ID: 1017880657

View in Genome Browser
Species Human (GRCh38)
Location 6:158560378-158560400
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017880644_1017880657 19 Left 1017880644 6:158560336-158560358 CCACGTGGAACTGGGGGCAGGGA 0: 1
1: 0
2: 2
3: 20
4: 298
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data
1017880637_1017880657 27 Left 1017880637 6:158560328-158560350 CCTGGCGCCCACGTGGAACTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data
1017880642_1017880657 20 Left 1017880642 6:158560335-158560357 CCCACGTGGAACTGGGGGCAGGG 0: 1
1: 0
2: 0
3: 22
4: 200
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data
1017880635_1017880657 28 Left 1017880635 6:158560327-158560349 CCCTGGCGCCCACGTGGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr