ID: 1017887382

View in Genome Browser
Species Human (GRCh38)
Location 6:158610316-158610338
Sequence GGAGCTGTTGAAAGAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017887382_1017887394 14 Left 1017887382 6:158610316-158610338 CCAGATTCTCTTTCAACAGCTCC 0: 1
1: 1
2: 0
3: 23
4: 276
Right 1017887394 6:158610353-158610375 TGTCAGGGTGAGGGTGGCAGAGG 0: 1
1: 0
2: 9
3: 110
4: 1008
1017887382_1017887391 4 Left 1017887382 6:158610316-158610338 CCAGATTCTCTTTCAACAGCTCC 0: 1
1: 1
2: 0
3: 23
4: 276
Right 1017887391 6:158610343-158610365 GTAGGCAATTTGTCAGGGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 139
1017887382_1017887392 5 Left 1017887382 6:158610316-158610338 CCAGATTCTCTTTCAACAGCTCC 0: 1
1: 1
2: 0
3: 23
4: 276
Right 1017887392 6:158610344-158610366 TAGGCAATTTGTCAGGGTGAGGG 0: 1
1: 0
2: 2
3: 11
4: 193
1017887382_1017887387 -1 Left 1017887382 6:158610316-158610338 CCAGATTCTCTTTCAACAGCTCC 0: 1
1: 1
2: 0
3: 23
4: 276
Right 1017887387 6:158610338-158610360 CCCCCGTAGGCAATTTGTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1017887382_1017887385 -2 Left 1017887382 6:158610316-158610338 CCAGATTCTCTTTCAACAGCTCC 0: 1
1: 1
2: 0
3: 23
4: 276
Right 1017887385 6:158610337-158610359 CCCCCCGTAGGCAATTTGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1017887382_1017887393 8 Left 1017887382 6:158610316-158610338 CCAGATTCTCTTTCAACAGCTCC 0: 1
1: 1
2: 0
3: 23
4: 276
Right 1017887393 6:158610347-158610369 GCAATTTGTCAGGGTGAGGGTGG 0: 1
1: 0
2: 1
3: 139
4: 5824

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017887382 Original CRISPR GGAGCTGTTGAAAGAGAATC TGG (reversed) Intronic
900856952 1:5193913-5193935 AGAGCTATAGAAACAGAATCTGG + Intergenic
903383022 1:22909802-22909824 TGAGCTGTGGAAGGTGAATCTGG + Intronic
904266840 1:29323221-29323243 GGAGCTGCTGAAGGTGAGTCTGG + Intronic
905245256 1:36608472-36608494 TGAGCTGTTAAAAGAGGCTCTGG + Intergenic
906547619 1:46631944-46631966 TGAGCTGGGGAAAGAGAACCAGG - Intergenic
911045410 1:93623575-93623597 GAAGCTGATGGAAGAGAATGTGG + Intronic
911165277 1:94719315-94719337 GGAGGTGTAGAAGGAGAAGCAGG + Intergenic
913457248 1:119045905-119045927 GAAGATGTTGAAGCAGAATCTGG - Intronic
914243878 1:145872020-145872042 AGAGCTGCTGAAAGAGAAGATGG - Exonic
914327795 1:146637285-146637307 GGATGTGTTGAATGAGAATAAGG + Intergenic
914692787 1:150046278-150046300 GGAGATGTTGAGAGAGTAGCTGG - Intergenic
915380379 1:155434303-155434325 GGAGCTAGGGAAAGAGAACCTGG + Intronic
915457752 1:156051916-156051938 GAAGGTGTTGAAAAAGAGTCAGG - Intronic
916793863 1:168147551-168147573 AGAGGTGTTGGAAGAGAACCAGG - Intergenic
919854245 1:201694774-201694796 GGAGCTGGAGACAGAGAAGCTGG + Intronic
921438024 1:215149718-215149740 AGAGATTTTGAAAGATAATCAGG + Intronic
922013875 1:221622908-221622930 AGAGCTGTTGAAAGAGAAGATGG + Intergenic
922085512 1:222343249-222343271 GGAGCTGGGGAAAGGGAGTCAGG + Intergenic
922193065 1:223336834-223336856 AGAGGTGTTCAAAGAGTATCTGG + Intronic
922243998 1:223777129-223777151 AGAGCTGTGGAAAGAAAAACAGG - Intergenic
922301803 1:224308190-224308212 GGAGTATTTGAAACAGAATCAGG + Exonic
922538884 1:226404086-226404108 GGAGCTGTGGAAGGAGCATTGGG - Intronic
923784672 1:237055455-237055477 GGAGCTGGTGCAAGATAATTCGG + Intronic
923942888 1:238848500-238848522 GGAGCCATTGAAAGAAAATACGG - Intergenic
1062967843 10:1623919-1623941 TCAGCTGGTGAAAGAGATTCAGG + Intronic
1063934724 10:11065896-11065918 GGAGCAATTGAAAGAAAACCAGG + Intronic
1064374158 10:14780427-14780449 AGAGCTGGAGAAAGAGAACCTGG + Intergenic
1067839071 10:49661810-49661832 GGAGCTGTAGAATGAGTACCCGG + Intronic
1067922690 10:50476347-50476369 GGAACTGTTATAAGAGAAGCAGG + Intronic
1068043052 10:51851115-51851137 GCAGCTGTTAATAGATAATCAGG + Intronic
1069245711 10:66202582-66202604 GGTGCTGTTAAAAGAAAAACCGG - Intronic
1070977618 10:80617867-80617889 GGGGCTGTTGAGAGACAAGCAGG - Intronic
1071009870 10:80925445-80925467 GGTGCTGTGGAAAGAGAACTGGG + Intergenic
1073073775 10:100810674-100810696 GGCACTGTTCAAAGAGAACCCGG + Intronic
1074387814 10:113030941-113030963 GGAGCTGGTGAGACAGACTCTGG - Intronic
1075516377 10:123111992-123112014 GGAGGTGTTGAAAGCGCCTCTGG - Intergenic
1076421004 10:130331541-130331563 GGATATGTGGAAAGAGAATGAGG + Intergenic
1077198037 11:1291348-1291370 GGAGCTGGTGATAGAGACCCCGG + Intronic
1077707145 11:4497630-4497652 TGATTTGTGGAAAGAGAATCAGG + Intergenic
1077730314 11:4723039-4723061 GGAGCTGATGAAAGTCAAACTGG - Intronic
1077837192 11:5935651-5935673 GGAGCTCTTGAAAGAGGAAGGGG - Intronic
1078143081 11:8705651-8705673 GGAGCTCGTGAAGGAGAAGCAGG - Intronic
1078170463 11:8925488-8925510 GGAGGTATTGGAAGAGAAACGGG - Exonic
1083401993 11:62429932-62429954 GGAGCTGTGGAAGGAGGAGCAGG + Intergenic
1084305924 11:68283231-68283253 AGACCTGCTGAAAGAGAATGAGG - Intergenic
1084920235 11:72463832-72463854 GGAGCTTGTGAAACATAATCAGG + Intergenic
1085072995 11:73564995-73565017 AGAGCTCTTGATAGGGAATCAGG - Intronic
1086302398 11:85441468-85441490 TGATCAGTTGAAAGATAATCAGG - Intronic
1086921497 11:92592941-92592963 GGAGCTGTTTAACGAGTATAGGG - Intronic
1088829865 11:113527261-113527283 GGAGCCTTTGAGAGAGAATTAGG - Intergenic
1089487563 11:118858740-118858762 GGTTCTGGAGAAAGAGAATCTGG - Intergenic
1089599208 11:119603159-119603181 GGAGCTGATGAACGTGAAGCTGG - Intergenic
1090185878 11:124738898-124738920 GGAGCTATGGAAAGAGCATCTGG - Intergenic
1091129727 11:133135361-133135383 AAAGCTGTTGAAGGAGAAACAGG - Intronic
1091484163 12:867947-867969 GGAGGTGGTGAAAAAGAAACTGG - Intronic
1091857470 12:3751350-3751372 GAAGCTGTGGGAAGAGAACCTGG - Intronic
1096589297 12:52646795-52646817 GGAGCTGATGAACGTGAAGCTGG - Exonic
1101627612 12:106461026-106461048 GGAGCTGTTTCAGGAGAATGAGG - Intronic
1102615724 12:114152422-114152444 GGAGCTGTTGAAAAGCAAGCAGG + Intergenic
1102948381 12:117010530-117010552 AGAGCTGTTGAGTGAGAACCGGG - Intronic
1103039168 12:117680701-117680723 GTAGGTGTTAAAAAAGAATCAGG + Intronic
1103705873 12:122871998-122872020 AGAGCTGCTTAAAGAGAAACAGG - Intronic
1104199803 12:126577444-126577466 GAAGGGGTTGAAAGAGAATGGGG + Intergenic
1107319615 13:39171696-39171718 GATGCTGTGGAAAGAGAATGGGG + Intergenic
1107896628 13:44971274-44971296 AGAGGTGTTTAAAGAGAATGAGG - Intronic
1108724982 13:53170819-53170841 GAAGATTTTGGAAGAGAATCAGG - Intergenic
1109298519 13:60564939-60564961 AGAGCTGTTGAGAGCAAATCTGG - Intronic
1111355126 13:87089570-87089592 GGAGATGTTGAAACAGGATGGGG - Intergenic
1112947411 13:104947741-104947763 AGATCTGTTGTAAGAGACTCAGG + Intergenic
1113810474 13:113139224-113139246 GGAGTTGTTTACAGAGAAACCGG + Intronic
1114165662 14:20216139-20216161 GGAGCTTTTGAAAGAGGTTTGGG - Intergenic
1116937553 14:50757837-50757859 GCAGCTGTTGGAAGAAAATGGGG - Exonic
1118845411 14:69544283-69544305 GCAGCAGCTGAAGGAGAATCTGG - Intergenic
1118870122 14:69734369-69734391 GGAGCTGCAGAAAGAGAAAGAGG + Intronic
1121205216 14:92159211-92159233 GGAGATGATGAAAAAGAAACAGG + Exonic
1121666766 14:95678159-95678181 GGAGCTGGTGAGGGAGAACCAGG - Intergenic
1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG + Intergenic
1125034060 15:35103497-35103519 GAAGCTGTTCTAAGAGGATCTGG - Intergenic
1126879804 15:53082442-53082464 GGACTAGTTGAAACAGAATCTGG - Intergenic
1127718309 15:61673663-61673685 GGATCAGTAGAAGGAGAATCTGG - Intergenic
1127749796 15:62024418-62024440 GGCAGTGTTGAAAGAGAATGAGG - Intronic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1132049745 15:98597263-98597285 GGAGCTATTTAAAGGTAATCAGG + Intergenic
1132481637 16:169201-169223 GGAACTGTGGAGAGAGAGTCAGG - Intergenic
1133437459 16:5792151-5792173 GGGGCTGATAAAAGAGAACCTGG + Intergenic
1134126292 16:11618505-11618527 GCAGCTGGTGTCAGAGAATCTGG + Intronic
1134219113 16:12339423-12339445 GGAGGTGTTGAAGCAGAAACTGG + Intronic
1134333708 16:13273949-13273971 ACCACTGTTGAAAGAGAATCTGG + Intergenic
1134822696 16:17259309-17259331 GGAGCTTTTGAAAAGGAAGCTGG - Exonic
1134829645 16:17312954-17312976 GGAGCTTTTCCAAGAGGATCCGG - Intronic
1135129963 16:19845258-19845280 GGAGCTGTTTAAAAATAAACTGG + Intronic
1135349870 16:21719652-21719674 GGAGCTGTTTAAAAAGAAACTGG - Intronic
1135755544 16:25094433-25094455 GGAGGTGTGGAAAGAGAAGCTGG + Intergenic
1135829929 16:25764033-25764055 GGAGCTGATGAAGGAGAATGCGG + Intronic
1136186113 16:28590004-28590026 TGAGCTGTTGAAGGAGCACCTGG - Intronic
1140005764 16:71073652-71073674 GGATGTGTTGAATGAGAATAAGG - Intronic
1140553409 16:75892675-75892697 AGAGCTTTTGAAAGAGAGACTGG - Intergenic
1143129402 17:4667433-4667455 GCAGCTGTCAAAAGAGAATGAGG + Intergenic
1143289658 17:5819434-5819456 GGAGCTGCTGAATCAGAATCTGG + Intronic
1143509349 17:7386971-7386993 GGGGCTGTGGAAAGAGGAGCTGG - Exonic
1145118785 17:20236841-20236863 GGAGCTGTGAAAATAGAAACGGG - Intronic
1146314162 17:31794338-31794360 GAAGCTTTTCAAAGAGAATAAGG + Intergenic
1147463547 17:40591826-40591848 GCATCTGTTAAAAGAGAAACTGG - Intergenic
1148562341 17:48613258-48613280 GGAGCTGGAGAAACAGAAGCTGG - Exonic
1150572755 17:66402053-66402075 GGAGCTGGAGAATGAGAATCGGG + Intronic
1152828847 17:82484903-82484925 GGAGCTGTTCAACGAGGATGTGG + Exonic
1153331979 18:3882808-3882830 GGAAGTCTTGAAAGAAAATCAGG - Intronic
1153512106 18:5867094-5867116 GGTGCTGTGGAAAGAGAATTGGG - Intergenic
1156849692 18:41712096-41712118 GGAGCCTTTGAGAGAGAATCAGG + Intergenic
1157302179 18:46487014-46487036 GGAACAGATGAAAGAGGATCAGG + Intronic
1157467141 18:47957064-47957086 GGAGCTGATGGAATAGAGTCTGG - Intergenic
1157887936 18:51386725-51386747 GCACCAGTTGAAAGAGAAACTGG + Intergenic
1157988744 18:52470211-52470233 GGAGCAGTGGGAGGAGAATCAGG - Intronic
1158747163 18:60214422-60214444 GGAAGTGTTGAAAGAGAACATGG + Intergenic
1160046488 18:75391547-75391569 GGGGCTGTTGCAAGAGGATGAGG + Intergenic
1160524442 18:79526705-79526727 GGGGTTGTTGAAAGGGAATTTGG + Intronic
1161060945 19:2214524-2214546 GAAGCTGTTGAAGGAGAAGCAGG + Exonic
1161941350 19:7406386-7406408 GAAGCTTTTCAAAAAGAATCTGG - Intronic
1163557482 19:18000995-18001017 GGCGCTGTTGAATCAGAAGCAGG - Intergenic
1163836193 19:19575806-19575828 GGAGCTGTTGAACAAGATTCAGG - Intronic
1164409526 19:27989192-27989214 GCAGCTGGTGAAAGAGAAGGTGG - Intergenic
1164668147 19:30055982-30056004 GAGGCTGTGGCAAGAGAATCGGG - Intergenic
1166441891 19:42822839-42822861 GGAGCTCTGGAAAGAGGAGCAGG + Intronic
1166461319 19:42991121-42991143 GGAGCTCTGGAAAGAGGAGCAGG + Intronic
1166501279 19:43343436-43343458 GGAGCTCTGGAAAGAGGAACAGG + Intergenic
1166508831 19:43390011-43390033 GGAGCTCTGGAAACAGAAGCAGG - Intergenic
1166511526 19:43412489-43412511 GGAGCTGTTGAAGCAGAAATGGG + Intronic
1167118380 19:47501369-47501391 GGAGCTGTGGAAAAAGAAACAGG - Intronic
1168522473 19:57063297-57063319 GGAGAAGTTGAAGGAGGATCCGG - Intergenic
925814558 2:7734954-7734976 GGAGCAGAAGAAAGAGAATAAGG + Intergenic
925993926 2:9276395-9276417 GGAGCTGATGCCAGAGAAGCAGG + Intronic
926428535 2:12762703-12762725 GGAGCTATTGAAATAGACTTGGG - Intergenic
926629983 2:15127394-15127416 AGGGCTGTTGAGAGAGAATCTGG - Intergenic
926722828 2:15974624-15974646 GGACCTTTTGGAAGAGAATACGG - Intergenic
928362679 2:30678520-30678542 GGAGCTGTGGTAAGAGCCTCGGG - Intergenic
928901128 2:36318672-36318694 GGAGATATTTAAATAGAATCTGG + Intergenic
929143544 2:38687121-38687143 GGAGCTGAGGGAAGAGAATTTGG - Intronic
930608480 2:53516423-53516445 GGAGCAGGTGAAAGAAAATTAGG + Intergenic
932296734 2:70630519-70630541 TGAGCTTCTCAAAGAGAATCAGG + Intronic
932754255 2:74395053-74395075 GGTGCTGTTGTAAGAGATCCAGG + Intergenic
933559984 2:83876692-83876714 GGAGCTCTTGAAAGAGGAAGGGG + Intergenic
933741111 2:85534514-85534536 GGGGCAGGTGAAAGAGAAGCAGG + Intergenic
936235620 2:110740234-110740256 GGAGCCTTTGGAAGATAATCTGG - Intronic
937060528 2:118977586-118977608 GGGGCTGTGGAAAGAGGATGGGG - Intronic
938763976 2:134448282-134448304 GCAGCTGTTGAAAAAGAATGAGG - Intronic
939953938 2:148509306-148509328 GAAGCTGTTGAACTAAAATCAGG - Intronic
942148595 2:173051621-173051643 GGATCTGTTGAAAGAGGAAAGGG - Exonic
942333113 2:174850229-174850251 GTAGCTGTTTAAATAGAATTAGG + Intronic
942896769 2:181066475-181066497 GGAGCTCTCGTAAGAGAGTCAGG - Intronic
943064419 2:183071345-183071367 GGAGCTGATGAACGACAAGCTGG - Intergenic
946621309 2:221566749-221566771 AGAGCTGCTGAAAGAGCACCTGG - Intronic
947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG + Intergenic
947508994 2:230733610-230733632 GGAACTATTGAAAGAGAAATTGG + Intronic
947515461 2:230800315-230800337 GGATTTATTGAATGAGAATCAGG + Intronic
947533133 2:230925305-230925327 GGAGCGGCTCAAAGAGCATCTGG - Intronic
947589634 2:231378270-231378292 GGACCTGTAGAAAGAGATTTGGG - Intergenic
947789925 2:232859558-232859580 GTAGCTGTTGTAAGCCAATCTGG - Intronic
1170036605 20:11996341-11996363 GGAGGGGTGGAGAGAGAATCTGG - Intergenic
1172665165 20:36594082-36594104 GGAGCTGGTGAAAGGGAATGGGG - Intronic
1175523651 20:59618864-59618886 GGAACTGTTTAGAGAGAGTCTGG + Intronic
1177056490 21:16310265-16310287 GGAGCACATCAAAGAGAATCAGG - Intergenic
1177348866 21:19909145-19909167 TAAGCTTTCGAAAGAGAATCTGG - Intergenic
1177759421 21:25386429-25386451 TGAGGTGTTGCAGGAGAATCAGG - Intergenic
1178805028 21:35832021-35832043 GGAGCTGGTGAAGGTGAATTGGG - Intronic
1180237111 21:46469373-46469395 GGAGCTGTTGAATCAGAGTGTGG + Intronic
1180629489 22:17218536-17218558 GGGGCTGTTGATGGAGAATGTGG - Intronic
1181116404 22:20634848-20634870 GGAGCTGTGGAAAGAGGCTGGGG - Intergenic
1181184764 22:21095088-21095110 GAGGCTGTTGAAAGATAATAAGG + Intergenic
1181970814 22:26688491-26688513 GAGGCTGTTGAAAGATAATGAGG + Intergenic
1183669560 22:39264521-39264543 GGAGCTGTGGTCAGAGAAGCCGG + Intergenic
1184855488 22:47144284-47144306 GGAGCTCTGGAAAGGGAAACGGG - Intronic
950087526 3:10270829-10270851 GGAGCTGTTGAAAGAGGATCTGG + Exonic
951218271 3:20043940-20043962 GGGGCTTTTGAAAGAAAAACAGG + Intronic
951998488 3:28757396-28757418 GGAGCTGCTGAAACATAATGAGG + Intergenic
952503957 3:33990421-33990443 GGAACTGCTGAAAAACAATCTGG - Intergenic
960554094 3:119008487-119008509 AGAGAGGTAGAAAGAGAATCAGG + Intronic
960610493 3:119550902-119550924 GGCGCTGTTCAAGGAGAGTCAGG - Intronic
960960342 3:123066583-123066605 TGAGCTGTTGGAAAACAATCTGG - Intergenic
961127642 3:124434757-124434779 GGAGGTGTTGAAATAGAAATTGG + Intronic
961534443 3:127561192-127561214 GGAGGTAAAGAAAGAGAATCTGG + Intergenic
962792518 3:138824484-138824506 GGAGCTATTAAAAGAAAATAAGG + Intronic
962833045 3:139160913-139160935 GGAACAGAGGAAAGAGAATCTGG - Intronic
963613113 3:147497415-147497437 GGAGCAGTTGGAAGAGAAAGTGG + Intronic
964802257 3:160568920-160568942 GGAGCTGATGAAAGTCAAGCTGG + Intergenic
964811397 3:160668461-160668483 GTAGCTTCTGAAAGAGGATCAGG + Intergenic
965455878 3:168899668-168899690 GTAGCTGTTAAAAAAGAATGAGG + Intergenic
967579014 3:191129867-191129889 AGAGCTGTTGGAAGAGAGGCAGG + Intergenic
970725080 4:19034326-19034348 GCAGTTGTTCAAAGAGAATTTGG - Intergenic
970845541 4:20533609-20533631 GGAGCATTTGAAGGAGCATCTGG + Exonic
971569292 4:28189495-28189517 ATAACTGATGAAAGAGAATCAGG + Intergenic
971889068 4:32494024-32494046 GGAGCTGCTGTCAAAGAATCAGG + Intergenic
972725120 4:41740544-41740566 GGAGATTTTGCAAGAGACTCCGG - Intergenic
972813387 4:42615245-42615267 GGAGGTGGTGAAAAAGAAGCAGG + Intronic
973584431 4:52376544-52376566 GCAGATATTTAAAGAGAATCTGG + Intergenic
973788339 4:54355883-54355905 GGAGATGCTGACAGACAATCTGG + Intergenic
976036459 4:80828615-80828637 GGAGCAAATGAGAGAGAATCAGG - Intronic
976109987 4:81662190-81662212 GTAGCTGATGAAAGAGTAACAGG + Intronic
981534209 4:145782473-145782495 GGATGTGTTGAAAGAGAGTCGGG - Intronic
981947156 4:150361554-150361576 AGAAATGTAGAAAGAGAATCTGG - Intronic
982176952 4:152714943-152714965 GGAGCTGTTGCAAGAGATGGGGG + Intronic
982564402 4:156970958-156970980 GGCGGTGGTGAAAGAGACTCGGG - Exonic
983043634 4:162959170-162959192 GGAGGTGTTTCAAGAGGATCTGG + Intergenic
985300811 4:188487418-188487440 GAAGCTGTAGAAAGAGAGTTGGG - Intergenic
987351356 5:17024992-17025014 GGAGCTGGTGAGAGAGAACCTGG + Intergenic
988598845 5:32620854-32620876 GCAGATGTTGAAAGAGAAGTGGG - Intergenic
992739886 5:79763043-79763065 GGTGCTGCAGAAAGAGAGTCAGG - Exonic
993198214 5:84777968-84777990 GTACCTGTTGAAAGAGATTTTGG + Intergenic
994587912 5:101734383-101734405 GAAGCTGGTGGAAGTGAATCTGG + Intergenic
994667503 5:102723611-102723633 AGAGCTGTGGAAAGAAAAACTGG + Intergenic
995215716 5:109592152-109592174 GGTGCTGTTGAAAGTGCAGCAGG - Intergenic
998097050 5:139401928-139401950 GCAGCTGGAGAAAGAGAAGCTGG - Exonic
999776381 5:154815737-154815759 GTGGCTGAAGAAAGAGAATCAGG - Exonic
1001111805 5:168902864-168902886 GAGGCTGTTGAATGAGAATGGGG + Intronic
1001421111 5:171587942-171587964 GCAGCTGTTGACAGAGAGTGTGG + Intergenic
1001474879 5:172043659-172043681 GCAGCTGTAGAATCAGAATCTGG + Exonic
1001561036 5:172669135-172669157 ACAGCTGCTGAAAGAGAATGTGG - Intronic
1001587813 5:172845171-172845193 GGAGGGGTTGCAAGAAAATCAGG - Intronic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004939416 6:20540395-20540417 GGAGAAGTTGTAAGAGGATCTGG + Intronic
1005429149 6:25736092-25736114 GTGGCTGTTGAAAGAGAAGGTGG + Intergenic
1005443364 6:25895819-25895841 TGAGGTGTTGAAAGTGAATGGGG + Intergenic
1005510086 6:26504906-26504928 AGAGCTATGGAGAGAGAATCTGG - Exonic
1005755219 6:28920078-28920100 GGAGATGTTGCAAGAGAACTGGG + Exonic
1006599858 6:35218168-35218190 GGACCTGTTGTAAGAGGAGCCGG + Intronic
1008426026 6:51357677-51357699 GGAGCTTATAAAAGAGATTCTGG - Intergenic
1010493850 6:76508494-76508516 ATAGTTTTTGAAAGAGAATCTGG - Intergenic
1010994776 6:82520548-82520570 GGAGATGTTGAGATAGAATGAGG + Intergenic
1011158193 6:84357057-84357079 GCAGCTGTTGAGAGAGCAACTGG - Intergenic
1011537568 6:88392672-88392694 GGAGCTCTTGTAAGGCAATCTGG - Intergenic
1013484507 6:110583880-110583902 TGAACTGATGAAAAAGAATCAGG + Intergenic
1014551737 6:122796905-122796927 GGAGATTTGGAAAGAGACTCTGG - Exonic
1014554050 6:122824252-122824274 TGAGCTGTAGAAAGAGACTTTGG - Intergenic
1014608850 6:123515441-123515463 GCAGCTTTTTAAAGAGAATGAGG + Intronic
1015235625 6:130967627-130967649 GAAGCTGCTGAAAGAGATTGGGG - Intronic
1015395348 6:132727834-132727856 GGAGTTTTGGAAAAAGAATCAGG - Intronic
1016547293 6:145238755-145238777 GGGGCCCTTGAAGGAGAATCTGG - Intergenic
1016560665 6:145392417-145392439 GGAGCAGTAGAAGGAGAATGGGG - Intergenic
1017887382 6:158610316-158610338 GGAGCTGTTGAAAGAGAATCTGG - Intronic
1019443368 7:1058607-1058629 CGAGCTGCTGGAAGAGAAGCAGG + Exonic
1020843626 7:13254695-13254717 GGAGCTGATGGTATAGAATCTGG - Intergenic
1020977100 7:15020201-15020223 GGAGCAGTTGAATGTGAATCTGG + Intergenic
1021225357 7:18020190-18020212 AGAGTTGTTAAAAGAGATTCTGG - Intergenic
1021784616 7:24139520-24139542 GGAGCTGTAGAAAAGGCATCTGG + Intergenic
1022793752 7:33715076-33715098 GGAGCTGCTGGAGGAGAAGCAGG - Intergenic
1023583115 7:41702459-41702481 GGGGATGGTGAAAGAGAATGGGG + Intronic
1024875121 7:54013482-54013504 GGAGCGCTGGAAAGAAAATCTGG - Intergenic
1025528869 7:61850885-61850907 GGAGCTGTTTGAAGTCAATCAGG - Intergenic
1025806335 7:64837478-64837500 GGAGCTCTTGAAAGAGGAAGGGG + Intergenic
1026253972 7:68694802-68694824 TGAGCTGTTGAATGCAAATCTGG + Intergenic
1028488817 7:91388582-91388604 GAAGCTGTTGCTGGAGAATCAGG + Intergenic
1029691483 7:102184980-102185002 AAGGCTGTGGAAAGAGAATCTGG - Intronic
1032309805 7:130774497-130774519 GGAGTTGTTGAAGGAGGATGAGG - Intergenic
1033558833 7:142511811-142511833 TGATCTGTGGAAACAGAATCTGG - Intergenic
1033662971 7:143415662-143415684 GGAGCTGTTGGGAGAGAAAAAGG + Intergenic
1033767635 7:144511372-144511394 AGAGCTGAGGAAAGGGAATCTGG - Intronic
1034733860 7:153411470-153411492 GGAGCTCTTGAAAGAGGAAGGGG + Intergenic
1037678613 8:21074080-21074102 GGAGGTGTTTAAAAAGAGTCTGG + Intergenic
1037830311 8:22184423-22184445 GGAGCTGCAGAAAGAGAAAAGGG + Intronic
1038979800 8:32747334-32747356 GGGGCTCTAGAAAGAAAATCTGG + Intronic
1039576359 8:38626958-38626980 GGAGGTGTTCAAATAGAATTTGG + Intergenic
1041449717 8:57994353-57994375 GGAGATGTTGAGAGAGAGGCAGG + Intergenic
1041813144 8:61934950-61934972 GGAGAAGTTGAATGAGAATAGGG + Intergenic
1041857532 8:62475439-62475461 GAAGCTGTTGAAAAAAAGTCTGG - Intronic
1042226089 8:66515524-66515546 GTAGCTATTGAAAGAGCATGAGG - Intronic
1042860927 8:73313217-73313239 GGAGCTGTTGGAAGTTAATTTGG + Intronic
1043104088 8:76085904-76085926 GCAGAAGGTGAAAGAGAATCAGG + Intergenic
1043672941 8:82911306-82911328 AGAACTTTTGAAAGAGAATATGG - Intergenic
1043948727 8:86283663-86283685 GGGGCAGTGGAAAGAGAATCAGG + Intronic
1044577513 8:93786725-93786747 GGAGGTGTTGAAAATTAATCTGG - Intronic
1045657967 8:104406460-104406482 GGAGCAGGTGAAGGAGGATCCGG - Intronic
1047697452 8:127416986-127417008 GGAGCTAGGGAAAGAGAACCTGG + Exonic
1048425490 8:134319460-134319482 GGAGATGCTAAGAGAGAATCAGG - Intergenic
1051387572 9:16525658-16525680 GCAGCTGTTAAAAAAGAATGAGG + Intronic
1051415009 9:16830120-16830142 GGAGTTTTTGAAAGAAAATATGG - Intronic
1052593299 9:30526984-30527006 GGAGATGCTGAAAAAGAAACAGG + Intergenic
1055998077 9:82183529-82183551 GGCTCTGTTGAAAGAAAAGCTGG + Intergenic
1056439322 9:86604472-86604494 GGAGAAGGTGAAGGAGAATCTGG + Intergenic
1056448502 9:86690364-86690386 TGAGCTGATGAAAGAGAGTTGGG + Intergenic
1057461891 9:95270648-95270670 GGACCTGCTGAAAAAGAATGAGG + Intronic
1057731556 9:97613456-97613478 GGAGCATTTCAAAGAGAATATGG - Intronic
1058178254 9:101764057-101764079 GGGGCTGTTGAAACAGAGGCAGG + Intergenic
1058688064 9:107495242-107495264 GGAGCTGTTGAAAGACTGGCTGG - Intergenic
1059212240 9:112524201-112524223 GGTGCTGTTGAAATAAAATGTGG + Intronic
1059733758 9:117081667-117081689 TGAGCCCTTAAAAGAGAATCGGG + Intronic
1061083064 9:128383691-128383713 GGAGGTGTTCAAAGAGAGGCTGG + Intronic
1061865654 9:133490736-133490758 GGAGCTGGAGAAGGAGAAGCAGG + Intergenic
1186503701 X:10073088-10073110 GGAGCTGTAGAAAAAGTAGCAGG - Intronic
1189487284 X:41443314-41443336 GGAGCTATAGAAAGAGAACCGGG - Intergenic
1189757478 X:44285607-44285629 GGATCAGTTGAAAGATGATCTGG + Intronic
1190220703 X:48510699-48510721 CAAGATGTTGACAGAGAATCTGG - Intronic
1190364412 X:49678015-49678037 GGGGCTGATGAAAGGGAAACAGG - Intergenic
1194196855 X:90904626-90904648 GGAGATGTAGAAATAGAAACAGG - Intergenic
1195364674 X:104114624-104114646 GAAGCTGTTGCAAGCGAGTCTGG - Exonic
1196628507 X:117907224-117907246 GGAGCAGCTGAAAGAGAGTTGGG + Intronic
1196717612 X:118825757-118825779 GGAGCTGCTGCAAGCGAGTCCGG - Exonic
1196776885 X:119346361-119346383 GGAGATGGTGAAAGTCAATCTGG + Intergenic
1198504786 X:137290739-137290761 AGAGCTGTTGAAAGAAACTGGGG + Intergenic
1199238949 X:145524754-145524776 AGAGGTGTTGAAAGATAATCAGG + Intergenic
1200542704 Y:4478832-4478854 GGAGATGTAGAAATAGAAACAGG - Intergenic
1201770345 Y:17612379-17612401 GGAGCTCTTGAAAGAGGAAGGGG - Intergenic
1201831209 Y:18293608-18293630 GGAGCTCTTGAAAGAGGAAGGGG + Intergenic