ID: 1017880642

View in Genome Browser
Species Human (GRCh38)
Location 6:158560335-158560357
Sequence CCCTGCCCCCAGTTCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017880642_1017880655 14 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880655 6:158560372-158560394 GGGGGCTTCGCGGGCGGGTCAGG No data
1017880642_1017880647 -7 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880647 6:158560351-158560373 GGCAGGGAAAAGGGCGCTGAAGG 0: 1
1: 0
2: 1
3: 31
4: 325
1017880642_1017880650 -4 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880650 6:158560354-158560376 AGGGAAAAGGGCGCTGAAGGGGG No data
1017880642_1017880656 17 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880656 6:158560375-158560397 GGCTTCGCGGGCGGGTCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 141
1017880642_1017880649 -5 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880649 6:158560353-158560375 CAGGGAAAAGGGCGCTGAAGGGG 0: 1
1: 0
2: 1
3: 32
4: 352
1017880642_1017880653 8 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880653 6:158560366-158560388 GCTGAAGGGGGCTTCGCGGGCGG No data
1017880642_1017880651 4 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880651 6:158560362-158560384 GGGCGCTGAAGGGGGCTTCGCGG 0: 1
1: 1
2: 0
3: 11
4: 200
1017880642_1017880648 -6 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880648 6:158560352-158560374 GCAGGGAAAAGGGCGCTGAAGGG No data
1017880642_1017880654 9 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880654 6:158560367-158560389 CTGAAGGGGGCTTCGCGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1017880642_1017880657 20 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data
1017880642_1017880652 5 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG No data
Right 1017880652 6:158560363-158560385 GGCGCTGAAGGGGGCTTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017880642 Original CRISPR CCCTGCCCCCAGTTCCACGT GGG (reversed) Intronic