ID: 1017882686

View in Genome Browser
Species Human (GRCh38)
Location 6:158572787-158572809
Sequence CGGCAAGGCAGCGTCCGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017882681_1017882686 7 Left 1017882681 6:158572757-158572779 CCCTGTCTGTGTAAATCACAGAA 0: 1
1: 0
2: 2
3: 26
4: 404
Right 1017882686 6:158572787-158572809 CGGCAAGGCAGCGTCCGTGTTGG No data
1017882680_1017882686 28 Left 1017882680 6:158572736-158572758 CCTGGGAGGGCGAGTGAGTTTCC 0: 1
1: 0
2: 4
3: 24
4: 365
Right 1017882686 6:158572787-158572809 CGGCAAGGCAGCGTCCGTGTTGG No data
1017882682_1017882686 6 Left 1017882682 6:158572758-158572780 CCTGTCTGTGTAAATCACAGAAA 0: 1
1: 0
2: 1
3: 23
4: 295
Right 1017882686 6:158572787-158572809 CGGCAAGGCAGCGTCCGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017882686 Original CRISPR CGGCAAGGCAGCGTCCGTGT TGG Intronic
No off target data available for this crispr