ID: 1017882646

View in Genome Browser
Species Human (GRCh38)
Location 6:158572507-158572529
Sequence GGCCACACCCCTTTTGTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017882629_1017882646 30 Left 1017882629 6:158572454-158572476 CCGCACGTCCCTCTGGTCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 194
Right 1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 57
1017882633_1017882646 21 Left 1017882633 6:158572463-158572485 CCTCTGGTCTGTGGGTCTCCTCC 0: 1
1: 0
2: 2
3: 36
4: 309
Right 1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 57
1017882632_1017882646 22 Left 1017882632 6:158572462-158572484 CCCTCTGGTCTGTGGGTCTCCTC 0: 1
1: 0
2: 2
3: 23
4: 243
Right 1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 57
1017882640_1017882646 3 Left 1017882640 6:158572481-158572503 CCTCCTCAGGGCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 40
4: 312
Right 1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 57
1017882643_1017882646 0 Left 1017882643 6:158572484-158572506 CCTCAGGGCACAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 48
4: 482
Right 1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017882646 Original CRISPR GGCCACACCCCTTTTGTCGA TGG Intronic
900931417 1:5740217-5740239 GGCCACACACCTTTTGTCTCTGG - Intergenic
901851677 1:12019849-12019871 GGCCACACCCCTATAGTCAGAGG - Intronic
902536238 1:17120543-17120565 GGCCTCACCCCTCTTGTCTGGGG - Intergenic
903737787 1:25541343-25541365 TGCCACAGCCCTTTTGCAGAAGG + Intergenic
905467777 1:38168615-38168637 GGCCTCACCTCATTTGTTGAGGG + Intergenic
919554044 1:199029375-199029397 GGCCACAGACCTTTTGGGGAAGG + Intergenic
920552235 1:206872250-206872272 GGCCACTCCCCTTCTCTGGAGGG + Intergenic
921902302 1:220463448-220463470 GACCCCACCCCTTCTGTCTAGGG - Intergenic
1083428548 11:62601965-62601987 GGCCCCACCCCCTTTTCCGAGGG + Intergenic
1091089379 11:132755877-132755899 GGCCACATCACTCTTGTCAAGGG - Intronic
1095345360 12:41143202-41143224 GGCCACACCCCTTTCATTCATGG - Intergenic
1102945518 12:116984341-116984363 GGCCACACACCCTTTCTCCAGGG - Intronic
1104851515 12:131877271-131877293 GTCCACGCCCCTTATGTCAAGGG - Intergenic
1108876703 13:55057740-55057762 GTCCACGCCCCTTATGTCAAAGG + Intergenic
1118453879 14:65928240-65928262 GTCCACCCCCCTTTTCTGGAGGG + Intergenic
1122092423 14:99349198-99349220 GGACACAGCCCTTGTGTCCATGG - Intergenic
1122717620 14:103705171-103705193 GGCCACATCCCTTTTGTGGCTGG + Intronic
1131201018 15:90395987-90396009 GGGCACACCCCTCTTGTAGAAGG + Intronic
1140476008 16:75239569-75239591 GGCGACACCCATTTTGCAGAAGG - Intronic
1141003488 16:80330449-80330471 GGCCACAACATTTTTGTCAACGG - Intergenic
1141151884 16:81570098-81570120 GGCCTCACCCCTTCTGCAGACGG + Intronic
1149274063 17:55014735-55014757 GTCCATACCCCTTATGTCAAGGG - Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159383627 18:67693572-67693594 GGACATATCCCTTTTGTCAAGGG - Intergenic
1165060768 19:33204268-33204290 GGCCACTGCCCTTTTGGGGAGGG + Intronic
1166076550 19:40417221-40417243 GGCCACACCCCCTTGGGTGAGGG - Intergenic
1166712944 19:44948872-44948894 GGCCAGACCCCATTTCTCCAGGG - Intronic
1166948967 19:46413703-46413725 GGCCACACCCCTGTGGGGGAGGG - Intergenic
930405851 2:50954667-50954689 GACCAAACCTCTTTTGTCCAAGG - Intronic
932440537 2:71731813-71731835 AGCCACACTGCTTTAGTCGAGGG + Intergenic
1183384824 22:37508839-37508861 GGCCACACCCACTCTGCCGATGG - Intronic
949400243 3:3658122-3658144 GGCCACAACTCTTCTGTCGCTGG + Intergenic
949725260 3:7036898-7036920 GGCCAGACTCATTTTGTAGATGG - Intronic
951200654 3:19872749-19872771 GTCCATACCCCTTATGTCAAGGG - Intergenic
963688404 3:148467084-148467106 GGGCACACCCTTCTTGTCAATGG - Intergenic
969217658 4:5735063-5735085 GGCCACACCCCTGTGCTGGATGG - Intronic
980557712 4:134430889-134430911 GGCAGCACCCCTTTTGGCAATGG + Intergenic
981882842 4:149636346-149636368 GCAGACACCCCTTTTGTCCAGGG - Intergenic
995465680 5:112447710-112447732 GTCCATACCCCTTATGTCAAGGG + Intergenic
999182051 5:149676572-149676594 TGCCACACTCCTTTTGGAGAAGG - Intergenic
999371869 5:151060608-151060630 GGCCAATCCTCTTTTGTAGAAGG + Intronic
1002599210 5:180344783-180344805 GGCCCGGCCCCTCTTGTCGAGGG - Intronic
1002959935 6:1905216-1905238 GGCCTCACCCCTGGTGCCGAGGG + Intronic
1003590489 6:7432817-7432839 GGCCTCACCCCTTTTGGTGTGGG + Intergenic
1009544813 6:65008631-65008653 GTCCATACCCCTTATGTCAAGGG + Intronic
1017784036 6:157740190-157740212 GGTCAAACCCCTTTTGTGCAAGG + Intronic
1017882646 6:158572507-158572529 GGCCACACCCCTTTTGTCGATGG + Intronic
1019416050 7:926892-926914 GGCCAGGCCCCTTTTGAGGATGG + Intronic
1019666358 7:2253975-2253997 GCCCGAACCCCTTTTGTGGAAGG - Exonic
1023699608 7:42879392-42879414 GGCCTCACCCAATTTGTCAAAGG - Intergenic
1031484565 7:122311482-122311504 GGCCGGCCCCCTTTTGTTGATGG + Intergenic
1039596569 8:38795512-38795534 GGCCACATCCATTTTGTAGGTGG - Intronic
1050675954 9:8053399-8053421 GGCCACACCACTATTGTCATTGG - Intergenic
1053362084 9:37495583-37495605 GGGCAGACCACTTTTGTTGAAGG + Intronic
1056665792 9:88579638-88579660 GGCCACACACCTCTTTTCTAGGG + Intronic
1056766102 9:89445762-89445784 GGCCTCACCCAATCTGTCGAAGG - Intronic
1189946568 X:46186758-46186780 GTCCATGCCCCTTTTGTCAAAGG + Intergenic
1191254532 X:58274029-58274051 GGCCTCACCTCTTTTGTCCCAGG + Intergenic
1191255093 X:58276276-58276298 GGGCTCACCCCTTTTGTCCCAGG + Intergenic
1191255253 X:58276887-58276909 GGCCTCACCACTTTTGTCCCAGG + Intergenic
1198552412 X:137758738-137758760 GGCCAAACTGCTTTTGCCGATGG + Intergenic