ID: 1017883836

View in Genome Browser
Species Human (GRCh38)
Location 6:158582194-158582216
Sequence ATTTGAGGAGGTGCCGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017883831_1017883836 22 Left 1017883831 6:158582149-158582171 CCTTTGCATTGCTTTATTTTCTT 0: 1
1: 2
2: 21
3: 236
4: 1894
Right 1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017883836 Original CRISPR ATTTGAGGAGGTGCCGCCGT GGG Intronic