ID: 1017875222 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:158518481-158518503 |
Sequence | GGTTCCCGAAGATGATCTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1017875219_1017875222 | -9 | Left | 1017875219 | 6:158518467-158518489 | CCAGACTTTGTCCAGGTTCCCGA | No data | ||
Right | 1017875222 | 6:158518481-158518503 | GGTTCCCGAAGATGATCTGGAGG | No data | ||||
1017875217_1017875222 | 12 | Left | 1017875217 | 6:158518446-158518468 | CCGAAGATGGGTTCATTTTGTCC | No data | ||
Right | 1017875222 | 6:158518481-158518503 | GGTTCCCGAAGATGATCTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1017875222 | Original CRISPR | GGTTCCCGAAGATGATCTGG AGG | Intergenic | ||