ID: 1017862530

View in Genome Browser
Species Human (GRCh38)
Location 6:158412355-158412377
Sequence AGTCTGAGGGAAGCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017862530 Original CRISPR AGTCTGAGGGAAGCCTCACA GGG (reversed) Intronic
901658508 1:10784302-10784324 AGTTTGAGGGAAGCATCCCTCGG + Intronic
902112992 1:14098758-14098780 AGTCCCAGGGCAGCCACACAGGG - Intergenic
902957100 1:19933204-19933226 GGTCTGAGGGAAGCAACATAAGG - Intergenic
904552026 1:31326727-31326749 GGGCTGAGGCAAGCCTCAGAGGG + Intronic
905376287 1:37523165-37523187 AGCCTGAGAGAAGACTCACCAGG - Intergenic
906143802 1:43548493-43548515 AATCTGCGGGAAGTCCCACAGGG - Intronic
906265068 1:44422399-44422421 AGTCTGAATGAAGCCCCACCAGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
910205195 1:84742650-84742672 AGTCCAATGGAAGCCTCTCAGGG - Intergenic
911223911 1:95283213-95283235 AGTCTAAGGTAAGCCGAACAAGG - Intergenic
912059507 1:105648494-105648516 AGTCATATGAAAGCCTCACAGGG - Intergenic
915033926 1:152906764-152906786 AGACAGAGGGAGGACTCACAAGG - Intergenic
915497601 1:156292867-156292889 AGTATGAAGGAAGCCCCACCTGG + Exonic
920658040 1:207890987-207891009 TGTCTCAGGGGAGCCTTACATGG + Intronic
920735941 1:208533132-208533154 AGTCTCAGGGAAACCTTGCAGGG - Intergenic
921478450 1:215636661-215636683 TGCCCGAGGGAAGCCTCAAAAGG + Intronic
921721224 1:218473806-218473828 TGGCTGAGGTCAGCCTCACATGG - Intergenic
1067884396 10:50074548-50074570 AGCTTGAGGGGAGCCTCTCAAGG + Intronic
1071271239 10:84009556-84009578 AGTCGGAGGAAAGCCACAGAAGG + Intergenic
1075830901 10:125409881-125409903 ACCCTCAGGGAAGCCACACATGG + Intergenic
1076015700 10:127025856-127025878 AGTTTGAGGCCAGCCTAACATGG + Intronic
1076247810 10:128961362-128961384 AGTTTCAGGGAAGCCACCCAGGG - Intergenic
1084144563 11:67257495-67257517 AGTCTGAGGGCAGGCTCTCCTGG - Exonic
1084486438 11:69450923-69450945 AGGCTGATGGAGGCCTCCCAGGG - Intergenic
1084659278 11:70537592-70537614 AGTCAGACAGCAGCCTCACAGGG - Intronic
1084855376 11:71981665-71981687 AGTCTGAGGGAAGGCTCTGAAGG + Intronic
1085236170 11:75017268-75017290 AAGCTCAGGGAAGTCTCACAAGG - Intronic
1085416844 11:76324222-76324244 AGTCTGAGGAAGGCATCGCAAGG + Intergenic
1088594524 11:111430453-111430475 TGTCTCAGGCAAGCCTCAGAGGG + Intronic
1089777804 11:120850968-120850990 AATGTGAGGGAAGCCCCAGATGG - Intronic
1093009097 12:14085283-14085305 ATTCTGAGCGAAGTATCACAAGG + Intergenic
1093009451 12:14090274-14090296 ATTCTGAGTGAAGTATCACAAGG - Intergenic
1097559532 12:61185696-61185718 AGTCTGAGTGCAGCCTCAAAAGG - Intergenic
1097906873 12:64929945-64929967 AGGCTGAGGTCAGCCTCAAATGG - Intergenic
1098289277 12:68941293-68941315 AGTGTGAGTGAAGCATCAAATGG + Intronic
1100354924 12:93820080-93820102 AGACAGAGGGAAGCATCAAAGGG - Intronic
1102261380 12:111445433-111445455 AGGCAGAGTGAGGCCTCACATGG - Intronic
1104620434 12:130307913-130307935 AGTCTGAGGGATGCCATCCAAGG - Intergenic
1104646980 12:130504621-130504643 AGTCTGAGATGAGCCTCACAGGG - Intronic
1106620829 13:31368816-31368838 AGGCTCAGGGAAGCCACCCAGGG + Intergenic
1106906985 13:34419692-34419714 AGGATGAGGAAAGCCTCCCAGGG + Intergenic
1111135903 13:84043354-84043376 AGGCAGAGGGAAGCCTCATGAGG - Intergenic
1111164009 13:84433365-84433387 AGTCTGAGGGTAGACTTTCATGG + Intergenic
1112343801 13:98574461-98574483 ACTCTTAGGGAAGCCTCCCAGGG + Intronic
1112581148 13:100677256-100677278 ATTCTGAGCAAAGCATCACAAGG - Intergenic
1113816069 13:113172027-113172049 AGTAGGAGGGCAGGCTCACATGG + Exonic
1113872089 13:113565654-113565676 GGTCTGAGGGAAGGGTCTCAGGG - Intergenic
1113921879 13:113917901-113917923 AGGCTGAAGGATGCCTCTCATGG - Intergenic
1117044935 14:51803793-51803815 AGTCTGGGCTAAGCCCCACAAGG - Intergenic
1117273278 14:54166802-54166824 ACTCTGAGGGCAGCCTTGCAAGG - Intergenic
1119472825 14:74910008-74910030 GGCCTGAGGGAAGCCTCGCTGGG + Exonic
1120302125 14:82721179-82721201 AGTTTGAGGGAAGCCTAACAGGG + Intergenic
1124227661 15:27908647-27908669 AGCGAGAAGGAAGCCTCACATGG - Intronic
1127803238 15:62495425-62495447 AATCTTAGGAAAGCCTCTCATGG + Intronic
1128143491 15:65318536-65318558 TGTCTGAGGAAAGCCTTACATGG - Intergenic
1129217372 15:74107946-74107968 AGGCAGAGGGAGGCTTCACAAGG + Intronic
1129604052 15:77016208-77016230 GGAGTGAGGGAAGCCGCACAAGG + Intronic
1130158678 15:81376631-81376653 AGGCTGAGGCGGGCCTCACAAGG + Intergenic
1133922267 16:10163883-10163905 AGTCTGATTGAATCCCCACAAGG - Intronic
1137405856 16:48188725-48188747 AGGCTTGGGGAAGCCTCAGAAGG - Intronic
1138390721 16:56668288-56668310 AGGGTGAGAGAAGCCGCACACGG - Intronic
1138477814 16:57282534-57282556 ATGCTGAGGGATCCCTCACAGGG + Intronic
1141008130 16:80372371-80372393 TGCCTCAGGGAAGGCTCACAGGG + Intergenic
1141327311 16:83073540-83073562 AGTTTTAGGGAGGGCTCACAGGG - Intronic
1141665523 16:85463393-85463415 GGTCTGAGGGCAGCCTCCCCCGG - Intergenic
1141937489 16:87251137-87251159 ACCCTGAGGGAAGCCCCTCAAGG + Intronic
1141955060 16:87365221-87365243 AGGCAGAGGGGAGCCTCAAAAGG + Intronic
1144772375 17:17766954-17766976 AGTCTGAGGGAGGTCTCAGATGG + Intronic
1145223159 17:21105737-21105759 TGTCTCAGGGGAGCCTCAGAGGG + Intergenic
1145366293 17:22269207-22269229 ATTCTGAAGGAAGCCCCACCTGG - Intergenic
1147195403 17:38763150-38763172 AGTCTGAGACCAGCCTAACATGG + Intronic
1147271736 17:39277550-39277572 AGTCTGAGACCAGCCTAACATGG + Intronic
1150493099 17:65587781-65587803 AGTCCCTGGGCAGCCTCACATGG - Intronic
1152566377 17:81102185-81102207 GGTGTGAGGGCAGCCTCCCAGGG + Intronic
1158060140 18:53330611-53330633 AGGCTGAGGGAAGGACCACATGG - Intronic
1158338326 18:56437339-56437361 AGTATGAGACAAGCCTAACATGG + Intergenic
1158745453 18:60195218-60195240 AGTTTCAGGGAAGCATCTCAGGG + Intergenic
1159955113 18:74513539-74513561 AGCCTGAGGGAAGCCGGAGAGGG - Exonic
1160016174 18:75142239-75142261 AGTCTGCGGGAAGAGTCACCCGG - Intergenic
1160187741 18:76688558-76688580 TTTCTCAGGGAAGACTCACATGG + Intergenic
1160398346 18:78588665-78588687 AGAATGAGGGACGCCTCACAAGG + Intergenic
1163410492 19:17150876-17150898 AGTCTGAGGGTACCAGCACAGGG - Intronic
1165173800 19:33912594-33912616 AGTCTGGAAGAAACCTCACATGG - Intergenic
927125133 2:20006767-20006789 AGTCTGAGGCAAGGCACTCAGGG + Intronic
927493356 2:23535347-23535369 AATCAGAGCCAAGCCTCACACGG + Intronic
929254747 2:39797846-39797868 ATTCTGAGCAAAGCATCACAAGG - Intergenic
932494219 2:72138531-72138553 ATTCCGAGGGAAGCCCCAGAAGG - Intronic
933178391 2:79202156-79202178 TGTCTCAGGTAAGCCTCAGAGGG + Intronic
936434070 2:112488044-112488066 AGGCTCTGGGAAGCCTCCCAAGG - Intronic
937218544 2:120328010-120328032 GGCCTGAGGGAAGGCACACAGGG + Intergenic
937397362 2:121548689-121548711 AGTCTGTTGTAAGCCTGACAGGG - Intronic
938789581 2:134664802-134664824 AGTCTGAGCCGAGTCTCACAGGG - Intronic
939231905 2:139438240-139438262 AGTCTGAGAGAATACTCACCTGG + Intergenic
940290008 2:152069060-152069082 TGACTGAGAGTAGCCTCACAGGG - Intronic
941099836 2:161283443-161283465 AATCTTAGGGAAGACACACATGG + Intergenic
941895292 2:170622836-170622858 ATTCTGAGCAAACCCTCACAAGG - Intronic
946223992 2:218252613-218252635 AGTGAGAGGGAAGCCTGACCTGG + Intronic
947229045 2:227866933-227866955 AGGCTGAGGGAAGAATCAGAAGG - Intergenic
948587805 2:239030365-239030387 AGTCTGAGTGAAAACTCAAATGG - Intergenic
948834124 2:240616396-240616418 AGTCTGCAGGAAGCTGCACAGGG - Intronic
948885843 2:240884157-240884179 AGTCCCAGGGAACCCTCTCAAGG + Intergenic
949078543 2:242077734-242077756 AGACTCAGGGACCCCTCACATGG - Intergenic
1169572802 20:6924882-6924904 ACTCCCAGGGGAGCCTCACAAGG - Intergenic
1169596460 20:7205218-7205240 AGTCTGAGGGAACCCTAAATAGG + Intergenic
1170932544 20:20781896-20781918 GTGCTGAGGGAGGCCTCACAGGG - Intergenic
1171437163 20:25132814-25132836 TTTCTTAGGGAAGCCTCTCATGG - Intergenic
1172064030 20:32207140-32207162 TATTTGAGGGAAGCCTCAAAGGG + Intronic
1172120061 20:32593164-32593186 AGCCTTAAGGAAGCCTCCCATGG - Intronic
1172933374 20:38601504-38601526 AGGCTCAGAGAAGCCTCAGAGGG + Intergenic
1173118362 20:40268008-40268030 TGTGTGAGGGAAGCCTTATAGGG + Intergenic
1174215369 20:48912209-48912231 AGCCTGGGGAAAGCCCCACAGGG - Intergenic
1175799878 20:61795539-61795561 AGACTGAGGCAGGCTTCACAGGG + Intronic
1176165079 20:63668554-63668576 GGTCTGAGGGGAGCCTCAGCAGG + Intronic
1176408530 21:6435022-6435044 GGTCTGGCCGAAGCCTCACAGGG + Intergenic
1179147793 21:38783759-38783781 AGCCAGAGGGAGGCCTCGCAAGG + Intergenic
1179668370 21:42928023-42928045 TGTCTCAGGGGAGCCTCAGAGGG + Intergenic
1179684023 21:43043348-43043370 GGTCTGGCCGAAGCCTCACAGGG + Intergenic
1179986380 21:44923201-44923223 AGGCTGAAGAAACCCTCACAAGG + Intronic
1181495009 22:23282815-23282837 GGTCTCAGGGAAGGCTCACAGGG - Intronic
1182141281 22:27960822-27960844 ACTCAGAGGGAAGACACACAGGG - Intergenic
1183792601 22:40085098-40085120 AGCCTGTGGAAAGGCTCACATGG + Intronic
1184269638 22:43371850-43371872 AGTCTGGGGTATGCCTTACAGGG - Intergenic
1184279012 22:43426637-43426659 GGCCTGAGGGAGGCCACACAGGG - Intronic
1184372027 22:44088760-44088782 AGTCTGAGGGAGGCCGGGCACGG - Intronic
1184486873 22:44785077-44785099 GGCCTGAGGGCTGCCTCACATGG - Intronic
1184847577 22:47098646-47098668 AGTCGGGGGGATGCCTCACCTGG - Intronic
949346898 3:3085034-3085056 AGCCTGAAGGAGGCCTAACAGGG - Intronic
949630756 3:5923773-5923795 AGTCTAAGGAAATCCCCACAAGG + Intergenic
951145831 3:19226055-19226077 AGACTGGGGGAAGCCCCATATGG - Intronic
952960479 3:38586215-38586237 AGCCTGAGGGCAGCTTCACTGGG + Intronic
954290363 3:49646751-49646773 GGTATGAGGGATGCCCCACAGGG + Intronic
954600645 3:51864971-51864993 AGCCTGAGAGAAGACTCACCAGG - Intergenic
955811792 3:62798681-62798703 ATATTGAGGGAAGCTTCACAGGG - Intronic
956454827 3:69410108-69410130 AGTCTGAGGGAAGCAAGCCAGGG - Intronic
961491236 3:127257989-127258011 GGTCGGAGGGACGCCGCACATGG - Intergenic
962723319 3:138196662-138196684 AGTCTGAGACCAGCCTAACATGG + Intronic
963222535 3:142827409-142827431 AGCCAGAGGGCAGCTTCACACGG + Intronic
964097304 3:152947083-152947105 TAGCAGAGGGAAGCCTCACATGG - Intergenic
971437030 4:26638429-26638451 AGTCTCAGAAAAGCATCACAAGG - Intronic
974136507 4:57825197-57825219 TGTCTGAGGGAACCCTCTCTTGG - Intergenic
974183592 4:58415944-58415966 AGACTGAGGGAATATTCACAAGG - Intergenic
976695911 4:87919480-87919502 TGTCTCAGGTGAGCCTCACAGGG - Intergenic
976802859 4:89012338-89012360 AGTCAGAGAGAAGCCTAACATGG + Intronic
982967388 4:161929816-161929838 AGACTGAGGGAAGCCATACCTGG - Intronic
984855425 4:184190996-184191018 AGTCTGAAGGAAGCCTGGAAAGG + Intronic
987062888 5:14259080-14259102 CGGCAGAGGGAAGCCTCAGAAGG - Intronic
987997652 5:25307042-25307064 ATTCTGAGCAAAGCATCACAAGG - Intergenic
990728787 5:58786048-58786070 AGTCTGACAGAAGCTTCACTGGG - Intronic
992702898 5:79358756-79358778 AGCCTGAGAGAAGACTCACCAGG + Intergenic
995314379 5:110751460-110751482 TAACTGAGAGAAGCCTCACATGG + Intronic
995853667 5:116572800-116572822 AGTCTGAGGGAAGCCGGACCTGG - Intronic
995906561 5:117131179-117131201 AGTCAGACGGGAACCTCACAAGG - Intergenic
996848441 5:127926872-127926894 ACTCTGAGGAAAAGCTCACAGGG + Intergenic
1005684938 6:28245260-28245282 AGTGTGAGAGAAGTTTCACACGG - Exonic
1011134517 6:84085930-84085952 AGCCTGAGTGAAGACTCACCAGG + Intronic
1016275686 6:142349530-142349552 AGTCTGAGGGAAACTCAACAGGG + Intronic
1016720342 6:147288984-147289006 AAACAGAGGGAAGCCTCAGATGG - Intronic
1017862530 6:158412355-158412377 AGTCTGAGGGAAGCCTCACAGGG - Intronic
1018057576 6:160065686-160065708 AAACTGAAGGCAGCCTCACATGG - Intronic
1023967435 7:44970271-44970293 AGCCACAGGGAAGCCACACAGGG - Intronic
1033627104 7:143121179-143121201 TGTCTCAGGCAAGCCTCAGAGGG + Intergenic
1034068205 7:148156891-148156913 AGTCTGGAGGTAGACTCACAGGG - Intronic
1035380725 7:158438940-158438962 TGTCTCAGGGCAGCCTCAGAGGG - Intronic
1035926916 8:3737879-3737901 AGTTTGAGGGAATTCTCACTGGG - Intronic
1037808254 8:22070185-22070207 GGTCTGAGGGCTGCCTCCCACGG - Exonic
1040309272 8:46228305-46228327 AGAATGCTGGAAGCCTCACAAGG + Intergenic
1040747823 8:50667483-50667505 ACACAGAGGGAAGCATCACAAGG + Intronic
1040897690 8:52385839-52385861 AGTCTGAGGGACCCCTGTCAGGG + Intronic
1041295968 8:56357837-56357859 AAGCTGAGGGAAGGCTCTCAGGG - Intergenic
1044910750 8:97055760-97055782 AGTCTGAAATAAGCCTTACAGGG - Intronic
1048543411 8:135363792-135363814 AGTCTGACGTAAGCCTAACTGGG + Intergenic
1049843999 8:144791316-144791338 AGCCGGAGGGCAGCTTCACACGG + Exonic
1051057386 9:13004008-13004030 AGACTGAGGGAAGGGTTACAGGG - Intergenic
1051089966 9:13394924-13394946 AGTCTGAAGGAAGCCGGGCATGG - Intergenic
1052580128 9:30344531-30344553 AGCCTGAGAGAAGACTCACCAGG - Intergenic
1059342340 9:113604710-113604732 AGTTTGAGGCCAGCCTCACTAGG + Intergenic
1059476175 9:114549749-114549771 AGTCTGAGGGTGGACTCTCAGGG - Intergenic
1185993510 X:4917759-4917781 AGCCTGAGGTAAACCTGACATGG - Intergenic
1190199313 X:48346507-48346529 AGAGTGAGGGAAGCCTGACCAGG + Exonic
1194762533 X:97811480-97811502 TGTCTTGGGGAAGCCACACAAGG - Intergenic
1197650221 X:129056145-129056167 AGTACCAGGGAAGCCTCAGAGGG + Intergenic
1200911177 Y:8532641-8532663 ATTCTGCAGGAAGCCCCACATGG - Intergenic