: 0
2: 5
3: 55
4: 410
1017860186_1017860188 -10 Left 1017860186 6:158389966-158389988 CCGGGTGTGGGTTCAAGTGATTC 0: 1
1: 1
2: 11
3: 229
4: 1083
Right 1017860188 6:158389979-158390001 CAAGTGATTCTCCTGCCAGGAGG 0: 1
1: 0
2: 6
3: 54
4: 244
1017860186_1017860190 -4 Left 1017860186 6:158389966-158389988 CCGGGTGTGGGTTCAAGTGATTC 0: 1
1: 1
2: 11
3: 229
4: 1083
Right 1017860190 6:158389985-158390007 ATTCTCCTGCCAGGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017860186 Original CRISPR GAATCACTTGAACCCACACC CGG (reversed) Intronic