ID: 1017873178

View in Genome Browser
Species Human (GRCh38)
Location 6:158503115-158503137
Sequence GCCCTGACTCAGCATCAGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017873178 Original CRISPR GCCCTGACTCAGCATCAGAG AGG (reversed) Exonic
901922052 1:12544138-12544160 GTCCTCACTCATCATCAAAGAGG + Intergenic
904351027 1:29906821-29906843 GCCCTGATTCAGCATGGCAGAGG - Intergenic
905626559 1:39493387-39493409 GTCCTGGCTCAGCAACATAGAGG - Intronic
906241686 1:44246026-44246048 GCCCTGATTCAGAATCAATGAGG - Intronic
906686765 1:47767944-47767966 GCCCTGGCTCAGCTTCAGCTAGG + Intronic
909345242 1:74577414-74577436 CACCAGACTCAGCATCACAGTGG + Intronic
910430613 1:87156129-87156151 GCTCAGACTCAGCAACAGACTGG - Intronic
911466365 1:98258733-98258755 ACCCTGATACAGCATCAGAAAGG + Intergenic
913497210 1:119439351-119439373 GCCCTGACTCAGAACTTGAGAGG + Intergenic
914879587 1:151537217-151537239 GAGCTGACTCAGCAGCTGAGCGG - Exonic
914959220 1:152191391-152191413 GAACTGACTCAGGCTCAGAGAGG - Intergenic
914976721 1:152371303-152371325 GCTCATACTCAGCATCATAGTGG + Intergenic
915165871 1:153947445-153947467 GCCCTGCTGCAGCATCAGATGGG - Intergenic
916012042 1:160714862-160714884 CCCCAGACTCAGCCTCACAGAGG - Intergenic
917472094 1:175334632-175334654 GCCCTGAGTCTGCATCTGGGTGG - Intronic
918044689 1:180934907-180934929 GCGCTGTCTCAGGATCAGAATGG + Intronic
918445818 1:184615727-184615749 GCCCCATCTCAGCATCACAGGGG - Intronic
923178475 1:231492755-231492777 CCCCTGCCTCAGCCTCAGATGGG - Intergenic
1063186016 10:3652235-3652257 TCCCTGGAGCAGCATCAGAGTGG + Intergenic
1063342733 10:5283342-5283364 GGCCTGACTCAGCAGGAGGGTGG - Intergenic
1065974649 10:30831457-30831479 ACGCTTACTCAGCATCAGGGTGG - Intronic
1066417929 10:35238426-35238448 GACCTGACAAAGCATCAGAAGGG - Intergenic
1069961149 10:72080309-72080331 GGCCTGGCTCAGCCTCTGAGAGG + Intronic
1070752481 10:78972474-78972496 GCCCTGCTTCAGCCTCAGGGGGG + Intergenic
1073168954 10:101485355-101485377 GCCCTGAGTGGGCATCAGACTGG + Intronic
1074646324 10:115457223-115457245 CCCCAGACTCAGCCTCACAGAGG - Intronic
1075226831 10:120637137-120637159 GCCCTGACTCAGGGCAAGAGAGG + Intergenic
1075467092 10:122659797-122659819 GCCCAGCCTCTGCATCAGAATGG - Intergenic
1076052870 10:127349217-127349239 GCCCAGAGCCAGCATCGGAGTGG - Intronic
1076441003 10:130481373-130481395 CCCCTGACTCAGCAGCACTGGGG - Intergenic
1077061480 11:619636-619658 GCCCTGACCCACCCACAGAGGGG + Intronic
1080352842 11:31405102-31405124 GCACTGCCTGAGCAACAGAGTGG - Intronic
1081630722 11:44687891-44687913 CCCCAGCCTCAGCATCAGAAAGG - Intergenic
1081807640 11:45899209-45899231 GCCCTGACTTAGCTTCTCAGAGG + Intronic
1081989435 11:47329829-47329851 GCTCTGCCTGAGCATCAGGGAGG + Exonic
1083763929 11:64833253-64833275 GCCCAGGCCCAGCATCAGCGAGG + Exonic
1087807046 11:102566333-102566355 GCCCTGAGTCCACATCTGAGTGG - Intergenic
1088470410 11:110183519-110183541 GACCTGTCTGAGCATCATAGTGG - Intronic
1088896317 11:114081258-114081280 GCTCAGGCTCAGCAGCAGAGAGG - Intronic
1089696234 11:120218025-120218047 GCACTGAGTCAGCAGCACAGTGG + Intronic
1090440188 11:126718884-126718906 GCTGGGATTCAGCATCAGAGAGG - Intronic
1090673552 11:128969058-128969080 TCCCTGCCTCAGCACCAGCGAGG - Exonic
1092337756 12:7648856-7648878 GCCATGACTCAGAGTAAGAGGGG - Intergenic
1092880765 12:12886186-12886208 TCCCAGACTCAGAAGCAGAGGGG - Intergenic
1093006975 12:14061553-14061575 GCCTGGACTCAGGATGAGAGAGG - Intergenic
1100927787 12:99569580-99569602 GCCCAGATTCTGCTTCAGAGAGG + Intronic
1101044976 12:100795386-100795408 GCACTCACTCAGGATCAGAAGGG + Intronic
1102246489 12:111359729-111359751 GCCCTGACTCAGCTTGTGTGGGG + Intergenic
1103531097 12:121602406-121602428 CTCCTGGCTCAGCCTCAGAGTGG + Intergenic
1103729778 12:123019847-123019869 GCCTTCACTCAGCCTCAGGGGGG + Intronic
1105630689 13:22162553-22162575 CTCCTGCCTCAGCATCTGAGTGG - Intergenic
1107312031 13:39089672-39089694 TCCCTGATTTAGCAACAGAGGGG - Intergenic
1108748579 13:53421594-53421616 CCCTTGTCTCAGCCTCAGAGTGG - Intergenic
1111310191 13:86474231-86474253 GCCCTTATTCAGACTCAGAGTGG + Intergenic
1112097426 13:96150208-96150230 GTCCAGACTCAGCCTCAAAGAGG - Intronic
1112303103 13:98248049-98248071 AGCCTCTCTCAGCATCAGAGAGG + Intronic
1112752582 13:102597295-102597317 GCCCGGACTCGGCCGCAGAGCGG - Intronic
1113881467 13:113629060-113629082 GAGCTGAGTCAGCATCACAGGGG - Intronic
1114416213 14:22546293-22546315 GCCCCCACTCAGCATCCCAGGGG + Intergenic
1116857150 14:49962809-49962831 GCCGTGACTCACCAAGAGAGAGG + Intergenic
1118683067 14:68263131-68263153 GCCCTCACAGAGCATCAGGGTGG - Intronic
1125826904 15:42684400-42684422 GCCCTGGCTCACCATCTGATGGG - Exonic
1126581046 15:50242815-50242837 GTGCTGACTCAGGATGAGAGTGG + Exonic
1128229677 15:66025736-66025758 GCCCAGACTCAGCCTCGGCGGGG - Intronic
1128708313 15:69853324-69853346 GCCCTGAATCAGCACCAGCCAGG + Intergenic
1129844299 15:78761196-78761218 GCCCTCATTCAGGCTCAGAGTGG - Intronic
1131078274 15:89512930-89512952 GCCCTGATTCAACGTGAGAGGGG + Intergenic
1131094048 15:89645101-89645123 CCCCTGCCACAGCCTCAGAGTGG - Exonic
1132571918 16:647926-647948 GGCCTGGGTCAGGATCAGAGGGG - Intronic
1133662788 16:7935188-7935210 GACCTGACTAAGCATGGGAGGGG - Intergenic
1134665855 16:16018061-16018083 GCCATGAATCAGCATCAAATAGG - Intronic
1138117311 16:54370778-54370800 GCCGTCACTCAGGATCCGAGGGG - Intergenic
1140498721 16:75413446-75413468 TCCCTGCCTCAGCCTCCGAGTGG - Intronic
1141028632 16:80569812-80569834 GCCCAGAGTCAGCGTGAGAGGGG + Intergenic
1141096197 16:81164859-81164881 GCCCAGCTTCACCATCAGAGTGG + Intergenic
1141598442 16:85111440-85111462 CCCCTGATTCAGCAGCACAGGGG + Intronic
1141714644 16:85719768-85719790 GCCCTGAGGCAGGAACAGAGGGG + Intronic
1141714666 16:85719862-85719884 GCCCTGAGGCAGGAACAGAGGGG + Intronic
1141714677 16:85719909-85719931 GCCCTGAGGCAGGAACAGAGGGG + Intronic
1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG + Intergenic
1142001244 16:87665550-87665572 GGCCTGTCTCAGCATCTGTGAGG - Intronic
1142179663 16:88662258-88662280 GGACTGGCTCAGCAACAGAGGGG + Intronic
1142309088 16:89301797-89301819 GCCCTGACTAAGCACCGCAGAGG + Intronic
1143158568 17:4854119-4854141 TCCCCGGCTCAGCATCAGAAAGG + Intronic
1144686007 17:17226877-17226899 GCACAGCCTCAGCATCGGAGTGG - Intronic
1146282699 17:31555318-31555340 GCCCTCAAGCAGCAGCAGAGGGG - Intergenic
1149419853 17:56499402-56499424 GCCCTCACTTGGCATCACAGTGG - Intronic
1150629437 17:66868681-66868703 GCAGGGACTCAGCATCAGAAGGG - Intronic
1150684209 17:67307262-67307284 GCCCAGAGTCACCATGAGAGGGG + Intergenic
1150737939 17:67756064-67756086 GCCCTGAGTCAGTTCCAGAGTGG - Intergenic
1151013220 17:70525628-70525650 GCCCTTCATCACCATCAGAGGGG + Intergenic
1152072816 17:78142399-78142421 GTCTGGACTCAGCATCAGGGAGG + Exonic
1152895511 17:82908730-82908752 GCCATGGCTCAGCGTCAGTGGGG - Intronic
1152945478 17:83195456-83195478 GCCCTGACACAGCCTAAGACGGG - Intergenic
1155722124 18:29028667-29028689 GCCTGGAATCAGCATCAGAGTGG - Intergenic
1157825699 18:50810073-50810095 CCCCTGCCTCAGCCTCTGAGTGG + Intronic
1160247834 18:77173853-77173875 GCCTTGGCTCAGCATTACAGAGG + Intergenic
1160445561 18:78924753-78924775 ACCCTAATTCAGCATCCGAGTGG + Intergenic
1161970325 19:7575622-7575644 ACCCTGAGTCAGCATGGGAGGGG + Intergenic
1163821682 19:19499718-19499740 GGCCTGGCGCAGCCTCAGAGTGG + Intronic
1165112672 19:33511376-33511398 TGCCTGACACAGCATCAGGGAGG - Intronic
1165259324 19:34598738-34598760 GCCCTGTCTCAGCCACAGAGAGG - Intronic
1165933207 19:39373515-39373537 GGCCTGAGGCAGCAGCAGAGGGG + Intronic
1166292491 19:41872014-41872036 GCCTTCACTCTGCATCTGAGCGG + Exonic
1166318231 19:42000686-42000708 GCTCTGACACAGTGTCAGAGGGG - Intronic
926699855 2:15796397-15796419 GCCCAGACTCCGTATGAGAGAGG - Intergenic
927590294 2:24350297-24350319 GCCATTACTCAGAATCACAGTGG - Intronic
929744599 2:44642795-44642817 GCCCTCCCTGAGCCTCAGAGTGG - Intronic
931821147 2:65953680-65953702 GGCCTGACAGAGCAGCAGAGTGG - Intergenic
932200807 2:69826672-69826694 TCCCTGACTCAGCCTCCGAGTGG - Intergenic
932477408 2:72014874-72014896 GTTCTGCCTCACCATCAGAGGGG - Intergenic
934857214 2:97736889-97736911 GACCTGACTCAGGGGCAGAGAGG + Intronic
936843851 2:116806160-116806182 GAACTGATTCAGAATCAGAGTGG + Intergenic
940830862 2:158463857-158463879 CCACTGACTCAGCCACAGAGGGG - Intronic
940982219 2:160016622-160016644 ATCCTGATTCAGCATCAGAGAGG + Exonic
942804227 2:179910887-179910909 GCCCTGACTCCCCAGCAGAGGGG + Intergenic
942931965 2:181504999-181505021 GCCCTGCATTAGCACCAGAGAGG + Intronic
945597875 2:211817541-211817563 TCCCTGCCACAGCATCAAAGGGG - Intronic
946713350 2:222528276-222528298 GGCCTAACTCAGAATCACAGCGG + Intronic
947957072 2:234201346-234201368 GCCTGGACTCAGCTTCAGTGGGG - Intergenic
948355366 2:237373269-237373291 GCCAAGACACAGCATCACAGAGG + Intronic
948889434 2:240899808-240899830 GGCCTAACTCTGCATCAGGGTGG + Intergenic
1168764222 20:371106-371128 GCCCTGACTCAGCACCTGCCTGG + Intronic
1169246727 20:4031884-4031906 GCTTTGGCTCGGCATCAGAGGGG - Intergenic
1169301996 20:4450914-4450936 GCACTGACTGAGAATCGGAGAGG + Intergenic
1170572639 20:17641108-17641130 GCCCACCCTCAGCAGCAGAGAGG + Intronic
1172165009 20:32893618-32893640 GCTCTCACCCAGGATCAGAGTGG - Intronic
1172668153 20:36614964-36614986 GCTCTGAGTCAGAACCAGAGTGG + Intronic
1173715828 20:45204583-45204605 GACCTGCCCCAGCAGCAGAGAGG - Intergenic
1174951928 20:55051524-55051546 TCGCTGACTCAGAAACAGAGGGG + Intergenic
1175588765 20:60170047-60170069 GTCCTGAGTCAGCGTGAGAGTGG - Intergenic
1175705010 20:61170319-61170341 ACCCTCACTCAGCACCAAAGGGG - Intergenic
1177204691 21:17997619-17997641 GCCATGCCTCAGAATCATAGCGG + Intronic
1178225199 21:30708640-30708662 ACTCTGACTCAGCTTCACAGAGG - Intergenic
1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG + Intronic
1181031501 22:20150526-20150548 GCCCTGTCCCAGCTTCAGTGCGG - Exonic
1181511889 22:23392999-23393021 GCCCTGTCCCAGCTTCAGTGTGG + Intergenic
1181587800 22:23863278-23863300 GCCCTCACACAGCCTAAGAGAGG - Intronic
1184820780 22:46907945-46907967 GCCCTGAGACAGCCGCAGAGTGG + Intronic
949128911 3:477928-477950 GCCCTGAGTCAACAGAAGAGGGG - Intergenic
952435684 3:33270277-33270299 TCCCTGACTCTGCCTCACAGGGG - Intergenic
959577677 3:107951921-107951943 GCGCTGCCTCAGCATCACTGGGG - Intergenic
960410010 3:117311567-117311589 TCCCAGGCTCAGCATCACAGAGG + Intergenic
964655442 3:159061834-159061856 GCCCTGACTCTGTATCTTAGAGG + Intronic
968341637 3:197960425-197960447 GCCCTACCTCAGTGTCAGAGGGG - Exonic
969207018 4:5654763-5654785 GGCCTGACTCAACAACAGAGTGG - Intronic
969613237 4:8238435-8238457 GCCCCTACTCAGCATCACACTGG + Intronic
970027520 4:11639346-11639368 GCCCTGAATCAGCTTCTGGGTGG + Intergenic
982173891 4:152687118-152687140 GGCCTGGCCCAGCATCAGAAAGG - Intergenic
985821610 5:2164288-2164310 CCCCCGACACATCATCAGAGGGG + Intergenic
985931897 5:3064814-3064836 GCTCTGACACACCAGCAGAGTGG + Intergenic
986350073 5:6868982-6869004 GTCCAGGCTCAGCATCACAGGGG + Intergenic
987402419 5:17491791-17491813 GGCCAGGCTCAGCCTCAGAGAGG - Intergenic
988361007 5:30236541-30236563 GACCTGACACAGCATGAGACAGG - Intergenic
988798973 5:34678699-34678721 GCCCTGGCACACCAGCAGAGGGG + Intronic
989224939 5:39016048-39016070 GCCCTGAGTCAGGATCTTAGGGG - Intronic
992162836 5:74019105-74019127 TCCCTGACCCAGTATCAGTGGGG - Intergenic
994681117 5:102888748-102888770 GACTTCTCTCAGCATCAGAGAGG - Intronic
998352337 5:141509620-141509642 GCCCTGGCTCAGCATCACCCAGG - Intronic
999317118 5:150591264-150591286 TCCCGGGCTCAGCTTCAGAGGGG - Intergenic
1006586811 6:35120477-35120499 GCCCTGACACAGCACCATTGTGG + Exonic
1007601278 6:43083222-43083244 GCCCAGGCACAGCAGCAGAGAGG - Intronic
1008493733 6:52112053-52112075 GCCTTTACTCAGCATAAGATGGG + Intergenic
1008629318 6:53348552-53348574 GCCCTGCCTCAGCCTCGGCGTGG + Intronic
1016846642 6:148574554-148574576 GCCCTGGCTCAGTATGGGAGGGG + Intergenic
1017873178 6:158503115-158503137 GCCCTGACTCAGCATCAGAGAGG - Exonic
1018460353 6:163992935-163992957 GCCCTGACTCAGAATCAGATGGG + Intergenic
1018460561 6:163994770-163994792 GCCCTGACTCAGAATCAGGTGGG + Intergenic
1020006330 7:4785366-4785388 GCTCTGTCTCAGCCTTAGAGTGG - Intronic
1020112335 7:5454657-5454679 GCCCTGAGTGAGGCTCAGAGAGG + Intronic
1021929779 7:25568734-25568756 GCACTGACTCACTATGAGAGAGG - Intergenic
1023315427 7:38931222-38931244 GACTTGACTCAGGAACAGAGAGG - Intronic
1024074288 7:45810826-45810848 GCCCAGCCTCAGCCTCACAGCGG + Intergenic
1024075328 7:45814980-45815002 GCCCAGCCTCAGCCTCACAGCGG + Intergenic
1025052123 7:55740812-55740834 GCCCAGCCTCAGCCTCACAGTGG - Intergenic
1025053125 7:55744702-55744724 GCCCAGCCTCAGCCTCACAGCGG - Intergenic
1025176459 7:56804670-56804692 GACCTCTCTCAGCATGAGAGAGG - Intergenic
1025180294 7:56820974-56820996 GACCTGCCTCAGCGTGAGAGAGG + Intergenic
1025180765 7:56822956-56822978 GACCTGCCTCAGCGTGAGAGAGG + Intronic
1025180773 7:56823004-56823026 GACCTGCCTCAGCGTGAGAGAGG + Exonic
1025692074 7:63757791-63757813 GACCTCCCTCAGCATGAGAGAGG - Exonic
1025695332 7:63771716-63771738 GACCTCTCTCAGCATGAGAGAGG + Intergenic
1026192651 7:68143551-68143573 GCACTGAGTCAGCTTCTGAGTGG + Intergenic
1029089133 7:98034301-98034323 CCCCGGACTCAGCATCTGAATGG + Intergenic
1029698072 7:102227679-102227701 CTCCTGACTCAGCAGCCGAGAGG - Intronic
1030597063 7:111552752-111552774 GCCCTGATTCAGTATGGGAGTGG - Intronic
1031644033 7:124201718-124201740 GACCTGGCTAAGAATCAGAGGGG + Intergenic
1032011417 7:128350526-128350548 CCTCTCACTCAGCACCAGAGTGG + Exonic
1036631282 8:10517789-10517811 GCCCTAACTCAGCATCCCTGGGG + Intergenic
1036761836 8:11514759-11514781 GCCCTGGCTGAGCATCAGAATGG + Intronic
1037159955 8:15757562-15757584 GCCAGGACTCAGCATGAGAAAGG - Intronic
1039008560 8:33068330-33068352 GGCCAGACACAGAATCAGAGAGG + Intergenic
1039545087 8:38404254-38404276 GCCGTGACTCATCACCTGAGCGG + Intronic
1039881666 8:41629124-41629146 GCCCTGACTCCTCAGCAGGGAGG - Intergenic
1039916113 8:41861563-41861585 CCACTGAATCAGCAGCAGAGTGG - Intronic
1040898201 8:52390198-52390220 GGGCTGACACAGCTTCAGAGTGG + Intronic
1045964579 8:108010209-108010231 CCCATGAGTCAGCAGCAGAGTGG + Intronic
1046972891 8:120242494-120242516 GCCCAGGCTCTGCTTCAGAGGGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048879407 8:138860289-138860311 GTCCTGACTCTGCCACAGAGGGG - Intronic
1048970341 8:139641806-139641828 GCCCTGACACTGCAGCAGTGTGG + Intronic
1049256007 8:141614303-141614325 GAGATGACTCAACATCAGAGAGG + Intergenic
1049478518 8:142807989-142808011 GCCCTGACACAGCCTCTGAGGGG + Intergenic
1051369146 9:16343606-16343628 GCCCCAACCCAGCCTCAGAGTGG + Intergenic
1053417136 9:37953831-37953853 GTCCTGACTCATCACCCGAGGGG - Intronic
1055341617 9:75290546-75290568 GCCCTGAAGCAGCAACAGGGAGG - Intergenic
1056828758 9:89896936-89896958 GCCCTCATCCAGCATCAGTGAGG - Intergenic
1058754781 9:108074226-108074248 GCCCTGAGTCAACATCACAGTGG + Intergenic
1058999037 9:110328980-110329002 GGCCTGCCACAGCATAAGAGGGG + Intronic
1059392198 9:114006289-114006311 GCCCTGACTCAGCCTTAGCTTGG + Intronic
1060727508 9:126016219-126016241 GCCCTGAGCCAGGATCAGATGGG + Intergenic
1060973084 9:127749865-127749887 GCCCTGAGTCTGCAGCACAGAGG + Intronic
1062459036 9:136655228-136655250 GCCATGACTCTGCATCAGGCAGG - Intergenic
1186807419 X:13153994-13154016 GCACTGACTCAGCCTCTGGGTGG - Intergenic
1196540597 X:116902475-116902497 GCCCTGTTCCAGCACCAGAGAGG + Intergenic
1197563530 X:128052478-128052500 GTCCTCAGTGAGCATCAGAGGGG + Intergenic
1197858166 X:130940802-130940824 GCACAGACTCAACATCAGAATGG - Intergenic
1201763106 Y:17559508-17559530 GTCCTCACTCAGCAGCAGGGCGG + Intergenic
1201838446 Y:18346481-18346503 GTCCTCACTCAGCAGCAGGGCGG - Intergenic