ID: 1017885028

View in Genome Browser
Species Human (GRCh38)
Location 6:158591843-158591865
Sequence ACATAGATACAAAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017885028_1017885031 8 Left 1017885028 6:158591843-158591865 CCTTCCATCTTTTGTATCTATGT 0: 1
1: 0
2: 1
3: 38
4: 423
Right 1017885031 6:158591874-158591896 AAAGTTGTTCCTGAAGAATTTGG 0: 1
1: 0
2: 3
3: 14
4: 284
1017885028_1017885033 21 Left 1017885028 6:158591843-158591865 CCTTCCATCTTTTGTATCTATGT 0: 1
1: 0
2: 1
3: 38
4: 423
Right 1017885033 6:158591887-158591909 AAGAATTTGGTACATATGTTAGG No data
1017885028_1017885034 30 Left 1017885028 6:158591843-158591865 CCTTCCATCTTTTGTATCTATGT 0: 1
1: 0
2: 1
3: 38
4: 423
Right 1017885034 6:158591896-158591918 GTACATATGTTAGGTGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017885028 Original CRISPR ACATAGATACAAAAGATGGA AGG (reversed) Intronic
903640336 1:24855382-24855404 CCATAGATACAATAGATAGATGG - Intergenic
904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG + Intergenic
905883179 1:41477546-41477568 ACATAGAAAGAAAATAGGGAGGG - Intergenic
906447953 1:45919853-45919875 GCATGGATACAAAAGAAGAATGG - Intronic
907629164 1:56062585-56062607 AAATTGATCCAAAACATGGAGGG + Intergenic
907851522 1:58259610-58259632 AGATACATCCAAAAGATGTAGGG + Intronic
907866293 1:58402494-58402516 AAAAAGAAACAAGAGATGGAGGG + Intronic
908043288 1:60139748-60139770 ACATTGATATAAAGGAAGGATGG - Intergenic
908201054 1:61796113-61796135 ACATAGAAACAAATGCTGGGTGG + Intronic
908860330 1:68478951-68478973 ACACAGAAATAAGAGATGGAGGG + Intronic
908975914 1:69898183-69898205 ACATAGACAGAAAATAAGGAAGG + Intronic
909003574 1:70248605-70248627 AAAGAGATAGAAAAGATGGAAGG + Intronic
909135232 1:71790517-71790539 ACATAAATATAAAAAATGCAAGG + Intronic
909492327 1:76239194-76239216 ACATGGAGAGAAAAGATAGAAGG + Intronic
909699372 1:78504684-78504706 ACATAAATACAAATGATGAATGG - Intronic
909970593 1:81982154-81982176 ACTGAGATACAAAAGATGACTGG - Intronic
910011975 1:82475575-82475597 ACATTGAAACACAACATGGAAGG + Intergenic
911456586 1:98131819-98131841 ACATAGATACAAAGTATTGCTGG - Intergenic
911493204 1:98595082-98595104 ACAGAGATACAGTAGAAGGATGG - Intergenic
911768615 1:101710633-101710655 AGATAGATAGATTAGATGGATGG - Intergenic
912413582 1:109493889-109493911 ACACAGATACAAATGAAGGTGGG + Intergenic
912567623 1:110599635-110599657 ACAAAGCTGCAAAGGATGGAAGG + Intronic
912600396 1:110926025-110926047 AAATAGATAAATATGATGGATGG + Intergenic
912985642 1:114426906-114426928 ATATAAATTTAAAAGATGGAGGG + Intronic
913962213 1:143349132-143349154 ACACAGATACAAAGGAAAGATGG + Intergenic
914056569 1:144174706-144174728 ACACAGATACAAAGGAAAGATGG + Intergenic
914122577 1:144791656-144791678 ACACAGATACAAAGGAAAGATGG - Intergenic
915010923 1:152685808-152685830 ACACGAATACAAAAGATGCAGGG + Intergenic
915750264 1:158201075-158201097 ACTCAGATATAAAAGAAGGATGG + Intergenic
915790532 1:158665223-158665245 ACAGAGTTTCAAAGGATGGAAGG - Intronic
916839174 1:168582495-168582517 ACAAAGTCACAAAAGATGAATGG + Intergenic
917190745 1:172415930-172415952 ACATAGAGCCAAAAGAATGAGGG + Intronic
918204173 1:182294495-182294517 GCACAGGTAGAAAAGATGGAAGG - Intergenic
918292180 1:183119482-183119504 ATATAGATGGAAAAGAAGGATGG + Intronic
918609908 1:186477265-186477287 ATATAGATAGAAAAAATGAATGG - Intergenic
919567459 1:199206853-199206875 GCAGAGATGCAGAAGATGGAAGG + Intergenic
920755545 1:208727628-208727650 AGATAGATAGAATGGATGGATGG + Intergenic
921143788 1:212331565-212331587 ACATAAATACTAAATATTGATGG + Intronic
921196010 1:212759061-212759083 ATATACATACAAAAGAATGAAGG + Intronic
921290256 1:213650535-213650557 ACATAGATGCAAATGCTGAAAGG - Intergenic
921802091 1:219413136-219413158 ACAAAGAAAAAAAAAATGGAAGG + Intergenic
922140430 1:222879610-222879632 ACATAAATAAAAAAGATGTAAGG + Intronic
922737155 1:227993038-227993060 ACATATATACAAATGTTGGCTGG + Intergenic
922968235 1:229710535-229710557 ACAGAGATATAAAAAATTGATGG - Intergenic
924354347 1:243154449-243154471 GGAAAGATACAAAATATGGAAGG - Intronic
1063517100 10:6707306-6707328 AGATAGATAGAGATGATGGATGG - Intergenic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1065326996 10:24558141-24558163 CCAAAGATAGAAACGATGGAAGG - Intergenic
1065333532 10:24630234-24630256 AACTATATACAAAAGAGGGACGG + Intronic
1066288426 10:33991221-33991243 ACATAGATTGGATAGATGGATGG - Intergenic
1068655694 10:59573902-59573924 AGAAAGATAAAAAAGAAGGAAGG + Intergenic
1070872342 10:79767403-79767425 ATATAGATATAAAAGATACAAGG - Intergenic
1070896672 10:79988751-79988773 ACATAGATAAAATAAAGGGATGG + Intergenic
1071639263 10:87289574-87289596 ATATAGATATAAAAGATACAAGG - Intergenic
1071655974 10:87448375-87448397 ATATAGATATAAAAGATACAAGG + Intergenic
1072342937 10:94472909-94472931 GCATAGATATAGTAGATGGAAGG + Intronic
1072966481 10:99977891-99977913 ACATAGATAGACAAGCTGGAAGG - Intronic
1073175959 10:101557901-101557923 CCATAGATCTAAAAGAAGGATGG - Intergenic
1073708452 10:106013428-106013450 ACATAAATATAAAAGAGGCAGGG - Intergenic
1075150156 10:119921835-119921857 ATAGAAATTCAAAAGATGGAAGG - Intronic
1075906413 10:126085637-126085659 ACAGACAGACAAAGGATGGATGG - Intronic
1076664699 10:132079772-132079794 TCATAGAAACAGAAAATGGAAGG - Intergenic
1076666141 10:132093912-132093934 AAATAGATACAAGAAATGAAGGG - Intergenic
1077964968 11:7120156-7120178 GTGTACATACAAAAGATGGAGGG - Intergenic
1078118753 11:8483421-8483443 GAATAGGCACAAAAGATGGATGG + Intronic
1080097133 11:28422167-28422189 ACATTGATAAAAGAAATGGAAGG + Intergenic
1081127208 11:39336044-39336066 ACACTGATAAAAAAGAAGGAAGG + Intergenic
1081552117 11:44123301-44123323 ACAAACAAACAAAAAATGGATGG + Intronic
1082992738 11:59222206-59222228 ACATAGATATAGAAGCTGGGTGG + Intergenic
1085151541 11:74256367-74256389 ACAAGGATACAAAGGATGAATGG - Intronic
1085780726 11:79406182-79406204 GCAGAAATCCAAAAGATGGAAGG - Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1086561369 11:88173498-88173520 ACATAAACAGAAGAGATGGAAGG - Intronic
1087435630 11:98113464-98113486 TCATGGAGACAAAAGATGAAGGG - Intergenic
1087514822 11:99144978-99145000 ACATAAATACAAAAGAGACATGG - Intronic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089797191 11:120990494-120990516 CCCTAGATACAGATGATGGAGGG - Intergenic
1090159118 11:124472669-124472691 TCAGAGATAAAGAAGATGGAGGG + Intergenic
1090470537 11:126977215-126977237 AAAAAGGTACAAAAGATGGCAGG - Intronic
1091104464 11:132905582-132905604 AGATAGTTCCCAAAGATGGAAGG + Intronic
1092553765 12:9532462-9532484 ACATAGCTAATACAGATGGAGGG + Intergenic
1092600850 12:10062397-10062419 ATATAGTCACAAAAGAAGGATGG - Intronic
1093204824 12:16235346-16235368 ACAGAGAAACAAAAGATAGAAGG - Intronic
1095296004 12:40528217-40528239 ACATAAATAGAAAAGATTTAGGG - Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095881981 12:47147562-47147584 AAATAGAAATAAAATATGGATGG - Intronic
1096371559 12:51073243-51073265 ACATACATACATAAAATTGAGGG + Intronic
1096379094 12:51140413-51140435 AGAAAGATAGAAAAGAAGGAAGG - Intronic
1096585964 12:52619889-52619911 ACAGAAATAGAAAAGAAGGATGG - Intergenic
1097411610 12:59261060-59261082 ACCTAGAAACAAATGATGGGGGG + Intergenic
1097912313 12:64983789-64983811 ACATAGATGCATAAGAAAGAAGG - Intergenic
1098194818 12:67988418-67988440 ACACACATATAAAAGAGGGAGGG + Intergenic
1098569293 12:71970669-71970691 ACAAAAATAGAAAAGATGTAAGG - Intronic
1099963692 12:89422023-89422045 AAAAAGATACAAAAGAATGAAGG - Intronic
1101619492 12:106371066-106371088 ACATAAATTCATAAGATTGAGGG + Intronic
1104073242 12:125365962-125365984 ACAAAAATACAGTAGATGGAAGG - Intronic
1104250764 12:127091350-127091372 AGATAGATACAAACAATAGATGG - Intergenic
1106755994 13:32823203-32823225 TCCTAGATACAAAAGAACGAAGG - Intergenic
1107143937 13:37036674-37036696 AAAGAGATAAAGAAGATGGAAGG - Intronic
1107839677 13:44443390-44443412 TCAGACATACAAAAGCTGGAAGG + Intronic
1108758665 13:53534827-53534849 AGATAGATATAAAAGAAGGGAGG - Intergenic
1108883562 13:55151247-55151269 GGAAAGATACAAAAGAAGGAAGG + Intergenic
1108931129 13:55821626-55821648 ACATTGAAACAAAAAATTGAAGG - Intergenic
1108935723 13:55878110-55878132 AAATAATTACAAAAGATTGATGG - Intergenic
1109239386 13:59865612-59865634 TCAAATAAACAAAAGATGGATGG + Intronic
1109388264 13:61661791-61661813 CCACTGAAACAAAAGATGGAAGG + Intergenic
1109484689 13:63002815-63002837 AAAAAGATACAAAATATGAATGG + Intergenic
1110134412 13:72047812-72047834 ACACAGATACAAAGGAAAGAAGG - Intergenic
1110444969 13:75570042-75570064 AGAAAGAAAGAAAAGATGGAAGG - Intronic
1110747343 13:79069849-79069871 ACCTAGATTCAAAAGAAGGAAGG + Intergenic
1111565389 13:90007682-90007704 ACAAACAAACAAAGGATGGAAGG + Intergenic
1111669353 13:91309259-91309281 AAAAAGATAAAAAAGATGAAAGG + Intergenic
1111914841 13:94350117-94350139 TCAAAGATACCAAAGATGAAAGG - Intronic
1112138296 13:96608901-96608923 ACACACACACAAAAGATGTATGG - Intronic
1112510328 13:100003163-100003185 ACATAAAGAAAAAAGAAGGATGG - Intergenic
1112902147 13:104370008-104370030 ACATGGAAACAAAAGATGGTAGG - Intergenic
1113069463 13:106406467-106406489 ACAATGATGAAAAAGATGGATGG + Intergenic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1115146716 14:30235304-30235326 AGATAGATACAAAAGTTGCTTGG + Intergenic
1115725099 14:36205646-36205668 ACAGAGATAAAAAAGAGAGAGGG - Intergenic
1117171164 14:53099044-53099066 ACAGAGATACAAAAAACAGATGG - Intronic
1117575144 14:57090514-57090536 AAATAGAAAGGAAAGATGGAAGG - Intergenic
1117736898 14:58776891-58776913 ACATGGATACAAAATAGGGAAGG + Intergenic
1118281393 14:64431996-64432018 ATATACATAGCAAAGATGGATGG + Intronic
1119081159 14:71695327-71695349 ATATAAATGCAAAAGAGGGATGG + Intronic
1119576145 14:75724163-75724185 GCAGAGATCCATAAGATGGAAGG - Intronic
1120029170 14:79620878-79620900 AGATAGAGACAAAAGTTGAAGGG + Intronic
1120113395 14:80584445-80584467 ACATGGATGTAAAATATGGATGG - Intronic
1120382078 14:83793418-83793440 ACATAGATACAAAAAAAGTGGGG - Intergenic
1120670226 14:87354480-87354502 ACATACATGCCAAAGATGGCTGG + Intergenic
1121790709 14:96697591-96697613 ACACAGGAACACAAGATGGAAGG - Intergenic
1122252830 14:100452207-100452229 GCATAGATAGAATAAATGGATGG - Intronic
1202829345 14_GL000009v2_random:9678-9700 AAATAAATAAAAAAGATGGCTGG - Intergenic
1125104710 15:35957095-35957117 ACATAGGTATAATAGATGAAAGG - Intergenic
1125620022 15:41052232-41052254 ACATAGATACAACTGAGAGAAGG - Intronic
1126080936 15:44960911-44960933 ATATAGATATAAATGAAGGATGG - Intronic
1126930360 15:53641925-53641947 AAACAGAAAAAAAAGATGGAAGG - Intronic
1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG + Intronic
1131925444 15:97378287-97378309 ACATAGAAGCAGAAGATAGAAGG + Intergenic
1132126265 15:99227911-99227933 ACATAGATGCAAAACACGAAGGG - Intronic
1132401443 15:101509621-101509643 ACACAGAGAAAAAAAATGGAAGG - Intronic
1132451354 15:101970348-101970370 ATATAAATACAGAAGGTGGAGGG - Intergenic
1133664876 16:7956893-7956915 ACATGGATACAAAGAAAGGATGG + Intergenic
1133976436 16:10602474-10602496 ACATAGCTAGAAATGGTGGAGGG - Intergenic
1134425716 16:14142228-14142250 AAAAAGAAAGAAAAGATGGAAGG - Intronic
1135585995 16:23671458-23671480 CCATAGATACAAAACAAGGAAGG - Exonic
1135855127 16:26002678-26002700 AGATAGAGAAAAAAGAAGGAAGG + Intronic
1135994100 16:27235485-27235507 ACAAACAGACAACAGATGGAGGG + Intronic
1136910111 16:34137714-34137736 TCATAGATACAAATGATATAGGG + Intergenic
1136985900 16:35104338-35104360 ACCTAGATACCCAAGATGGGAGG + Intergenic
1137039153 16:35593614-35593636 ACATAGAGAAAATAGATGGAAGG + Intergenic
1138853140 16:60654755-60654777 TTATAGCTACAAAAGAAGGATGG + Intergenic
1140100138 16:71908983-71909005 AAATAGAAACAAAAGATGTAAGG - Intronic
1140635722 16:76910900-76910922 AAATTTATACAAAACATGGATGG - Intergenic
1140774343 16:78236316-78236338 ACATACTTACAAAGGATGGTGGG + Intronic
1141052033 16:80776548-80776570 ATATATAAATAAAAGATGGATGG - Intronic
1141220647 16:82066269-82066291 ACATGGAGACATAAGAAGGAAGG + Intronic
1143413503 17:6727437-6727459 ATATATATATAAAACATGGACGG - Intergenic
1143794820 17:9327978-9328000 AGAGAGAGACAAAAGAAGGAAGG - Intronic
1143799655 17:9368201-9368223 ACATAGAAAGAAAACATTGATGG + Intronic
1144030847 17:11321664-11321686 ACAAAGAAACAAAAAACGGAGGG - Intronic
1144139544 17:12335777-12335799 AAAGTGATACAAAAAATGGAGGG - Intergenic
1146442499 17:32909542-32909564 AGATAGATACAAATTTTGGAAGG + Intergenic
1148620300 17:49029593-49029615 ACATTGATACAGGAGAAGGAAGG + Intronic
1149382196 17:56105477-56105499 AAAAAGATACAAAGGAAGGATGG - Intergenic
1149618841 17:58025680-58025702 ACATATGTATAAAAGATAGATGG - Intergenic
1150510897 17:65752058-65752080 ACATATAGACAGATGATGGATGG - Intronic
1152434681 17:80268708-80268730 GGATAGATAGATAAGATGGATGG - Intronic
1152434806 17:80269672-80269694 ACATAGATAGAACAGATGAATGG - Intronic
1152483034 17:80568746-80568768 ACAGAGGAAAAAAAGATGGAGGG - Intronic
1153708495 18:7772497-7772519 AAATAGAAAAAAAAGAAGGAAGG - Intronic
1155425419 18:25701816-25701838 AATTAGATACAAGAGATGGGTGG - Intergenic
1155523792 18:26696177-26696199 GCATAGATACAAAAAAGGGAGGG + Intergenic
1156300086 18:35828732-35828754 ACTTAGACATCAAAGATGGAGGG + Intergenic
1157023818 18:43818724-43818746 AAATAAATACAAACAATGGAGGG - Intergenic
1157130475 18:45002560-45002582 ATATAAATATAAAAGATCGAGGG - Intronic
1158050518 18:53212410-53212432 AGATAGATACAATAGATGCTAGG - Intronic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1158268854 18:55690381-55690403 AGATAGATATATTAGATGGATGG - Intergenic
1158745159 18:60191243-60191265 ACAGAGATACAAGGGAGGGAGGG - Intergenic
1159157915 18:64608296-64608318 ACATAAATAAAAAAGAGCGAAGG - Intergenic
1159376744 18:67603234-67603256 AGACAGACACAAAAGAAGGATGG + Intergenic
1160128751 18:76205194-76205216 AAATAGAAACAAAAGAAAGAGGG + Intergenic
1164141374 19:22468272-22468294 TCATAGAAACAAAACATGGAAGG - Intronic
1164833172 19:31338806-31338828 AGAAAGAAAAAAAAGATGGAGGG - Intronic
1202643347 1_KI270706v1_random:118104-118126 AAATAAATAAAAAAGATGGCTGG + Intergenic
1202696050 1_KI270712v1_random:127391-127413 ACACAGATACAAAGGAAAGATGG + Intergenic
925021322 2:571156-571178 ACATTGATACAAGAAATTGAAGG + Intergenic
925767508 2:7250993-7251015 AAATGGCTATAAAAGATGGAAGG + Intergenic
928177507 2:29044912-29044934 AGATAGATAATAGAGATGGATGG - Intronic
928227604 2:29466283-29466305 ACATAGAAACAATAGATGACGGG - Intronic
928581346 2:32710815-32710837 ACATAGATTTAAAAGAAGGCTGG + Intronic
929291283 2:40194873-40194895 ACAAAGCCACCAAAGATGGAAGG + Intronic
930483686 2:51984627-51984649 ACAGTGATAGAAAAGAGGGATGG - Intergenic
930979926 2:57511189-57511211 GGATAGATATAAAAGATAGAAGG + Intergenic
931113709 2:59141517-59141539 ACATATATAAAAAAGATGTATGG - Intergenic
931952445 2:67380408-67380430 ACAAAGTAACAAAAGATGGAAGG + Intergenic
934277218 2:91584427-91584449 ACACAGATACAAAGGAAAGATGG + Intergenic
935375121 2:102387810-102387832 AGAGAGATACATGAGATGGAGGG + Intronic
937227869 2:120379987-120380009 TCAGAAATACAAAAAATGGAAGG + Intergenic
937446287 2:121961459-121961481 ACATGGTTAAAAAAAATGGAAGG + Intergenic
938870706 2:135473185-135473207 TCATAGAAACAGAAAATGGAAGG - Intronic
939682856 2:145160224-145160246 ACATAGATGCAAATGATGGCAGG + Intergenic
939762882 2:146206143-146206165 AAATAGATAAAAAAGAAAGAAGG + Intergenic
940419739 2:153466086-153466108 ACAGAGATACAAAAATTAGATGG - Intergenic
940445481 2:153771859-153771881 ACACAGATGCAAGAGAAGGATGG + Intergenic
940635780 2:156294782-156294804 ACAGACAAACAAAAGATGGATGG - Intergenic
941196435 2:162458563-162458585 ACAAAGATAAAGAAAATGGAGGG - Intronic
941323128 2:164080460-164080482 AGCTAGAGACAAAAGAGGGAGGG - Intergenic
942201003 2:173571273-173571295 AAATAAAGACAAAAGAGGGAGGG + Intergenic
943332973 2:186582563-186582585 ACATAGAGACAAAAAATTAAAGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944988867 2:205211312-205211334 CCATACATACAATAGATGTATGG + Intronic
945404757 2:209431817-209431839 ACATGGATATAAAAGAGGGAGGG + Intronic
945693216 2:213068482-213068504 AGATAGATACCATAGATTGAAGG - Intronic
945793964 2:214338578-214338600 AGAGAGAAACAAAAGATAGAAGG - Intronic
946784742 2:223231165-223231187 AAAAAGATACCAAAGATTGAAGG - Intergenic
947671131 2:231936105-231936127 AGAAAGAAACAAAAGAAGGAAGG - Intergenic
948350387 2:237335424-237335446 AATTAGATACAAAAGGTAGATGG - Intronic
948842397 2:240659910-240659932 ACAAATAGACAAAAGATGAATGG - Intergenic
1169684470 20:8255329-8255351 ACACAGATACAAACACTGGATGG + Intronic
1169685072 20:8262028-8262050 ACATAAAAACAAAAAATGAAGGG - Intronic
1169810329 20:9603325-9603347 ACACAGATAAAGAAAATGGATGG - Intronic
1169892368 20:10466872-10466894 ACATTGATAGTAAAGATGCAGGG - Intronic
1170340191 20:15317472-15317494 AGATAGATAGATTAGATGGATGG - Intronic
1171024724 20:21619396-21619418 ACAAAGATAAAAAAAATGGGGGG - Intergenic
1171147839 20:22801307-22801329 AAATAAATACAAAAAATGGATGG - Intergenic
1171378525 20:24714049-24714071 AAAAAGATACAGAATATGGATGG - Intergenic
1172184193 20:33021168-33021190 ACAGACAGACAACAGATGGATGG - Intronic
1172782729 20:37446837-37446859 AGATGGATAGAAATGATGGATGG - Intergenic
1173198169 20:40933002-40933024 ACAGAGATAGAAAAGAGGGAGGG + Intergenic
1173687365 20:44933017-44933039 ACAGAGAGAGAAAAGTTGGATGG - Intronic
1175155759 20:56970361-56970383 ACAAAGATACAAAAGTTAGCCGG - Intergenic
1176608529 21:8854518-8854540 AAATAAATAAAAAAGATGGCTGG - Intergenic
1177474286 21:21598464-21598486 ACATAGAATCAAAATTTGGATGG - Intergenic
1177865381 21:26506727-26506749 AAACAGGTACAAAAGATGCATGG + Intronic
1177955096 21:27588421-27588443 AGAAAGGAACAAAAGATGGAAGG + Intergenic
1178136190 21:29630168-29630190 AGATAGATAAATAAAATGGAGGG + Intronic
1180017841 21:45098798-45098820 ACAAATATACACAAGATTGAAGG - Intronic
1180358614 22:11864333-11864355 AAATAAATAAAAAAGATGGCTGG - Intergenic
1180379652 22:12127998-12128020 AAATAAATAAAAAAGATGGCTGG + Intergenic
1182344092 22:29647967-29647989 ACATACATACAAAAAATAGCTGG + Intronic
1184898517 22:47427191-47427213 TGACAGATGCAAAAGATGGATGG + Intergenic
949175070 3:1051625-1051647 GCCTAGCTACAAAAGATGAAAGG - Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
952179197 3:30900272-30900294 TCATAGAAACAAAAGTGGGAAGG + Intergenic
952972958 3:38666241-38666263 AAATAAATAAAAAAGATGGTAGG + Intergenic
953988224 3:47462206-47462228 AGGAAGATAAAAAAGATGGATGG - Intronic
954931957 3:54291078-54291100 ACCTACATACACAGGATGGATGG + Intronic
955723225 3:61905417-61905439 AGATAGTGTCAAAAGATGGAAGG - Intronic
956750941 3:72343530-72343552 ACAGAGAGATAGAAGATGGATGG - Intergenic
956896135 3:73662103-73662125 ACATATCTCCAAATGATGGAAGG - Intergenic
957235376 3:77582261-77582283 ACAAAGATACAAAAGTTAGCCGG - Intronic
957312254 3:78535776-78535798 ACATACACCCAAAAGAGGGATGG - Intergenic
957578646 3:82041925-82041947 ACATTGAAAAAATAGATGGATGG + Intergenic
957693565 3:83602807-83602829 ACACAGATACAAAAGAGGATAGG - Intergenic
959459498 3:106607389-106607411 ACACAGATACAAAACATATACGG + Intergenic
959931169 3:111984766-111984788 TCATAGAGACACAAGATAGAAGG + Intronic
960741130 3:120835219-120835241 ACATATAAAGAAAGGATGGAAGG - Intergenic
960743348 3:120858886-120858908 ACATAGTTACACAACATGGGGGG - Intergenic
962143999 3:132820979-132821001 CCATCCAAACAAAAGATGGAAGG - Intergenic
964209779 3:154214065-154214087 ACACACATGCAAAAGAGGGAAGG + Intronic
964865123 3:161249539-161249561 ACATGGATACAGATGATGAAAGG + Exonic
965377475 3:167943299-167943321 ACACAAATACAAAGGCTGGAAGG + Intergenic
965820190 3:172677299-172677321 ACATAAACACAAAAGATACAAGG + Intronic
966029723 3:175330981-175331003 ACATAAATACAAAAGATCAGGGG + Intronic
966302048 3:178490027-178490049 ACATAGTTACTAAAGGAGGAAGG - Intronic
966439762 3:179930785-179930807 ACAGAGATAAAAATGATGAAAGG - Intronic
966690642 3:182737990-182738012 CCACAGATAGAAAAGAGGGAAGG - Intergenic
966842011 3:184097515-184097537 ACTTAGACAAAGAAGATGGAAGG + Intronic
967077321 3:186015171-186015193 ACATTGACATAAATGATGGAAGG - Intergenic
967114698 3:186326549-186326571 AGATAGTTAAAAAATATGGAAGG - Intronic
969637672 4:8378654-8378676 CAGTAGATACAAAAGATGGGTGG - Intronic
970042679 4:11813549-11813571 AAATAGAGAAAAAGGATGGAAGG - Intergenic
970116706 4:12705232-12705254 AAATAGATACAGAAGCTGGCAGG - Intergenic
970321616 4:14880581-14880603 AGAAAGATACAAAGGCTGGAAGG - Intergenic
971672970 4:29587939-29587961 ACAAAATTACAAAACATGGAAGG + Intergenic
972157981 4:36188587-36188609 ACATAGAGTCAAAAGATAGGAGG + Intronic
972753614 4:42020213-42020235 ATATAGAGACAAAAGCTAGATGG + Intronic
972969823 4:44559610-44559632 TAATAGAGACTAAAGATGGAAGG + Intergenic
973257451 4:48127809-48127831 ACACAAATACCAAAGATGGGAGG - Intronic
974504818 4:62755765-62755787 AGATAGATACATAAAATAGATGG + Intergenic
974900508 4:67991190-67991212 ACATTAACACAAATGATGGAAGG - Intergenic
975052079 4:69878161-69878183 AGATAGATAGAAAACAAGGATGG - Intergenic
976242678 4:82974879-82974901 ACGTAGATACAAAAGTGGGATGG + Intronic
976459784 4:85296756-85296778 ACATAGATACAATAAATACATGG + Intergenic
976664720 4:87577983-87578005 ACATAAATACTAAAGAATGACGG - Intergenic
977320967 4:95515668-95515690 ACATAGATCCAACAGATCTAAGG + Intronic
977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG + Intronic
978931875 4:114324200-114324222 AAAAAGAAATAAAAGATGGATGG - Intergenic
979207704 4:118060234-118060256 ACATAGCTTCAAAATATAGAAGG - Intronic
979657519 4:123213051-123213073 ACATAGCTTCAAATGCTGGAAGG - Intronic
980053470 4:128059988-128060010 ACAGAGCTAGTAAAGATGGATGG + Intergenic
980791306 4:137622828-137622850 TCATAGATAAAAGAGAGGGAGGG - Intergenic
982341841 4:154308272-154308294 ACAAAGAAACAAAAGAAGGGAGG + Intronic
982955985 4:161766845-161766867 ATACAGATATAAAAGATAGATGG + Intronic
983983475 4:174028117-174028139 ACATAGATAAAACATTTGGATGG + Intergenic
984189543 4:176588892-176588914 ACATAGATAAAAGACATGGATGG + Intergenic
984232941 4:177121228-177121250 ACATTTATACTAAAAATGGAGGG + Intergenic
984458652 4:180005231-180005253 ACATAGATACAATTGATTCAGGG - Intergenic
984538263 4:181003685-181003707 ACATGAATACAAATGATAGAAGG - Intergenic
1202770720 4_GL000008v2_random:204014-204036 AAATAAATAAAAAAGATGGCTGG + Intergenic
986818930 5:11444711-11444733 AAATAAATAAAAAAGATGAATGG + Intronic
987875176 5:23672541-23672563 ATAAAGATAAAAAACATGGATGG - Intergenic
988445608 5:31282974-31282996 ACATTGATAAGAAAGATGGAAGG + Intronic
989563643 5:42878621-42878643 AAATAGAGACAAAAAAAGGAAGG + Intronic
990207499 5:53444960-53444982 ATATAAATACTAAAGATGTAAGG - Intergenic
990308450 5:54516724-54516746 ACATAGAGACAACAGATGGATGG + Intergenic
990697865 5:58442406-58442428 ACATAGAAACAAAATTTGGTAGG - Intergenic
991577534 5:68120884-68120906 AAATATATACAAAAGATTAAAGG + Intergenic
992027443 5:72684609-72684631 AGTGAGAAACAAAAGATGGAAGG - Intergenic
992166717 5:74059583-74059605 AAATACATAAAAAAGATTGAAGG - Intergenic
992485083 5:77186769-77186791 ACATAGTTGCCAAAGATGAAGGG - Intergenic
992603600 5:78432148-78432170 ACATAGAGATAGAAGAAGGATGG - Intronic
993022934 5:82613457-82613479 ACAATGATACAAAAAATGGAAGG + Intergenic
993139620 5:84014941-84014963 ACATAGAAACAAAAGAAGGTTGG + Intronic
994311755 5:98280711-98280733 AGATAGATAGATAGGATGGATGG + Intergenic
994336980 5:98578510-98578532 ACATAGATAATAAAAAGGGAAGG - Intergenic
994383897 5:99104967-99104989 ATACAGATACAAAAGAATGAGGG + Intergenic
994483905 5:100371078-100371100 ACAAAGATACAAAAGATCCTCGG - Intergenic
994686722 5:102963993-102964015 AGATAGAAAAAAAAGAAGGAGGG + Intronic
995948438 5:117680057-117680079 AGAAAGAAACAAAAGAAGGAAGG - Intergenic
996007283 5:118436925-118436947 ATAGAGATACAAAAGATGCTAGG - Intergenic
996208269 5:120770971-120770993 AAATAAATAGAAAAGATGCAAGG - Intergenic
996244765 5:121248486-121248508 AAATAAGTAAAAAAGATGGAGGG - Intergenic
996341952 5:122448544-122448566 ATATATATAAAAAATATGGAAGG - Intronic
996341954 5:122448571-122448593 AAATATATATAAAATATGGAAGG - Intronic
996740460 5:126794094-126794116 ACAAAAATACAAAAGTTGGCTGG - Intronic
997494723 5:134312903-134312925 ACAAACAAACAAAATATGGAAGG + Intronic
997965221 5:138351628-138351650 AAATGGATACAAAAGATAAAGGG - Intergenic
998604131 5:143616061-143616083 TCATAGATAGTAGAGATGGAGGG - Intergenic
998772534 5:145562778-145562800 ACACAGAAAAAAAAAATGGAAGG + Intronic
998982923 5:147724826-147724848 AGATAGATAAAAAACAAGGAAGG + Intronic
999185960 5:149709186-149709208 ACAGAGAGACAAGAGATAGAGGG + Intergenic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000599098 5:163250704-163250726 ACATGTAAAAAAAAGATGGAGGG + Intergenic
1000929546 5:167234835-167234857 AAATTGATATAAAAAATGGAAGG - Intergenic
1001671653 5:173478692-173478714 CCCTAGATGCAAAAGATGGAAGG - Intergenic
1003514174 6:6804547-6804569 ACAGAGATGCAAAAGAAGAAGGG - Intergenic
1003619097 6:7681718-7681740 ACAAAAATAGAAAAGAAGGAGGG - Intergenic
1004484987 6:16058010-16058032 ACACAAAAACAAAAGATGGTGGG + Intergenic
1005646904 6:27848005-27848027 ATATAGATATAAGGGATGGAAGG - Intronic
1005674292 6:28137864-28137886 AGAAGGATGCAAAAGATGGATGG + Intergenic
1005704980 6:28442586-28442608 ACTGAGGTACAAAAGAAGGACGG + Intronic
1005986165 6:30876923-30876945 ACATACAAACAAAAAATGGCTGG + Intronic
1006773358 6:36572462-36572484 ACAAACACACAAAAGATGGTTGG + Intergenic
1008231329 6:48987565-48987587 AAAAAGATACAAAATATGAAGGG + Intergenic
1008733737 6:54516087-54516109 AGATAGAAAGAATAGATGGAAGG + Intergenic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1009839642 6:69052882-69052904 TTATAGATAGAAAATATGGATGG + Intronic
1010232811 6:73550453-73550475 ACATAGACACAAAAAAAGTAAGG + Intergenic
1010298649 6:74232031-74232053 AAAGAGAGAAAAAAGATGGATGG - Intergenic
1010450068 6:75992531-75992553 GCATGGATACAAAGGAAGGAAGG - Intronic
1011556548 6:88575645-88575667 ATATAGAGCCAAAAGATCGAAGG - Intergenic
1012488284 6:99746690-99746712 AGACAGATACAAAATATGTAAGG - Intergenic
1012836236 6:104271925-104271947 ACAAAGATTCAAAAGATAGGAGG - Intergenic
1013002460 6:106037539-106037561 ACAGAAAGAAAAAAGATGGAAGG - Intergenic
1013349796 6:109295087-109295109 ACATTGATACATAAGATCCATGG + Intergenic
1013962635 6:115918788-115918810 ACACAGAAGCAACAGATGGAAGG + Intergenic
1014672008 6:124316384-124316406 ACATAGACACAGATGATTGATGG + Intronic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015253853 6:131156118-131156140 AAAAAAATACAAAAGATAGAAGG - Intronic
1015744415 6:136494894-136494916 CCATAGATACCACAGATGAAAGG + Intronic
1016524341 6:144984515-144984537 ACATAAAAACATAAAATGGAGGG - Intergenic
1016802427 6:148180479-148180501 CCATAGAAAAAGAAGATGGAAGG - Intergenic
1017690272 6:156957074-156957096 ACAAGGATACAAGAGATTGAAGG + Intronic
1017885028 6:158591843-158591865 ACATAGATACAAAAGATGGAAGG - Intronic
1017966222 6:159269296-159269318 AAATAGATAGGATAGATGGATGG - Intronic
1017998076 6:159551545-159551567 ACAAAGACACAAAAGAAAGAAGG - Intergenic
1018266834 6:162033810-162033832 AACAAGATAGAAAAGATGGAAGG - Intronic
1018557446 6:165063854-165063876 AAACAGTTACAAAAGATTGAGGG - Intergenic
1020394231 7:7695730-7695752 ACATAGATATTAAAGATGCTAGG - Intronic
1020712377 7:11623950-11623972 ACATAGAAACAAAATAGGGCAGG + Intronic
1020774937 7:12441490-12441512 TGATAGATTCAAATGATGGAAGG - Intergenic
1023213921 7:37840276-37840298 ACAAAGATACTAGAGACGGAGGG + Intronic
1024160398 7:46668894-46668916 ACATGCATACAAAAGCTAGAAGG + Intergenic
1024966673 7:55028857-55028879 ACAGATAAACAAAAGATGGTTGG + Intronic
1025145812 7:56502472-56502494 ACATGGATACAGATGATGAAAGG - Intergenic
1025710956 7:63909158-63909180 ACATGGATACAGATGATGAAAGG - Intergenic
1027533835 7:79370209-79370231 AAATATATACAAAATATAGATGG + Intronic
1027694334 7:81390177-81390199 ACAAATATATAAAAGATGGGTGG - Intergenic
1028604454 7:92640401-92640423 CAATAGATACAAAAGAAGGATGG + Intronic
1028804834 7:95012967-95012989 ACATATACAAAAAAAATGGAAGG - Intronic
1030580668 7:111350787-111350809 AAATAGATACAAAAGATGAGAGG - Intronic
1031663100 7:124451856-124451878 ACATATATACAGTAGAGGGAGGG + Intergenic
1031848793 7:126838352-126838374 GCAGAGAAACAAAAGAAGGAAGG - Intronic
1033034292 7:137858547-137858569 AGAAAGAAAAAAAAGATGGAAGG + Intergenic
1034895383 7:154873020-154873042 ACACAGAGACACAAGATGGCTGG + Intronic
1039952622 8:42183707-42183729 ACATAAATACCATAAATGGAAGG + Intronic
1040057735 8:43075159-43075181 ACATTGATACAAAAGCTTGTAGG + Intronic
1040625918 8:49149914-49149936 ACATAGATATGAATTATGGATGG - Intergenic
1041160547 8:55038322-55038344 ACAAAGAAACAAATAATGGATGG + Intergenic
1041998364 8:64090691-64090713 ACATAAAAACAAAAGATGGCCGG - Intergenic
1042414353 8:68501874-68501896 ACATAGGTACAAAGGGTAGAAGG + Intronic
1043505790 8:80900606-80900628 ACAAAGAAACAAAAAATGTATGG + Intergenic
1043971467 8:86533885-86533907 GAATAGATACAAAGGAAGGAAGG - Intronic
1044596080 8:93960043-93960065 ACATAGCTACAAAAGAGGCTGGG + Intergenic
1044599260 8:93987432-93987454 ACACACACACAAAAGATAGACGG + Intergenic
1045155963 8:99471603-99471625 ACAAAGGAACAAAAAATGGAGGG + Intronic
1046220883 8:111212842-111212864 AGAAAGATTCAAAAGATGTACGG + Intergenic
1046264554 8:111814232-111814254 ACCTAGATTCAGAAGATGCATGG - Intergenic
1046624863 8:116565561-116565583 AGATAGATACAGAAGATATATGG + Intergenic
1046745424 8:117870839-117870861 ACACACACACAAAAGATTGAAGG + Intronic
1047969744 8:130074591-130074613 ACAGCAATGCAAAAGATGGAGGG + Intronic
1048171086 8:132107103-132107125 AAATAGATACAGAAGAAGAAGGG - Intronic
1049416023 8:142495671-142495693 ACAGAGATACACAAGACAGAAGG - Intronic
1050323407 9:4477325-4477347 TCATAGATACAGAAGTAGGATGG + Intergenic
1050846792 9:10231331-10231353 ACAAAGAAAAAAAAAATGGAAGG + Intronic
1053050082 9:34954164-34954186 ACACACACACAAAGGATGGAAGG + Intergenic
1053440238 9:38110092-38110114 ACATAGATACGAAGCCTGGAAGG - Intergenic
1054222116 9:62422889-62422911 GCATGGAAAAAAAAGATGGAAGG - Intergenic
1054228598 9:62486283-62486305 GCATGGAAAAAAAAGATGGAAGG + Intergenic
1054358422 9:64087888-64087910 AAATAAATAAAAAAGATGGCTGG - Intergenic
1055742785 9:79408048-79408070 ACAAAGATAGAAGGGATGGAAGG + Intergenic
1055806024 9:80094479-80094501 ACATAGAAGAAAAAGAAGGAAGG - Intergenic
1056101809 9:83306888-83306910 AAATAGATAGAAATGATGGTTGG + Intronic
1058132426 9:101267831-101267853 ACAGAGATACCAAAGAGGAAAGG - Intronic
1058149501 9:101448768-101448790 AAAAAGATACAAAGGAAGGAAGG + Intergenic
1058923223 9:109638156-109638178 ACCTATATACACAACATGGATGG + Intergenic
1060025292 9:120165666-120165688 ACATGGATGGAAAACATGGATGG + Intergenic
1061417584 9:130455512-130455534 ACAGAGAGATAAAAGAGGGAAGG - Intronic
1203703930 Un_KI270742v1:19738-19760 AAATAAATAAAAAAGATGGCTGG - Intergenic
1203560086 Un_KI270744v1:46086-46108 AAATAAATAAAAAAGATGGCTGG + Intergenic
1185498463 X:578053-578075 ACACATAAACAATAGATGGATGG + Intergenic
1185622344 X:1458999-1459021 ACATAGATAAACAGAATGGATGG - Intergenic
1185622393 X:1460303-1460325 ACATAGATAAACAGAATGGATGG - Intergenic
1185629966 X:1508693-1508715 AGATAGATAGAATGGATGGATGG - Intronic
1185629998 X:1509034-1509056 GCATAGATAGAATAAATGGATGG - Intronic
1185630016 X:1509363-1509385 AGATAGATAGAATAGATGGATGG - Intronic
1185630047 X:1509700-1509722 GCATAGATAGAATAAATGGATGG - Intronic
1185717502 X:2354453-2354475 ACAAAAACAAAAAAGATGGATGG - Intronic
1185813831 X:3135579-3135601 ACATAGATGAAATTGATGGATGG + Intergenic
1185925872 X:4145355-4145377 AGCTAGATAGATAAGATGGATGG + Intergenic
1185958710 X:4522161-4522183 AGATAGATAGATTAGATGGATGG + Intergenic
1186154869 X:6714556-6714578 AGATAGATACAATAGCTAGATGG + Intergenic
1186178647 X:6951236-6951258 AGATAGATAGATATGATGGATGG - Intergenic
1186244125 X:7602647-7602669 ATATAGATAGATATGATGGATGG + Intergenic
1187034073 X:15519211-15519233 CCATAGATCCAATAGATGGGCGG - Intronic
1187405699 X:19001687-19001709 ACATAGTGACATAAGATAGAAGG + Intronic
1187629685 X:21155333-21155355 ATATAGATACAGAAGGTTGAAGG + Intergenic
1187900261 X:24021636-24021658 GGATGGATACAAAACATGGAAGG - Intronic
1188608568 X:32066826-32066848 ACATAGTTACCAACGATGGATGG + Intronic
1189262022 X:39686177-39686199 ACAAAGAAAAAAAAGAAGGAAGG + Intergenic
1191913553 X:66177526-66177548 ACAGAAATACAAAAGATTCAAGG - Intronic
1192136051 X:68601591-68601613 CCAGATAAACAAAAGATGGAGGG + Intergenic
1193434993 X:81462231-81462253 TCATTGATCAAAAAGATGGAAGG - Intergenic
1193700361 X:84752706-84752728 TCATTGATAGAAAAGATAGAAGG + Intergenic
1193948866 X:87773544-87773566 ACATAAAAAGAAAAGATGGAAGG - Intergenic
1196334870 X:114520577-114520599 ACATATATACTAAATATGAAGGG + Intergenic
1197231893 X:124014335-124014357 ACATATATATAAAGGATGGAAGG - Intronic
1197514204 X:127403718-127403740 ACATAGAAATCAAAGATGAAAGG - Intergenic
1197867233 X:131032273-131032295 AAATAAAAACAAAAGGTGGAGGG - Intergenic
1198185110 X:134247285-134247307 ACATAAATACAAAAAATAGCCGG - Intergenic
1198574709 X:137997535-137997557 ACATTGATGCAAAAAATGAATGG + Intergenic
1199354574 X:146846913-146846935 AGATATTTAGAAAAGATGGAAGG - Intergenic
1199989933 X:152981514-152981536 AAATAGAACAAAAAGATGGAGGG + Intergenic
1200174962 X:154107819-154107841 ACCTATACACAAAACATGGAAGG + Intergenic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200738401 Y:6826897-6826919 ACAAAGATACAATATATGAAGGG - Intergenic
1201546554 Y:15170131-15170153 AGATAGATATAACAGATGAATGG + Intergenic
1201584355 Y:15544684-15544706 ACATAATTACAAAGGCTGGATGG - Intergenic
1201693900 Y:16802113-16802135 ACATAGATACATAGGCTAGATGG + Intergenic
1201953739 Y:19597072-19597094 ACATAGATAATAAAGATGCATGG - Intergenic