ID: 1017875222

View in Genome Browser
Species Human (GRCh38)
Location 6:158518481-158518503
Sequence GGTTCCCGAAGATGATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017875219_1017875222 -9 Left 1017875219 6:158518467-158518489 CCAGACTTTGTCCAGGTTCCCGA No data
Right 1017875222 6:158518481-158518503 GGTTCCCGAAGATGATCTGGAGG No data
1017875217_1017875222 12 Left 1017875217 6:158518446-158518468 CCGAAGATGGGTTCATTTTGTCC No data
Right 1017875222 6:158518481-158518503 GGTTCCCGAAGATGATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017875222 Original CRISPR GGTTCCCGAAGATGATCTGG AGG Intergenic