ID: 1017880644

View in Genome Browser
Species Human (GRCh38)
Location 6:158560336-158560358
Sequence TCCCTGCCCCCAGTTCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 298}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017880644_1017880650 -5 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880650 6:158560354-158560376 AGGGAAAAGGGCGCTGAAGGGGG No data
1017880644_1017880651 3 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880651 6:158560362-158560384 GGGCGCTGAAGGGGGCTTCGCGG 0: 1
1: 1
2: 0
3: 11
4: 200
1017880644_1017880653 7 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880653 6:158560366-158560388 GCTGAAGGGGGCTTCGCGGGCGG No data
1017880644_1017880649 -6 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880649 6:158560353-158560375 CAGGGAAAAGGGCGCTGAAGGGG 0: 1
1: 0
2: 1
3: 32
4: 352
1017880644_1017880656 16 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880656 6:158560375-158560397 GGCTTCGCGGGCGGGTCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 141
1017880644_1017880657 19 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data
1017880644_1017880658 30 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880658 6:158560389-158560411 GTCAGGCGGAGGTGTTTGCGCGG No data
1017880644_1017880654 8 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880654 6:158560367-158560389 CTGAAGGGGGCTTCGCGGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 102
1017880644_1017880648 -7 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880648 6:158560352-158560374 GCAGGGAAAAGGGCGCTGAAGGG No data
1017880644_1017880655 13 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880655 6:158560372-158560394 GGGGGCTTCGCGGGCGGGTCAGG No data
1017880644_1017880652 4 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880652 6:158560363-158560385 GGCGCTGAAGGGGGCTTCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 107
1017880644_1017880647 -8 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880647 6:158560351-158560373 GGCAGGGAAAAGGGCGCTGAAGG 0: 1
1: 0
2: 1
3: 31
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017880644 Original CRISPR TCCCTGCCCCCAGTTCCACG TGG (reversed) Intronic