ID: 1017869443

View in Genome Browser
Species Human (GRCh38)
Location 6:158474356-158474378
Sequence AACCCTGTGCTGGCACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017869436_1017869443 3 Left 1017869436 6:158474330-158474352 CCCAAGGCCTCCCTCAGTCATCC 0: 1
1: 0
2: 2
3: 17
4: 290
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869437_1017869443 2 Left 1017869437 6:158474331-158474353 CCAAGGCCTCCCTCAGTCATCCA 0: 1
1: 0
2: 2
3: 36
4: 367
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869432_1017869443 22 Left 1017869432 6:158474311-158474333 CCGGGTAGCCAGTCCTCAGCCCA 0: 1
1: 0
2: 4
3: 24
4: 236
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869434_1017869443 14 Left 1017869434 6:158474319-158474341 CCAGTCCTCAGCCCAAGGCCTCC 0: 1
1: 1
2: 4
3: 64
4: 481
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869438_1017869443 -4 Left 1017869438 6:158474337-158474359 CCTCCCTCAGTCATCCAGAAACC 0: 1
1: 0
2: 0
3: 18
4: 238
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869435_1017869443 9 Left 1017869435 6:158474324-158474346 CCTCAGCCCAAGGCCTCCCTCAG 0: 1
1: 0
2: 5
3: 75
4: 597
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869440_1017869443 -8 Left 1017869440 6:158474341-158474363 CCTCAGTCATCCAGAAACCCTGT 0: 1
1: 0
2: 3
3: 21
4: 203
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data
1017869439_1017869443 -7 Left 1017869439 6:158474340-158474362 CCCTCAGTCATCCAGAAACCCTG 0: 1
1: 0
2: 0
3: 15
4: 194
Right 1017869443 6:158474356-158474378 AACCCTGTGCTGGCACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017869443 Original CRISPR AACCCTGTGCTGGCACTGCC TGG Intronic
No off target data available for this crispr