ID: 1017882750

View in Genome Browser
Species Human (GRCh38)
Location 6:158573092-158573114
Sequence CTGTGGCAGTGACCCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017882750 Original CRISPR CTGTGGCAGTGACCCCTGGG GGG Intronic
900391739 1:2436640-2436662 CTGTGGCTCTGTCTCCTGGGAGG + Intronic
900407133 1:2497720-2497742 CTTTGGCAGAGTCCCCTGGAGGG + Intronic
900636366 1:3667937-3667959 CAGTGGCCATGAGCCCTGGGGGG - Intronic
900804427 1:4757921-4757943 TTGTGGGAGGGACCCGTGGGAGG + Intronic
900896620 1:5487247-5487269 CTGAGGCACTGAGCCCTGGAGGG - Intergenic
902169712 1:14599576-14599598 CTGTGCCATTCACCCCTGCGGGG - Intronic
903451969 1:23459839-23459861 GTGTGGCAGAGATCACTGGGTGG + Intronic
905313955 1:37069257-37069279 CTGTAGCAGTGGCCCCTGCAGGG + Intergenic
905799693 1:40835184-40835206 CTGCAGCAGTGAGCCCTTGGGGG - Intronic
905851354 1:41277418-41277440 CTGGGGCAGGGGCCCGTGGGTGG + Intergenic
906292950 1:44631831-44631853 CGGTGGGAGGGACCCCGGGGAGG + Intronic
907471070 1:54673802-54673824 CTTTGTGAGTGGCCCCTGGGAGG + Exonic
909266861 1:73570801-73570823 GTGTGAGAGTGAGCCCTGGGAGG - Intergenic
910156513 1:84225317-84225339 CAGTGGCAGTGGCCCCAGGCAGG + Intronic
911358065 1:96845739-96845761 CTGTGGCTGTGACTGCTTGGTGG + Intergenic
911614427 1:99992933-99992955 CTGTGGCTGTAACCCCTAGTGGG + Intronic
913126111 1:115791904-115791926 CTGAAGCAGAGACTCCTGGGCGG + Intergenic
915139801 1:153760348-153760370 GTGTGGCAGTGATGGCTGGGTGG - Exonic
915934270 1:160081653-160081675 CGGCAGCAGAGACCCCTGGGGGG - Exonic
918043430 1:180926941-180926963 CTGTGCCTGTGAACCCTGGCAGG - Intronic
918050224 1:180967219-180967241 CTGTGACCGTGGCCCCTGGCGGG + Intergenic
918321976 1:183373109-183373131 CTGAGGCAGTCAGCCCTAGGTGG + Intronic
919796036 1:201322177-201322199 ATGAGGCAGTGGCTCCTGGGGGG - Intronic
919974300 1:202600758-202600780 CTGAGGGAGGGATCCCTGGGTGG + Intronic
921081096 1:211738863-211738885 CTGTGGCAGGAGCCCCTGGAAGG + Intergenic
921365837 1:214372783-214372805 GTGTGGCAGGGGCCCCTGGGTGG + Exonic
923793243 1:237128766-237128788 CTGTTGCAGTGATCCAGGGGAGG + Intronic
924518549 1:244786238-244786260 CTGTGGCTGTCAGCCCTGGCTGG + Intergenic
1063295567 10:4801769-4801791 CTGTGGCATGGTTCCCTGGGAGG + Intronic
1064304875 10:14156530-14156552 GGGTAGCAGTTACCCCTGGGAGG + Intronic
1064555139 10:16540485-16540507 CTGGGGCATTGTCCTCTGGGAGG + Intergenic
1067201486 10:44175851-44175873 TATTGACAGTGACCCCTGGGGGG + Intergenic
1067711271 10:48653120-48653142 ATGGAGCAGTGACTCCTGGGAGG + Intronic
1070111978 10:73495662-73495684 CTTGGGGAGTGGCCCCTGGGCGG - Intronic
1070188951 10:74093712-74093734 TTGCTGCAGTGAGCCCTGGGAGG + Intronic
1070671047 10:78377464-78377486 CTGTGGGATTAACTCCTGGGGGG - Intergenic
1071772445 10:88744212-88744234 GTATGGCAGTGACCACAGGGAGG - Intronic
1075400674 10:122159333-122159355 CTGGGACTGTGACACCTGGGTGG + Intronic
1076140329 10:128073365-128073387 GTGTGCCAGTGGCCCCTGGGTGG - Exonic
1076411445 10:130254495-130254517 CTGTGGCTGTGTCCCGTGGCCGG + Intergenic
1076531278 10:131146958-131146980 CTGAGGCAGTGACAGCTGGTGGG - Intronic
1077138775 11:1014400-1014422 CCGTGCCAGTGACCCCAGAGCGG + Intronic
1077538411 11:3135231-3135253 CTGGGCCAGTGTCCCCTTGGCGG - Intronic
1078341196 11:10498950-10498972 CCTTGGCTGGGACCCCTGGGGGG - Intronic
1078740280 11:14059736-14059758 CTGTGGCAGCGGCTGCTGGGGGG - Intronic
1078823812 11:14907442-14907464 CTGTGACAGTGACCCCAGCTGGG + Intronic
1080701482 11:34647978-34648000 CTGAGGCAGGGAGGCCTGGGAGG + Intronic
1082763752 11:57150167-57150189 CTGTGGCAGGGAGCACTGGGTGG + Intergenic
1082778653 11:57268915-57268937 CTGTGGGTGGGACCCCTGTGAGG - Intergenic
1083267812 11:61555094-61555116 CTGTGGCTGTGGGCACTGGGTGG - Intronic
1084399186 11:68933798-68933820 CTGTGGCAGCCACACCTGGGAGG - Exonic
1084711749 11:70847910-70847932 CTGTAGCCGTGAAGCCTGGGAGG - Intronic
1085390863 11:76181539-76181561 CTGGGGCAGGGAGCCCGGGGTGG - Intergenic
1086840186 11:91675477-91675499 CTGTGGGAGGGACCCATGGTTGG + Intergenic
1086986107 11:93251117-93251139 CTGGGGAAATGACCACTGGGTGG - Intergenic
1090506211 11:127318256-127318278 TTGTGGGAGGGACCCATGGGAGG - Intergenic
1090839463 11:130475728-130475750 CTGTGCCAGTGACCACTGTGGGG + Exonic
1093147170 12:15580725-15580747 TTCAGGCAGTGGCCCCTGGGTGG - Exonic
1094230679 12:28099437-28099459 TTGTGGGAGGGACCCCTGGTGGG - Intergenic
1101744927 12:107532237-107532259 CAGTGGCAGTGGGCCCTGGTTGG - Intronic
1101970133 12:109307217-109307239 GAGTTGCAGTGACCCCGGGGGGG + Intronic
1101987666 12:109460466-109460488 CGGTTGGAGTGACCCCTGAGAGG - Intronic
1103739441 12:123081438-123081460 TGGTGGCAGAGACCCCTGAGGGG + Intronic
1103812947 12:123630442-123630464 CTGTGGCAGTGTCCTCTGGCGGG - Exonic
1104706144 12:130948940-130948962 CTGAGTCAGAGACCCCAGGGTGG + Intergenic
1104897045 12:132169470-132169492 CCGTGGCAGGCACCCCAGGGCGG + Intergenic
1107412694 13:40172469-40172491 CCGTGGCAGTGGCCCTCGGGCGG - Intergenic
1107693848 13:42980602-42980624 TTGTGGGAGGGACCCATGGGAGG - Intronic
1111409448 13:87855048-87855070 CTGTGGCTCTTACCTCTGGGGGG - Intergenic
1112370361 13:98788200-98788222 CTGTGGCTGTGGCCCGGGGGTGG - Intergenic
1113718026 13:112528020-112528042 CTGTAGAAGTGACCCCTGTGTGG + Intronic
1116100328 14:40425565-40425587 TTGTGGAAGGGACCCATGGGAGG - Intergenic
1117468720 14:56020456-56020478 CTGTGGCAGTGAAATCTGGCTGG - Intergenic
1117819318 14:59631441-59631463 CTTTGGGATTGACCACTGGGGGG + Intronic
1120400561 14:84025479-84025501 CTGTGGCAGAATGCCCTGGGCGG + Intergenic
1121832329 14:97063134-97063156 CTGTGTCTGTCACACCTGGGGGG - Intergenic
1122189518 14:100029663-100029685 CTGTGGGAGTGAGCCTTGGAGGG + Intronic
1122523706 14:102364442-102364464 CTGAGGCAGTGACCTCAGGAAGG - Intronic
1122853326 14:104548247-104548269 AGTTGGCAGTGTCCCCTGGGTGG - Intronic
1124612665 15:31218708-31218730 CTGTGGCAGTGCCCAAGGGGAGG + Intergenic
1126698122 15:51342408-51342430 CTGTGCCACTGACCTGTGGGTGG + Intronic
1128385735 15:67147001-67147023 CTGTGGGAGGGGCCCCTGGCAGG - Intronic
1128389369 15:67172893-67172915 CTGTGGCTGTGGCTCCCGGGGGG + Intronic
1128757240 15:70191398-70191420 CTGTGGGAGTGAACTCTGGGAGG - Intergenic
1129108179 15:73323054-73323076 TTGTGGCAGGGGCCTCTGGGGGG - Exonic
1129467130 15:75730510-75730532 CTGTGGTAGTGCCCCCAGAGAGG + Intergenic
1130964456 15:88686525-88686547 CCCTGGCAGTGGCCACTGGGAGG - Intergenic
1131155523 15:90073003-90073025 CTCTGGCAGTGACCCTTTGTGGG - Intronic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1131927652 15:97403353-97403375 GTGTTGCAGTGTCCGCTGGGTGG + Intergenic
1132083252 15:98885165-98885187 CTCAGGCTGTGAGCCCTGGGAGG + Intronic
1132974898 16:2706312-2706334 GCATGGCAGTGACCTCTGGGAGG + Intronic
1134514280 16:14874109-14874131 CTGCTGCAGTGACCCCAGAGGGG - Intronic
1134779387 16:16881985-16882007 CACTGCCAGTGTCCCCTGGGAGG + Intergenic
1136396639 16:29996127-29996149 CTGTCCCAGTGTCCCCCGGGAGG + Exonic
1136924743 16:34361760-34361782 CTGTGGAGTTGAACCCTGGGAGG - Intergenic
1136979830 16:35050046-35050068 CTGTGGAGTTGAACCCTGGGAGG + Intergenic
1137564407 16:49524432-49524454 GTGTGGCAGTGACAGATGGGTGG + Intronic
1139132055 16:64158440-64158462 CTGTGTCCCAGACCCCTGGGGGG - Intergenic
1139571625 16:67816513-67816535 CTGCGGGAGTGACTCCAGGGAGG + Intronic
1141471482 16:84241511-84241533 CTGGGGCAGTGACAACGGGGAGG + Intergenic
1141624369 16:85253563-85253585 CTGGCACAGTGAGCCCTGGGAGG - Intergenic
1141698290 16:85630994-85631016 CTGCTGCAGTATCCCCTGGGGGG + Intronic
1141919898 16:87128635-87128657 CTGTGTGTGTGACCCCTTGGGGG - Intronic
1142225176 16:88873675-88873697 ATGTGTCAGGGAACCCTGGGCGG - Intergenic
1142276779 16:89122974-89122996 CTGTCGCAGAGGCCCCTGTGCGG - Intronic
1143519150 17:7435886-7435908 CTGGGGGAGTGCCCCCTGGTGGG + Exonic
1144828977 17:18121345-18121367 CTGTGGCAGAGCCCCAGGGGCGG - Exonic
1146774950 17:35605571-35605593 CTGTGACAGTTACCACTGTGGGG + Intronic
1148156032 17:45425687-45425709 CTGGGGCATTGGCCGCTGGGAGG - Intronic
1148765768 17:50037448-50037470 ATGTGGCTGTGTGCCCTGGGAGG + Intergenic
1148807677 17:50272435-50272457 CTGTTGCAGTGGGGCCTGGGTGG + Intronic
1150387698 17:64774296-64774318 CTGGGGCATTGGCCGCTGGGAGG - Intergenic
1151356179 17:73559953-73559975 CAGTGGCAGTCACCCCTGGGAGG + Intronic
1152033926 17:77860108-77860130 ATGTGGGCCTGACCCCTGGGAGG + Intergenic
1152514080 17:80811958-80811980 CTGTGGCTGTGTCCCACGGGTGG - Intronic
1152547535 17:81009328-81009350 CTGTGGAGGTGGCCCCTGTGGGG + Intronic
1153774361 18:8439695-8439717 GTGTGGCAGTGACTCTTTGGAGG + Intergenic
1155362201 18:25014815-25014837 CTGGGGCAGGCTCCCCTGGGTGG + Intergenic
1156204153 18:34867773-34867795 CTGTGGCAGTGCCCCCAAGGTGG + Intronic
1160107215 18:75989294-75989316 CTGTGCTAGAAACCCCTGGGAGG + Intergenic
1160849479 19:1183532-1183554 CTGTGGCTTTGTCCCCGGGGCGG + Intronic
1161577833 19:5064674-5064696 CTCTGGCAGTGGCCCCTGCCTGG - Intronic
1163547742 19:17949671-17949693 CAGGGCCAGGGACCCCTGGGGGG - Intergenic
1164609709 19:29623847-29623869 CTGTGGCAGAGGCCCCTGGCAGG + Intergenic
1165561629 19:36685401-36685423 ATGTGGCATTGACTTCTGGGTGG - Intergenic
1166413144 19:42570357-42570379 CTTTGGCATGGACCCCTGGTAGG - Intergenic
1166801605 19:45461104-45461126 TTGTGACTGTGACCTCTGGGAGG - Intronic
1167019672 19:46863746-46863768 CTGTGGCCATAACCCCTGGTGGG - Intergenic
1168260569 19:55191727-55191749 CTCCGGCAATGACCCCTGTGGGG + Exonic
925836563 2:7952256-7952278 CTGTGGCTGAGAGCCCTGTGAGG + Intergenic
926361128 2:12088576-12088598 CTGTGGCAAGGACCCTAGGGAGG + Intergenic
926979206 2:18549267-18549289 TTGTGGGAGGGACCCGTGGGAGG + Intergenic
927430031 2:23019656-23019678 CTGAGGCAGTGAGCACTGGGAGG - Intergenic
928209555 2:29313377-29313399 GAGTGGCAGTGTCCCCTTGGTGG + Intronic
929823452 2:45291583-45291605 CTGTGGGAGGGACCCAGGGGAGG + Intergenic
932217522 2:69976420-69976442 CTATGGAAGTGACTCCTGGTAGG - Intergenic
934657820 2:96125160-96125182 CCATGGCAGTCACCCCTCGGAGG + Intronic
935796981 2:106652384-106652406 CAGTGAAAATGACCCCTGGGAGG - Intergenic
936066052 2:109332937-109332959 CTGTGACAGTGAGACCTTGGTGG + Intronic
937331617 2:121034093-121034115 CTGATGCAGAGAGCCCTGGGAGG + Intergenic
937419484 2:121742026-121742048 GTCTGGCAGTGTCCCATGGGAGG + Intronic
937978060 2:127593491-127593513 GTGGGGCAGAGACCCCTCGGCGG - Intronic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
938646551 2:133336878-133336900 CTGTGGCAGTGAGACCCGGTAGG - Intronic
939454759 2:142419755-142419777 CTTTGGCAGTGTCCCTTGGATGG - Intergenic
940238554 2:151537880-151537902 CTGTGTCAGTGACTGCTCGGTGG + Exonic
944070017 2:195657640-195657662 GTGGGGGAGTGACCGCTGGGCGG + Intronic
945129151 2:206548359-206548381 GTGTGGCATTGAGCCTTGGGTGG + Intronic
946159767 2:217828948-217828970 CATTGCCAGTGTCCCCTGGGGGG - Intronic
947611219 2:231526183-231526205 CTGTGGCAGAGACCCAGGGAAGG - Intronic
948318800 2:237052595-237052617 CTGTTGCAGTTTCCACTGGGTGG - Intergenic
948647523 2:239416461-239416483 TTGTGGGAGGGACCCATGGGAGG + Intergenic
948946706 2:241224142-241224164 CTGCAGCAGTGACGCCTGGAAGG + Exonic
1168874292 20:1160121-1160143 CAGTGACAGTCACTCCTGGGTGG - Intronic
1171463230 20:25310395-25310417 CTGGGGGAGGGACCCTTGGGAGG - Intronic
1172872538 20:38144690-38144712 CTCTGCCACTAACCCCTGGGTGG - Intronic
1174628394 20:51935093-51935115 TGGGGGCAGTGAACCCTGGGAGG + Intergenic
1174840614 20:53898160-53898182 ATGTGGCAGAAAACCCTGGGAGG + Intergenic
1175184687 20:57172177-57172199 CTGTGCCAGTATCCCCTGGAAGG - Intronic
1175497094 20:59422811-59422833 CTCAGGCAGAGACCCCTGGAGGG - Intergenic
1175657144 20:60780833-60780855 CTGAGGCTGAGAACCCTGGGAGG - Intergenic
1176296283 21:5075218-5075240 CTGGAGCAGTGGCCCCCGGGTGG + Intergenic
1178691118 21:34751093-34751115 ATGCAGCAGAGACCCCTGGGTGG + Intergenic
1178976795 21:37227438-37227460 CTGTGGGTGTGTCCCCTGTGCGG + Intronic
1179780854 21:43700023-43700045 CTGTCACAGGGACCCCTGTGTGG + Intergenic
1179860766 21:44186903-44186925 CTGGAGCAGTGGCCCCCGGGTGG - Intergenic
1180721908 22:17915618-17915640 CTGTGGCAGTGACGACAGGCAGG - Intronic
1181303785 22:21902444-21902466 GTATGGGACTGACCCCTGGGTGG - Intergenic
1184043928 22:41960398-41960420 CTGGGGCAGTGTCCTGTGGGTGG + Intergenic
1184692998 22:46125813-46125835 ACCTGGCAGTGACCCCTGGGCGG + Intergenic
1185413642 22:50698324-50698346 TCTCGGCAGTGACCCCTGGGTGG + Intergenic
949658298 3:6247360-6247382 AGGTTGCAGTGAGCCCTGGGAGG + Intergenic
950118119 3:10464327-10464349 CTGGGCCTGTGTCCCCTGGGAGG - Intronic
950334138 3:12180424-12180446 CTTTGGCAGTGACGCCAGAGTGG + Intronic
953407871 3:42668546-42668568 CTGGGGCAGAGGCCTCTGGGTGG + Intergenic
954157376 3:48694013-48694035 CTGGGGCAGAGAGGCCTGGGAGG - Intronic
954307659 3:49738246-49738268 CAGTGGCAGTGACCACAAGGAGG - Exonic
957085419 3:75672380-75672402 CAATGGCAGTGGCCCCTGGCTGG + Intergenic
959943814 3:112106732-112106754 CTGTGGCAGTGACACATGGCAGG - Intronic
960999410 3:123363490-123363512 CTGTGGCATAGATTCCTGGGAGG - Intronic
961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG + Intronic
961039718 3:123669136-123669158 GTGAGGCAGTGATCCCTGGCAGG + Intronic
965420633 3:168454209-168454231 TTGTGGGAGAGACCACTGGGAGG - Intergenic
966919417 3:184602218-184602240 CGGTGTCGCTGACCCCTGGGCGG + Intronic
967036795 3:185654138-185654160 CTCTGGCTGTGACTCCTTGGTGG + Intronic
967538791 3:190640579-190640601 CTGTGGCAGGGAACACTTGGAGG + Intronic
968405625 4:337193-337215 CTGTGGCGGTGACCCCGGTGAGG - Intergenic
968511204 4:996715-996737 CTGAGGCAGAGACACGTGGGAGG - Intronic
968983996 4:3865566-3865588 CTGTGGCTGTGACAGCTGGGTGG + Intergenic
969673132 4:8600761-8600783 CTGCGGCTGTGGCTCCTGGGTGG + Intronic
973558873 4:52113839-52113861 CCTTTGCAGTGACCCCTGAGGGG + Intergenic
974782728 4:66574762-66574784 ATGAGGCACTGACCCATGGGTGG - Intergenic
980406424 4:132358261-132358283 CTGAGGCAATGAGCCTTGGGCGG + Intergenic
984925413 4:184802348-184802370 CTGCGGCAGTCAGCCCGGGGGGG + Intronic
985933909 5:3080117-3080139 CTGTGGCACTTACCCCTGGGTGG + Intergenic
986142892 5:5048503-5048525 CTAAAGGAGTGACCCCTGGGAGG + Intergenic
987317777 5:16740186-16740208 CTGAGGGAGTGACAGCTGGGAGG + Intronic
990149354 5:52799501-52799523 GTGTGGAATTTACCCCTGGGTGG - Intronic
991565391 5:67999135-67999157 ATGTGGCAGTGACTCAGGGGCGG - Intergenic
993431795 5:87841382-87841404 CAGTGGCTGTGACCCCTGGAAGG + Intergenic
995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG + Intergenic
996790746 5:127290688-127290710 CCGGGGCAGTGGCCGCTGGGGGG - Intergenic
997587794 5:135054000-135054022 CTGTGGTGGTGACCCCTGTGAGG + Intronic
999114418 5:149149953-149149975 CTGTGGCTGTGGCCCCAGGAAGG + Intronic
1000571998 5:162925884-162925906 TTGTGGGAGTGACCCAGGGGAGG - Intergenic
1002197686 5:177510088-177510110 GTGGGGCAGTGGCCCCTGGGGGG - Intronic
1002473046 5:179448699-179448721 CTGTGGGAAAGACCCCGGGGGGG - Intergenic
1002481178 5:179501955-179501977 CTGTGGGAAAGACCCCGGGGGGG + Intergenic
1004398314 6:15265866-15265888 ATGAGGCAGAGACCCCTGAGTGG - Intronic
1005003221 6:21263623-21263645 CTGTGGAAGTGACAACTTGGGGG + Intergenic
1005802946 6:29445550-29445572 CTGTGGGAGTGAGCTCTGGTTGG - Intronic
1005909364 6:30294572-30294594 CTGTGTCTGTGGCCCCTGGCAGG + Intergenic
1006264905 6:32912746-32912768 GTGTGGAAATGACCCCTGGTTGG - Intergenic
1006303418 6:33205852-33205874 GTGTTGCAATGAACCCTGGGAGG - Exonic
1006444938 6:34074867-34074889 CTGGGGTAGGGACCTCTGGGGGG - Intronic
1007926616 6:45654842-45654864 CTGTGGCTTTGACCCCTAAGGGG - Intronic
1009802297 6:68554072-68554094 CTGTGGCATTTATCCCAGGGAGG + Intergenic
1011696909 6:89921292-89921314 CTGTGGAAGTGAGCCCAGGCTGG - Intergenic
1012915252 6:105162959-105162981 CTCTGCCAGTGACCACTGTGTGG - Intronic
1016831306 6:148436157-148436179 AGGTGGCCGTGAACCCTGGGAGG + Intronic
1017882750 6:158573092-158573114 CTGTGGCAGTGACCCCTGGGGGG + Intronic
1018027101 6:159815232-159815254 CTGTGGTAGTAGCCCCTGAGTGG + Intronic
1018428354 6:163703261-163703283 CTGTGGAAGAGTCTCCTGGGAGG + Intergenic
1018576733 6:165267313-165267335 CTGTGTCACTGACTCCTGGATGG - Intergenic
1019725188 7:2598193-2598215 GTCTGGCAGTGCCTCCTGGGAGG - Intronic
1020101245 7:5395337-5395359 TATTGGCAGTGACCCCGGGGTGG - Intronic
1023248096 7:38228356-38228378 CTGTGGCAGTGACCACAGTCTGG - Intronic
1025262639 7:57430098-57430120 CTGTGGCAGGAGCCCCAGGGTGG - Intergenic
1025740033 7:64187624-64187646 CTGTGGCAGGAGCCCCAGGGTGG - Intronic
1025813558 7:64889972-64889994 CTGGGGCAGTGACCCCTGGTCGG - Intronic
1026948917 7:74334366-74334388 CTGGGCCTGTGACCCCTGGGAGG + Intronic
1029818930 7:103126570-103126592 CTGAGGAGGTGGCCCCTGGGAGG - Intronic
1031690867 7:124786144-124786166 CTGTGGGAGGGACCCATGGGAGG + Intronic
1035176586 7:157056313-157056335 TGGTGGCGGTGTCCCCTGGGAGG - Intergenic
1035295578 7:157865204-157865226 CTGTGGGGGTGGCCCCTGAGGGG + Intronic
1037210043 8:16375524-16375546 TTGTGGCAGTGAGCTCTGGAAGG - Intronic
1041521040 8:58756594-58756616 TTGTTGCAGTGTCCCCTGGAGGG - Intergenic
1041568529 8:59309086-59309108 CTGTGGCAGACACTCTTGGGTGG + Intergenic
1045482063 8:102600709-102600731 CTGTGGCAGGGACGGCAGGGCGG - Intergenic
1047356247 8:124124954-124124976 CTCTGGCAGGCACCTCTGGGAGG - Intergenic
1047813944 8:128442143-128442165 TTGTTGCAATGACCCCTGGGAGG + Intergenic
1048278240 8:133083960-133083982 CTGTGGCACTGTCCTCTGAGAGG + Intronic
1049143479 8:140979673-140979695 TTGTGGCAGGGACCGGTGGGAGG + Intronic
1049627736 8:143633587-143633609 CTGTGGCAGAGCTCCCTGTGGGG - Intergenic
1049709619 8:144057699-144057721 CTGTCACAGGGCCCCCTGGGAGG + Exonic
1050689332 9:8207697-8207719 CTGTATCAGGGAACCCTGGGTGG + Intergenic
1052684303 9:31734958-31734980 CAGTGGCAGTGACCCCTTGCAGG + Intergenic
1052816655 9:33107185-33107207 CTTTGGCAGTGTCCCCAGGCAGG - Intronic
1054376417 9:64453152-64453174 CTGAGGAAGTGACCTCTGGATGG + Intergenic
1056615732 9:88164037-88164059 CTGTGGGAGTGGCCTCAGGGAGG - Intergenic
1057301366 9:93886963-93886985 GTGAGGCAGTGAGCCCTGAGGGG + Intergenic
1061285702 9:129621234-129621256 CTGCCTCAGAGACCCCTGGGTGG + Intronic
1061647636 9:132018666-132018688 CTGTAGCAGGGACCCCAGGGAGG - Intronic
1061720693 9:132549295-132549317 CTGGTGCAGAGACCCTTGGGAGG - Intronic
1062048506 9:134435397-134435419 CTGGGGCAGGGACCAGTGGGGGG - Intronic
1062543400 9:137051448-137051470 CTTTGGCTGTGACCCCTTGCAGG - Intronic
1187098131 X:16167904-16167926 CTGTGGCACTGACTTCTGAGAGG + Intronic
1190113593 X:47611041-47611063 CTGAGGAAGTGACCACTGGGTGG - Intronic
1191030172 X:55961258-55961280 CTGTGGTGGTGAGGCCTGGGTGG - Intergenic
1195296255 X:103481100-103481122 CTGTGGTGCTGACCCCTGGGTGG + Intergenic
1195671159 X:107471203-107471225 CTGCGGCAGTGGCCTGTGGGAGG - Intergenic
1200734934 Y:6784033-6784055 GGGTCGCAGTGTCCCCTGGGTGG + Intergenic