ID: 1017883831

View in Genome Browser
Species Human (GRCh38)
Location 6:158582149-158582171
Sequence AAGAAAATAAAGCAATGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2154
Summary {0: 1, 1: 2, 2: 21, 3: 236, 4: 1894}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017883831_1017883833 7 Left 1017883831 6:158582149-158582171 CCTTTGCATTGCTTTATTTTCTT 0: 1
1: 2
2: 21
3: 236
4: 1894
Right 1017883833 6:158582179-158582201 TGGCGTGATGATCTGATTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1017883831_1017883835 21 Left 1017883831 6:158582149-158582171 CCTTTGCATTGCTTTATTTTCTT 0: 1
1: 2
2: 21
3: 236
4: 1894
Right 1017883835 6:158582193-158582215 GATTTGAGGAGGTGCCGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 59
1017883831_1017883836 22 Left 1017883831 6:158582149-158582171 CCTTTGCATTGCTTTATTTTCTT 0: 1
1: 2
2: 21
3: 236
4: 1894
Right 1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1017883831_1017883834 10 Left 1017883831 6:158582149-158582171 CCTTTGCATTGCTTTATTTTCTT 0: 1
1: 2
2: 21
3: 236
4: 1894
Right 1017883834 6:158582182-158582204 CGTGATGATCTGATTTGAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017883831 Original CRISPR AAGAAAATAAAGCAATGCAA AGG (reversed) Intronic