ID: 1017880637

View in Genome Browser
Species Human (GRCh38)
Location 6:158560328-158560350
Sequence CCCAGTTCCACGTGGGCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017880637_1017880648 1 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880648 6:158560352-158560374 GCAGGGAAAAGGGCGCTGAAGGG No data
1017880637_1017880646 -9 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880646 6:158560342-158560364 GGAACTGGGGGCAGGGAAAAGGG 0: 1
1: 0
2: 7
3: 103
4: 830
1017880637_1017880647 0 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880647 6:158560351-158560373 GGCAGGGAAAAGGGCGCTGAAGG 0: 1
1: 0
2: 1
3: 31
4: 325
1017880637_1017880656 24 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880656 6:158560375-158560397 GGCTTCGCGGGCGGGTCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 141
1017880637_1017880655 21 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880655 6:158560372-158560394 GGGGGCTTCGCGGGCGGGTCAGG No data
1017880637_1017880657 27 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data
1017880637_1017880649 2 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880649 6:158560353-158560375 CAGGGAAAAGGGCGCTGAAGGGG 0: 1
1: 0
2: 1
3: 32
4: 352
1017880637_1017880653 15 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880653 6:158560366-158560388 GCTGAAGGGGGCTTCGCGGGCGG No data
1017880637_1017880651 11 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880651 6:158560362-158560384 GGGCGCTGAAGGGGGCTTCGCGG 0: 1
1: 1
2: 0
3: 11
4: 200
1017880637_1017880652 12 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880652 6:158560363-158560385 GGCGCTGAAGGGGGCTTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1017880637_1017880650 3 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880650 6:158560354-158560376 AGGGAAAAGGGCGCTGAAGGGGG No data
1017880637_1017880654 16 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880654 6:158560367-158560389 CTGAAGGGGGCTTCGCGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1017880637_1017880645 -10 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880645 6:158560341-158560363 TGGAACTGGGGGCAGGGAAAAGG 0: 1
1: 0
2: 4
3: 81
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017880637 Original CRISPR CCCAGTTCCACGTGGGCGCC AGG (reversed) Intronic