ID: 1017869468

View in Genome Browser
Species Human (GRCh38)
Location 6:158474555-158474577
Sequence CTTTTTGAAGAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017869468_1017869477 29 Left 1017869468 6:158474555-158474577 CCCTGCTCCCTCTCTTCAAAAAG 0: 1
1: 0
2: 1
3: 29
4: 346
Right 1017869477 6:158474607-158474629 CAACACTGTTTTTTACTTCACGG 0: 1
1: 0
2: 5
3: 20
4: 328
1017869468_1017869472 -2 Left 1017869468 6:158474555-158474577 CCCTGCTCCCTCTCTTCAAAAAG 0: 1
1: 0
2: 1
3: 29
4: 346
Right 1017869472 6:158474576-158474598 AGACCCCCTTGCTGTTGCTCTGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017869468 Original CRISPR CTTTTTGAAGAGAGGGAGCA GGG (reversed) Intronic
900331967 1:2139731-2139753 TCTTTTGAAGAGAGGCAGGATGG - Intronic
900780292 1:4613587-4613609 CATTCTGCAGACAGGGAGCATGG - Intergenic
902360468 1:15939697-15939719 CTTTTTGGAGAAAAGGAACAGGG + Exonic
903337260 1:22633452-22633474 CTTTCTGAATCCAGGGAGCATGG + Intergenic
903427698 1:23266651-23266673 ATTTTGGAAAAGAGTGAGCATGG + Intergenic
903500660 1:23798615-23798637 CTTTTTGAAGAGACGCTGTAGGG + Exonic
904512500 1:31024061-31024083 CTTTTTAAAGAGAGAAAGAAGGG + Intronic
905434017 1:37944757-37944779 TTTTTTGTAGAGATGGAGCCGGG + Intronic
905517835 1:38575161-38575183 CATTTCCAAAAGAGGGAGCAGGG - Intergenic
905882026 1:41470215-41470237 TGTTTTGAAGGCAGGGAGCATGG - Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906610933 1:47202003-47202025 CATTGTGGGGAGAGGGAGCATGG + Intergenic
907425080 1:54374441-54374463 CTTTTAGATGGGAAGGAGCAGGG - Intronic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
910889299 1:92000383-92000405 CTTGTTGAAGTGAGGAAACATGG + Intronic
912896296 1:113594081-113594103 CTTTTTGAAGGGAAGAAGAAAGG + Intronic
914941953 1:152030912-152030934 TTTTTTTAAGAGAGAGAGAATGG - Intergenic
915586831 1:156848502-156848524 CCTTAGGAAGGGAGGGAGCAGGG - Intronic
916199947 1:162261442-162261464 CTTATAGAAGAGAGGCAGCGGGG + Intronic
916390734 1:164328223-164328245 CTATTTGAAGGGTGGGAGGAGGG + Intergenic
917370516 1:174289042-174289064 TTTTTTGTAAAGAGGGTGCAGGG + Intronic
919855594 1:201704110-201704132 GTTCTTGGGGAGAGGGAGCAGGG - Intronic
919969906 1:202568788-202568810 CTTTTTGATAATAGAGAGCAAGG + Intronic
920553368 1:206884614-206884636 TTTCTTGGAGGGAGGGAGCAGGG - Intergenic
921744064 1:218717725-218717747 CATTTTGAAAAGAATGAGCATGG + Intergenic
922238213 1:223737183-223737205 CTTTTTCTGGAGAGGAAGCAAGG + Intronic
922795455 1:228337431-228337453 CTTCCTGAAGAGAAGGTGCAGGG + Intronic
923001058 1:230006741-230006763 GTTTTTGAAGAGAGAGAGAGAGG - Intergenic
1063636190 10:7785469-7785491 CTTGTTGAAGAGAGGAGGCCAGG - Intronic
1063640984 10:7830323-7830345 ATTTTTGGAGGGAGGGAGGAAGG - Intronic
1063959755 10:11297440-11297462 CTTGTGGAACAGAGGGACCAGGG + Intronic
1066402012 10:35085851-35085873 CTTTTTACAGCGAGGGAGGAAGG + Intronic
1068299384 10:55118993-55119015 CCCATTGAACAGAGGGAGCATGG - Intronic
1068598818 10:58934280-58934302 CTCTTTGAAGAGATGGCCCATGG - Intergenic
1069689907 10:70343584-70343606 CTTTCAGAAGAGAGAAAGCAAGG + Intronic
1069923765 10:71833958-71833980 CTTTTTGGAGTGAGTGACCAAGG + Intronic
1070545105 10:77446090-77446112 CTCTTTGAAGAGAGGTTTCAGGG - Intronic
1071083696 10:81842794-81842816 CTTTTTGCAGTGAGAGAGGAAGG - Intergenic
1071721368 10:88149813-88149835 CCTTTGGAAGAGAGGGAGCGTGG + Intergenic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1075813573 10:125246862-125246884 CTTTTTGCAGTGAGTGAGCTGGG + Intergenic
1077722069 11:4639275-4639297 CTAATTTAAGATAGGGAGCAGGG - Intergenic
1079288036 11:19157673-19157695 CCTTTTTCAGAGAGGAAGCAAGG + Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1082791929 11:57351506-57351528 CATTTTGAAGAAAGGGAGAGAGG + Intronic
1084479976 11:69414449-69414471 CTTATTGAAGAGGATGAGCAAGG + Intergenic
1084893508 11:72249371-72249393 ATTTTTAAAAAGAGGGAGAAGGG - Intergenic
1085652635 11:78282195-78282217 CTTGTTGAAGAGATGGAATATGG - Intronic
1085748503 11:79136837-79136859 CTTTAGGATGATAGGGAGCATGG - Intronic
1086223174 11:84474788-84474810 CTTCTTGAAGAGTGGGGCCATGG + Intronic
1086439744 11:86816192-86816214 CTAATTGAAGAGATGGAGGAAGG - Intronic
1086736410 11:90311348-90311370 CATTTTTAGGAGAGGAAGCAAGG + Intergenic
1089347380 11:117799179-117799201 CCTTTAGAAGGGAGGGGGCATGG - Intronic
1091143268 11:133254286-133254308 CTATGTGATGAGAGAGAGCAGGG + Intronic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091618826 12:2070180-2070202 ATTTTTGAAGTCATGGAGCAAGG - Intronic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1094115426 12:26906800-26906822 CTCATTGGAGAGAGTGAGCATGG - Intronic
1094147600 12:27246344-27246366 CTTTTTGTTAAGAGGGAGAAAGG + Intronic
1094627303 12:32136227-32136249 TTTTTTGAAGGTAGGGACCATGG + Intronic
1095882073 12:47148433-47148455 CTGTTAGAAGAGAGTGAGTAGGG + Intronic
1096448263 12:51714915-51714937 GATTTTGAAAAGAGGGAGTAAGG + Intronic
1097397883 12:59098200-59098222 CTTTTTGAAGAGAAGCAGAATGG + Intergenic
1098065520 12:66611918-66611940 CTTTTTGTAGAGAGAGAACATGG + Intronic
1098253866 12:68596419-68596441 CTTGTTTGAGAGAAGGAGCATGG + Intergenic
1098921296 12:76304563-76304585 CTTCTGGAAGAAAGGGAGAATGG - Intergenic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1100369035 12:93948523-93948545 CTATTTGAAAAGTGGGAGCATGG - Intergenic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1103180802 12:118909517-118909539 ATTTGTAAAGAGAGGCAGCATGG - Intergenic
1105781999 13:23714055-23714077 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1105803994 13:23938991-23939013 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1106711426 13:32338988-32339010 CTTTTTGATGAAAAAGAGCAAGG + Exonic
1106998932 13:35521823-35521845 CTTTTTTGAGAAAGGGGGCATGG + Intronic
1107385727 13:39906842-39906864 CATTTTGAAGAGGGGGAGACTGG + Intergenic
1107433902 13:40365016-40365038 CTTTTTGACAAGAGAGAGGAAGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1110622457 13:77612509-77612531 GTTTTGGAAGAAGGGGAGCAAGG + Intronic
1111770815 13:92593304-92593326 CATTTTGAAGGCAGGGAGTAAGG + Intronic
1111823520 13:93242401-93242423 TTTTGTGTAGAGAGGGAGCAGGG + Intronic
1111867751 13:93791002-93791024 GTTTTTGAAAAGAGGAACCATGG + Intronic
1111884100 13:93997114-93997136 CTTTTTAAAAAGAGGAAACACGG - Intronic
1113065286 13:106367740-106367762 CTTCTTGAAGAATGGGAGAAGGG - Intergenic
1113285502 13:108843087-108843109 GTTATTGGAGAGTGGGAGCAAGG + Intronic
1113968223 13:114166837-114166859 CGTGGTGAGGAGAGGGAGCAGGG - Intergenic
1114628899 14:24147054-24147076 CTCTTAGAAGAGAGCGGGCAGGG + Exonic
1115791171 14:36880185-36880207 TTTTTTAAAGAGAAGGAGCCTGG + Intronic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1117599725 14:57362829-57362851 CTTATTGTTGAGATGGAGCAGGG - Intergenic
1118062600 14:62156750-62156772 AATTGTGAAGAGAGAGAGCAAGG + Intergenic
1118930135 14:70234070-70234092 CTTTAAGAAGATAGGGATCAGGG + Intergenic
1120341848 14:83230695-83230717 CCTCTTGAAGAGAAGGAACATGG + Intergenic
1120387494 14:83864587-83864609 CCATTTGAAGAGAGGAAGCTAGG - Intergenic
1122021976 14:98845570-98845592 ATGTTTGAAGAGAGGGAGACAGG + Intergenic
1122578341 14:102755787-102755809 CTTCTCCAAAAGAGGGAGCAGGG + Intergenic
1122715501 14:103694475-103694497 CTTTATGGAATGAGGGAGCACGG + Intergenic
1125528819 15:40397393-40397415 TTTTTTTAAGAGACGGACCAAGG + Intergenic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127109225 15:55649872-55649894 CTTGTACATGAGAGGGAGCAGGG - Intronic
1127545551 15:59991769-59991791 CTTTTTAAAGAGGGGAAGGAAGG + Intergenic
1127690557 15:61391917-61391939 ATTTTTGATGAGATGGAGAAGGG - Intergenic
1127960535 15:63887187-63887209 CCTGTTAAAAAGAGGGAGCAGGG - Intergenic
1128002904 15:64210628-64210650 TTTGTTGAAGGCAGGGAGCAAGG + Intronic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1129114285 15:73356633-73356655 CTTTTTGATGGGATGGAGCTTGG + Intronic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129641275 15:77381052-77381074 CTCTGTGAAGAGGGAGAGCAGGG - Intronic
1129675184 15:77629475-77629497 CTTTAGGAAGAGAGGGAGACTGG - Intronic
1129966013 15:79736293-79736315 CTTCTTGAAGACAGGGTGCCTGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1131151998 15:90053194-90053216 CTGTTTGGAGTGAGGGAGCTGGG + Intronic
1131247877 15:90811423-90811445 CTTTTTCAATATAGGGAACAAGG + Intronic
1133151984 16:3840554-3840576 ATTTTTGAAGACTGGGACCAGGG - Intronic
1133218703 16:4308740-4308762 TTTTTTGTAGAGATGGGGCAGGG + Intergenic
1133761520 16:8802469-8802491 GTTTTTGAAGAGCAGGAGTATGG + Intronic
1133986698 16:10674296-10674318 ATTTTTATAGGGAGGGAGCAAGG - Intronic
1135189714 16:20344920-20344942 AGTTTTCAAGAGAGGAAGCACGG - Intronic
1135954999 16:26949083-26949105 CATATGGAATAGAGGGAGCAAGG - Intergenic
1136359652 16:29770585-29770607 CTATTTGAAGAGGAGGAGCTGGG + Intergenic
1138708139 16:58938873-58938895 CTTTTTAAACAGAGCGAACATGG + Intergenic
1140400599 16:74667770-74667792 CTTTTGAAACTGAGGGAGCAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140748970 16:78006149-78006171 CACTTTGAAAGGAGGGAGCAGGG - Intergenic
1140774190 16:78235195-78235217 CTGTTTGAAGAAAGGAAGCATGG - Intronic
1140863204 16:79037339-79037361 CTTTTTGTAGAGAGGAAGAATGG + Intronic
1141543854 16:84749424-84749446 CTTTTGGGAAAGAGGGAGTAGGG + Intronic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1144607301 17:16678250-16678272 CTTGTTGGAGAGTGGGAGGAAGG - Intergenic
1145275901 17:21430220-21430242 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145313748 17:21716133-21716155 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1145712188 17:26988106-26988128 CTTTTGGAAGGCAGGGAACAAGG - Intergenic
1146511538 17:33453441-33453463 CTTTTTGAAAAGAGGCAGGGAGG + Intronic
1146511675 17:33454856-33454878 CTTTTAGAAAAGAGGTTGCAGGG - Intronic
1146562838 17:33886307-33886329 CTTTTTGATGTCAGGGGGCAGGG + Intronic
1146829791 17:36058585-36058607 CTTTTTGAAGAGAATGGCCAGGG + Intergenic
1147864291 17:43542802-43542824 CAATTTGAAGAGAAGCAGCAGGG - Intronic
1147915201 17:43881656-43881678 CTCTGTGAAAAGAGGGGGCATGG - Intronic
1149914206 17:60593599-60593621 CTATTTAAAGAGAGGAAGCTTGG - Intergenic
1150178354 17:63087187-63087209 CTGTTGGAAGAGACAGAGCAAGG - Intronic
1152499232 17:80697151-80697173 CTTTCTGCAGAGAGGGGACATGG + Intronic
1152593247 17:81223718-81223740 CTTTTTAAAAAGCGGGGGCAGGG - Intergenic
1152929873 17:83104035-83104057 ATTCTTGATGAGAGGGAGCTGGG + Intergenic
1153765835 18:8374301-8374323 GTTTTTGGGGAGTGGGAGCATGG - Intronic
1156219886 18:35040911-35040933 CTATTTGGAGAAAGGGAGAAAGG + Intronic
1156563528 18:38157124-38157146 CTTTCTGAAGAAAGGAGGCAGGG - Intergenic
1157613053 18:48970611-48970633 CTTGTTTTAGACAGGGAGCAAGG + Intergenic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1159624740 18:70679305-70679327 ATTTTTGAAGAGTGAGAGAAAGG + Intergenic
1161203853 19:3029972-3029994 TTTTTTGCAGAGATGGAGTAGGG + Intronic
1161885127 19:6988689-6988711 CTTTTTCAAGAGACAGAGCATGG - Intergenic
1163051310 19:14686200-14686222 CTCTTGGGAGAGAGGGAGTAAGG - Intronic
1163386688 19:17004387-17004409 CTGTGTGAAGAGAGAGGGCAAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164157027 19:22603198-22603220 ATCTTTGGAGAGAGGGAGGAGGG - Intergenic
1164508739 19:28880574-28880596 TTTCTTCAAGGGAGGGAGCAAGG + Intergenic
1164926827 19:32137300-32137322 CGTTTTGAGGGGAGGGAGCCAGG + Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165401167 19:35601260-35601282 GTTTTAGGAGAGAGGGAACAGGG - Intergenic
1166917375 19:46204554-46204576 CTGTTTGAGGACAGGGAGCAGGG - Intergenic
1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG + Intergenic
926916643 2:17898711-17898733 TTATTTTCAGAGAGGGAGCAAGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927689217 2:25195827-25195849 CTTAATGAGGCGAGGGAGCAAGG - Intergenic
928192058 2:29180157-29180179 CTTTTGGAGGAGAGGTGGCATGG + Intronic
928394886 2:30935934-30935956 ATTTCTGAAGTGAGGGAGGAGGG + Intronic
929844687 2:45511061-45511083 CCTTGTCAAAAGAGGGAGCAAGG - Intronic
930865723 2:56120430-56120452 CTTTTGGAAGGGAAGGAGGAGGG - Intergenic
931988399 2:67764029-67764051 CTGTTGGAAGAGAAGTAGCAAGG - Intergenic
932426274 2:71637423-71637445 CTTTTAGGAGAAAGGAAGCAGGG + Intronic
932997471 2:76872896-76872918 ATTTGGCAAGAGAGGGAGCAAGG - Intronic
933242457 2:79937682-79937704 CCTTTTTAATAGAGGGAACAGGG - Intronic
933255900 2:80080118-80080140 CTCTTTGAAGTGTGGGGGCATGG + Intronic
935890598 2:107673796-107673818 CAATTTGAAGAGACGCAGCAAGG - Intergenic
939737901 2:145872239-145872261 CTTTTTGAAGAGGAGTGGCAAGG + Intergenic
940088644 2:149891661-149891683 ATTGGTGAAGAGATGGAGCATGG + Intergenic
940774733 2:157874863-157874885 GCTTTTGGAGAGAGGCAGCAAGG - Exonic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
942006326 2:171703647-171703669 CATTATGAAGAGAAAGAGCAAGG + Intronic
942569941 2:177303629-177303651 CCTTTTGAAGTTAGGGAGTAAGG - Intronic
943474350 2:188336196-188336218 CTTCTTAAAGAAAGGCAGCAGGG - Intronic
944194875 2:197041780-197041802 ATTTTTGAAGAGAGGTAAGATGG - Intronic
945889796 2:215417741-215417763 CTTTTTAAAGAGTAGGAGTAAGG + Intronic
946973552 2:225122371-225122393 CTTTTTTAATTGAGGGAGAATGG - Intergenic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947364454 2:229379893-229379915 CTTGTTGAAGAGAGAGACAAGGG - Intronic
947709936 2:232307287-232307309 CTTTAGGAAGGGAGGGAGCATGG + Intronic
1169381297 20:5109854-5109876 TTTTCTTAAGAGCGGGAGCAGGG - Intronic
1169684162 20:8251761-8251783 CTTTTTGGGGAGAGGGACCTAGG - Intronic
1169965801 20:11215881-11215903 CTTTTTGATTAGAGGGACCCAGG - Intergenic
1170300564 20:14880215-14880237 AGTTTTGGGGAGAGGGAGCATGG + Intronic
1171002717 20:21430821-21430843 CTTTTTGAAAATAGAGAGCTTGG + Intergenic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1175803248 20:61813073-61813095 CTTTTCAAACAGAGAGAGCAAGG + Intronic
1177262918 21:18752473-18752495 CTTTTGAAAGAGATGGATCATGG - Intergenic
1178117522 21:29432650-29432672 CTTTTTCAGGAAATGGAGCAAGG - Intronic
1178509116 21:33187809-33187831 ATTTTTAAAGTGAGGGAGGAGGG + Intergenic
1178510676 21:33202451-33202473 CTTATTAAAGAGAGGGTTCAGGG - Intergenic
1180645835 22:17337975-17337997 CTTTTTACAGCGGGGGAGCAAGG - Intergenic
1181936952 22:26445888-26445910 CCTTTAGAAGAGAGGGAGACAGG + Intronic
1182076962 22:27501425-27501447 CTTTTTGCTGTGGGGGAGCAGGG - Intergenic
1182492094 22:30679927-30679949 CTGTTTGAAGGCAGGGACCAAGG + Intergenic
1182951932 22:34384298-34384320 CTCTTTATAGAGAGGAAGCAAGG - Intergenic
1182962443 22:34488297-34488319 ATTGTGGAAGGGAGGGAGCAAGG - Intergenic
1183044434 22:35208371-35208393 CCCTTTGTAGAGAGGGACCAAGG + Intergenic
1183074176 22:35416286-35416308 CCTACTGAAGTGAGGGAGCAGGG - Intronic
1184490322 22:44804544-44804566 CCTTGTGAGGACAGGGAGCACGG + Intronic
1184891847 22:47384530-47384552 CATTGTGAAGAGAAGGAGCCAGG + Intergenic
950916810 3:16654322-16654344 CTTTTTGAAAAGTAAGAGCAAGG - Intronic
954667454 3:52264436-52264458 CTTTTTAACTAGAGGCAGCAGGG + Intronic
954904955 3:54053423-54053445 CTTTTCCAAGAGAGGGAGGAGGG + Intergenic
955077548 3:55627900-55627922 TTTTTTGAAGAAAGGGGGCGGGG + Intronic
956831876 3:73058814-73058836 CTTTTTAAAGGAAGGGAGAATGG + Intronic
959391363 3:105778604-105778626 CTTTTTGATGAAAGGGGGGAGGG + Intronic
962162751 3:133016646-133016668 CTTTTTAAAGTGAGGGAACTGGG + Intergenic
962490062 3:135884489-135884511 CCTTTTCCAGAGAGTGAGCAGGG + Intergenic
962626012 3:137226849-137226871 GTTTTTGGAGAGAGTTAGCAGGG + Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
965847862 3:172985925-172985947 GTTTTTGGAGGGAGGTAGCATGG + Intronic
968621309 4:1604582-1604604 CTTGTTGGAGAGAGGGAGTGAGG - Intergenic
968837443 4:2975460-2975482 CTTTTAGAAAAGGAGGAGCAGGG + Intronic
969242842 4:5912427-5912449 CTTTATGAAGAAAAGGAGCTGGG + Intronic
971017404 4:22502590-22502612 CTTTTTTAACAGAGGAAGAAAGG + Intronic
972239481 4:37174843-37174865 ATTTTGGATAAGAGGGAGCAGGG - Intergenic
974905308 4:68047884-68047906 CATTTTAATGAAAGGGAGCAAGG + Intergenic
975072483 4:70158879-70158901 CCTGTTCAAGAGAGGGAGAAGGG - Exonic
976426442 4:84908694-84908716 CTTTTAGAATAAAGGGATCAAGG + Intronic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
976626625 4:87191289-87191311 CTTTTTGTAGAGAGGGGGTTTGG - Intronic
978624487 4:110669128-110669150 TCTTTTGGAGGGAGGGAGCATGG + Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979675833 4:123409604-123409626 CTTTTTGCAGAAAGACAGCATGG + Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980483724 4:133425465-133425487 CTTTTTGATGAAAAGGAGTAGGG - Intergenic
981585981 4:146302925-146302947 ATTCTTGAAGAGAGGGATCTGGG - Intronic
981943640 4:150315227-150315249 CTTGTTGATGAGCAGGAGCAAGG - Intronic
982080373 4:151783756-151783778 CTTTTTGAAGAGGGGAAGGGGGG + Intergenic
982179547 4:152737206-152737228 ATTGTTAAAAAGAGGGAGCAAGG + Intronic
982793159 4:159615802-159615824 CTTTTTGAAGAGCTTGAGTATGG + Intergenic
983795653 4:171859440-171859462 CTTCAGGAAGGGAGGGAGCATGG + Intronic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
985952816 5:3236460-3236482 CTCTTTGAACAGAGGAGGCAAGG - Intergenic
986114427 5:4757560-4757582 CTTTTTTAATATAGTGAGCACGG + Intergenic
988391444 5:30638604-30638626 CATTTTGATGAAAGGGATCATGG - Intergenic
989042187 5:37240499-37240521 TTTTCCCAAGAGAGGGAGCAAGG + Intronic
989139416 5:38188608-38188630 CTTTGAGATGAGTGGGAGCATGG + Intergenic
989208622 5:38836347-38836369 CTTCTTGAGGACAGGGACCAAGG + Intergenic
989781119 5:45265754-45265776 TTTGTTGAAGAGAGGTAGGAAGG - Intronic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
992374973 5:76179966-76179988 ATTTTTTAAGAGAGGGATCTTGG + Intronic
993027996 5:82667885-82667907 CTTTGGAAAGAGAGGGATCAGGG - Intergenic
993051558 5:82932189-82932211 CATTTTGAAAAAAGTGAGCATGG + Intergenic
993075183 5:83220733-83220755 TTTTTTGAGGAGAGAGAGAAAGG + Intronic
993493118 5:88576328-88576350 CATTTTGAAGAAAGAGAGGAGGG - Intergenic
993776395 5:92003499-92003521 CTATTTGTAGAGAGGAAGGAAGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995937689 5:117536808-117536830 GTTTATGAAGGGAGGAAGCATGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996978649 5:129462445-129462467 CTTTTTGGAGGAAAGGAGCAAGG + Intronic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998200894 5:140119225-140119247 TTTTTTGAAGAGAGAGATTAAGG + Exonic
999371716 5:151059491-151059513 CTTTGTGAAGGGAGGCAGCAGGG + Intronic
999763300 5:154719324-154719346 CTTCCAGAAGAGAGGGAGCTGGG - Intronic
1000057296 5:157618710-157618732 CTTTTAGCAGAGAGGGGACATGG + Intergenic
1001157098 5:169282075-169282097 CTTTCTGTAGAGAGGATGCAAGG - Intronic
1001976184 5:176001140-176001162 CTTTTTGATGAGTGTTAGCATGG - Intronic
1002405213 5:179024974-179024996 CTTCTCCAAGAGAGGCAGCAGGG + Exonic
1002809847 6:616916-616938 TTTTTAGTAGAGAGGGAGGAGGG + Intronic
1003314343 6:4998111-4998133 CTTTTGGAGGATAGGAAGCATGG - Intronic
1003359189 6:5408140-5408162 CTCTTTGAAGACAGGGAGTATGG - Intronic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1004512448 6:16294074-16294096 CTTTGTGAAGAGAGGGACATGGG + Intronic
1004822880 6:19387261-19387283 CTTTTTGAAGAAAGGGGCAAAGG - Intergenic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1010083514 6:71888801-71888823 TTTTTGGATGAGAAGGAGCAGGG - Intronic
1010401686 6:75453508-75453530 ATTTTTTAAGAGAGGGAGAAAGG + Intronic
1010837584 6:80609185-80609207 CTTTTTGAAAAGATGGAAAAAGG + Intergenic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1012443386 6:99283614-99283636 CCTTTTGAGGAGATGCAGCATGG + Intronic
1013802082 6:113958344-113958366 TTTTTTGAAGCGAGGGAGTAAGG + Intronic
1014071664 6:117188459-117188481 CTTGTTGAAGAGAAGGAGATAGG + Intergenic
1014174322 6:118315092-118315114 GTTTTTGAAGAGAGGCTACAGGG - Exonic
1015940908 6:138450989-138451011 CTATTGGAAGAGGAGGAGCAGGG - Intronic
1016282893 6:142439408-142439430 CTTTTTGCAAATAGGGAGTAAGG + Intronic
1016321568 6:142852133-142852155 CTTTTTAAAGATAGAAAGCATGG - Intronic
1016820524 6:148342592-148342614 CATTTTGAAGAGAGGGGTCCCGG + Exonic
1016927594 6:149367445-149367467 CATTTTGAATTGAGGGAACAAGG + Intronic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1019008973 6:168826138-168826160 CTCTATAAAGCGAGGGAGCAGGG + Intergenic
1019974430 7:4569316-4569338 TTTTTTGAAGAGATGGAGTCTGG + Intergenic
1020285721 7:6678877-6678899 CTTTTTGAAGAGACCTAGCCAGG - Intergenic
1020572502 7:9883481-9883503 CTTTTTAAGGGGAGGGAGCCAGG + Intergenic
1021283311 7:18747098-18747120 CTTTTTGAGGAAAGGAAGGAAGG + Intronic
1022836601 7:34122474-34122496 GATTTTGAATAGAGGGACCAGGG + Intronic
1025040872 7:55644483-55644505 CTTTTTGCAAAGAGGAAGAAAGG - Intergenic
1025980216 7:66399145-66399167 CTTGTTGAGAAGAGGGAGCAAGG - Intronic
1026829492 7:73602359-73602381 CCTTTTAAAGAAAGGCAGCAGGG - Intronic
1027205097 7:76091518-76091540 CTTGTTGAGAAGAGGGAGCAAGG - Intergenic
1027918789 7:84362886-84362908 CTTTTTGCAGACATAGAGCAGGG - Intronic
1028419678 7:90618915-90618937 CTTTTTGATGAGAAGGAGCAGGG + Intronic
1028851342 7:95541567-95541589 CTTTTTTGAGATAGGGAGTAGGG + Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030437952 7:109549592-109549614 CTTTTTGTTGAGAAGGAGAAAGG - Intergenic
1031095091 7:117407722-117407744 CTATGTGAAGAGATGAAGCAGGG + Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1033166474 7:139042805-139042827 CTTTCAGTGGAGAGGGAGCAGGG - Intergenic
1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG + Intergenic
1033667093 7:143451787-143451809 CTTTTTCAAGAGACCCAGCAAGG + Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034395627 7:150822525-150822547 ATTTCTGGAGAGAGGGAGAAAGG + Intergenic
1034528457 7:151680867-151680889 CTTCTCGAAGAGAAAGAGCAAGG - Intronic
1034854202 7:154525324-154525346 TTTTTTGAAGAGACGGAGTCTGG + Intronic
1034904362 7:154930818-154930840 CAGTTTGAAGAATGGGAGCAAGG + Intronic
1034922876 7:155098443-155098465 CTTTCTGAAGAGAGGGGACAAGG + Intergenic
1035386688 7:158477807-158477829 CTTTTTCCAGAAAGGCAGCAGGG - Intronic
1036056400 8:5259738-5259760 CCTTTTGAAGGGTGGGAGAAGGG + Intergenic
1036798242 8:11771036-11771058 GTTTTTTGAGAGCGGGAGCAGGG + Intronic
1037620712 8:20561184-20561206 CTTTTAGAAGGAAGGGAGGAAGG + Intergenic
1037656561 8:20888735-20888757 ATTTTGGAAAAGAGGGAACAAGG + Intergenic
1038675165 8:29616498-29616520 TCCTTTGAAGACAGGGAGCAAGG - Intergenic
1038840203 8:31177716-31177738 CTTTGTGAAGAATGGGAGCACGG + Intergenic
1039343998 8:36683965-36683987 CTTTAGGAAGAGTGGGAGAAAGG - Intergenic
1040713275 8:50215687-50215709 CTTTTTGAAAGGAGAGAGCTTGG - Intronic
1041458773 8:58088806-58088828 CTTTTTGATCAGAGGGCTCATGG + Intronic
1042009194 8:64220964-64220986 TTTTTTGAGGAAAGGGTGCAGGG - Intergenic
1042172594 8:66006668-66006690 TTTTTTTAAAAGTGGGAGCAGGG - Intergenic
1042610556 8:70595247-70595269 CTTCTGGAGGAGAAGGAGCAGGG - Intronic
1043412754 8:80015674-80015696 CAGTTTGAAGAGACAGAGCAAGG + Intronic
1043438239 8:80254645-80254667 CATTTTACAGAGAGGCAGCAAGG + Intergenic
1043799697 8:84592342-84592364 ATTCCTGAAGAGAGTGAGCACGG - Intronic
1044681538 8:94783438-94783460 TTTTCTAAAAAGAGGGAGCAGGG - Intronic
1045157541 8:99493481-99493503 TTATTTGAAGAGAGAGAGAATGG + Intronic
1045819407 8:106318494-106318516 CTTTGTGAACATAGGAAGCAGGG - Intronic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1047731589 8:127733405-127733427 CTTTTTGTAGAGAGGCAGTCTGG - Intergenic
1048843322 8:138583742-138583764 ATTTCGGAAGAGAGGGAACATGG - Intergenic
1053873055 9:42513843-42513865 TTTTGTGAAGAGAGGAAGCAGGG + Intergenic
1053899697 9:42782077-42782099 TTTTGTGAAGAGAGGAAGCAGGG - Intergenic
1054261948 9:62875516-62875538 TTTTGTGAAGAGAGGAAGCAGGG + Intergenic
1054269275 9:62952909-62952931 TTTTGTGAAGAGAGGAAGCAGGG - Intergenic
1056807120 9:89737379-89737401 CTTTCTGAAGACAGGCAGCCAGG + Intergenic
1057745394 9:97747103-97747125 CTTTATTAAAAGAGGCAGCAGGG - Intergenic
1058040144 9:100293988-100294010 CTTTTTGTAGAGACGGAGTTTGG - Intronic
1058927020 9:109676386-109676408 CTTAATGAAGATAGGGAACATGG + Intronic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059438708 9:114290798-114290820 CTTTCTTAACAGGGGGAGCAGGG + Exonic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1059677603 9:116554615-116554637 TTTTTAGAAGAGAGAGACCAAGG + Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1061202625 9:129146390-129146412 ATTTTTGAGGAGAGGGAACCTGG + Intronic
1061349148 9:130050432-130050454 CTTTTTGTAGAAAGTGATCATGG - Intergenic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1186018542 X:5226990-5227012 TTTTTTTTTGAGAGGGAGCACGG - Intergenic
1186294130 X:8130366-8130388 CTTTATGAAGTGAGAAAGCATGG + Intergenic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1186623579 X:11267737-11267759 CTGTTTTAAGAGTGGAAGCAAGG + Intronic
1187423238 X:19154878-19154900 GTTATTGAAGAGTGGGAGGAAGG - Intergenic
1187737890 X:22323009-22323031 TTTTTGGAGGAGAGGGAGAAGGG + Intergenic
1188948102 X:36333494-36333516 TTTTTAGGAGAGAGGGAGAATGG - Intronic
1189462693 X:41254897-41254919 CTTTTTAAAAAAAGGGGGCAGGG - Intergenic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1191119465 X:56888442-56888464 CTTTGTGAAAAGAGAAAGCATGG - Intergenic
1191679798 X:63829484-63829506 CTTCTTGAAGAAAGGCAGAAAGG - Intergenic
1192534072 X:71912561-71912583 CTTTATGAAGAGAGGTGCCAGGG - Intergenic
1193864616 X:86715796-86715818 CTTTAAGAAGAGAGGAGGCAGGG + Intronic
1196400928 X:115315571-115315593 CATTTTGAAAAGAGAAAGCATGG + Intergenic
1196591309 X:117488115-117488137 CTTTTAGTGGGGAGGGAGCATGG + Intergenic
1196707047 X:118726001-118726023 CTTTTGGGAGGGAAGGAGCAAGG - Intergenic
1197532301 X:127644653-127644675 CTTTTTAAAGAGGGGAGGCAGGG + Intergenic
1197701036 X:129599840-129599862 CTCTGTGGTGAGAGGGAGCAAGG - Intergenic
1198081388 X:133243172-133243194 CTTTTTAAAGAGATGGAGCCAGG - Intergenic
1198092730 X:133347726-133347748 CTTTTTGGAAGGAGGGAGGATGG - Intronic
1199342513 X:146698142-146698164 ATTTTTGAAGAAAGGAAGGAAGG + Intergenic
1199342525 X:146698266-146698288 ATTTTTGAAGAAAGGAAGGAAGG + Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1199746369 X:150774375-150774397 GTTTTAGAGGAGAGGGAGCAAGG - Intronic