ID: 1017883836

View in Genome Browser
Species Human (GRCh38)
Location 6:158582194-158582216
Sequence ATTTGAGGAGGTGCCGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017883831_1017883836 22 Left 1017883831 6:158582149-158582171 CCTTTGCATTGCTTTATTTTCTT 0: 1
1: 2
2: 21
3: 236
4: 1894
Right 1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017883836 Original CRISPR ATTTGAGGAGGTGCCGCCGT GGG Intronic
901150587 1:7098688-7098710 ATGTGAGGAGTGGCCTCCGTGGG - Intronic
902304366 1:15525139-15525161 AGTCGCGGAGGTGCCGCCTTGGG - Intronic
907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG + Intronic
918381280 1:183958080-183958102 ATTTGGGGATGTGCTGCCTTCGG - Intronic
919650914 1:200148099-200148121 CTTTGAGAAGGTGCAGCAGTGGG - Intronic
923045894 1:230355408-230355430 ATTTGGAGAGGTGCCGCAGAAGG - Intronic
924690935 1:246349494-246349516 ATTTGAGGAGGTGCTGAGGAAGG + Intronic
1066449237 10:35512813-35512835 ATTTGAGGAGGTGTCGCGGGTGG + Intronic
1066458291 10:35590839-35590861 ATATGAGGAGGTGGGGCCTTTGG - Intergenic
1070394737 10:76002350-76002372 ATTTGAGGAGGTTGCGGGGTGGG + Intronic
1084965622 11:72742996-72743018 ATTTGAGGAGGTGCCCGAATGGG - Intronic
1085694737 11:78694534-78694556 ATTTGAGGTGGTGCCTCTGGTGG + Intronic
1091198088 11:133748895-133748917 ATGTTAGGAGGTGGGGCCGTTGG - Intergenic
1104463094 12:128970685-128970707 ATTTGAGGAGGTGCCAGCCGTGG - Intronic
1109013440 13:56978453-56978475 ATCTGAGGAGGTGAGGCCTTTGG + Intergenic
1113678732 13:112226969-112226991 ATTTGAGAAGGTGCCTGGGTTGG + Intergenic
1121321103 14:92992096-92992118 ATTCGAGGAGGTGCCGCTGAAGG - Intronic
1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG + Intronic
1136247894 16:28985716-28985738 ATCTGAGGATGTGCTGTCGTAGG - Exonic
1137935291 16:52629219-52629241 ATTTGAGGATCTGACTCCGTTGG - Intergenic
1146008539 17:29177510-29177532 AGTTGGGGAGGTGCCGAGGTAGG - Intronic
1146649125 17:34595853-34595875 ATTTGGGGAGGCGCCTCAGTAGG + Intronic
1163502736 19:17686426-17686448 ACTGGAGGAGGTTCCGACGTGGG - Intronic
1164293107 19:23885168-23885190 ATTCTAGGAGGTGCAGCCTTGGG + Intergenic
1165385170 19:35506142-35506164 AGTGGAGGAGGTGACGCTGTTGG - Intronic
1167430495 19:49451484-49451506 ATTTGAGGAGCTGCTGCTGCAGG - Exonic
925409129 2:3628629-3628651 ATTCGAGGAGGTGGTGCGGTTGG + Intronic
1171176201 20:23052076-23052098 ATATGAGGAGGTGCAGATGTTGG + Intergenic
1174750132 20:53103836-53103858 ACTTGAGGAGCTGCCGCAGGTGG + Intronic
1178992647 21:37367737-37367759 ATTTTAGGAGGAGGCGCCGCGGG + Intronic
949315993 3:2756263-2756285 ATATGAGGAGGTGGGGCCTTTGG + Intronic
953980364 3:47410379-47410401 AATTGAGGAGGTGGGGCCGAGGG - Exonic
961314522 3:126025572-126025594 AGGTGAGGAGGTGGCGCCTTTGG + Intronic
968751892 4:2394385-2394407 ATTGGAGCAGGTGTGGCCGTGGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
996746003 5:126846504-126846526 ATTTTAGGAGGTGCCACCAGAGG + Intergenic
1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG + Intronic
1003852794 6:10242219-10242241 GTTTGAGGAGGTGGAGCCTTTGG - Intergenic
1013958215 6:115865800-115865822 ATTTGAGGAGGAGCTGCCCTGGG - Intergenic
1015434378 6:133168917-133168939 ATTTGAGGAGAGCCAGCCGTAGG + Intergenic
1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG + Intronic
1019170966 6:170133015-170133037 ATTTGGGCAGGTGCCTCAGTGGG + Intergenic
1022284832 7:28946579-28946601 ATTTTAGGAGGTGGGGCCTTTGG + Intergenic
1030138729 7:106284643-106284665 AGGTGAGGAGGCGCCGCAGTGGG - Intronic
1033601062 7:142888742-142888764 ATGTCAGGAGGTGCTGCCCTGGG - Intergenic
1033614908 7:143004715-143004737 ATTTGAGGAGGTACCACTTTTGG - Intergenic
1034434645 7:151057561-151057583 ATTTCAGGAAGTGTCGCGGTTGG + Intronic
1048199214 8:132357812-132357834 ATTGGAGGAGGAGCAGCCATAGG - Intronic
1059474916 9:114538726-114538748 ATATGAGGAGGTGAGGCCTTTGG + Intergenic
1185677039 X:1857542-1857564 ATATGAGGAGGTGGGGCCCTTGG - Intergenic
1188007071 X:25022836-25022858 AGAAGAGGAGGTGACGCCGTCGG - Intergenic