ID: 1017894560

View in Genome Browser
Species Human (GRCh38)
Location 6:158668114-158668136
Sequence CAGTAAGAACAGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 617}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017894560 Original CRISPR CAGTAAGAACAGAGTGAAGA TGG Intronic
900640128 1:3684551-3684573 CAGAACGAACAGAGTGAAGCGGG + Intronic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
902559508 1:17268098-17268120 CAGTAAGAACAGTCAGAAGTGGG + Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903582293 1:24380651-24380673 CACCAAGCACAGAGTGAAGTAGG - Intronic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
904146100 1:28392940-28392962 CAGTAAGTTCCTAGTGAAGATGG + Intronic
904390145 1:30179520-30179542 CACTAAGAACAAAGTTTAGAGGG - Intergenic
904594416 1:31634116-31634138 CAGTAAGGACAGAGGGAAAAAGG + Intronic
904728285 1:32567197-32567219 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
904975775 1:34455202-34455224 CAGTCGGAAATGAGTGAAGACGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905993714 1:42362790-42362812 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907509639 1:54948631-54948653 GAGAAAGAACAGAGGAAAGAAGG - Intergenic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
907980330 1:59474063-59474085 CAGTTGGAACAGAGTGATGCAGG - Intronic
908512926 1:64863481-64863503 TAGTAAAAACAAAGTGAAGAGGG - Intronic
908529958 1:65025018-65025040 CAGTGAAAACAGAGCTAAGAGGG - Intergenic
908532012 1:65042871-65042893 CAGTCAGAACAAACTGAAGCCGG - Intergenic
908692745 1:66801189-66801211 GAATAAAAACAGAGTGAAAATGG + Exonic
908814086 1:68013815-68013837 CAGTCAAAAGAGAGTGAAGGGGG - Intergenic
908917968 1:69154725-69154747 CAGCAAAAACAGTGTTAAGAAGG - Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910627981 1:89328421-89328443 CATTAAAAGCAGAGTGTAGAGGG + Intergenic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
911824166 1:102460628-102460650 CAGTCAGTAAAGACTGAAGAAGG - Intergenic
911825450 1:102479343-102479365 CAGTGATAACAAAGTGATGATGG - Intergenic
912839908 1:113030242-113030264 AAGTAAAAACAAAGAGAAGAAGG - Intergenic
914723276 1:150306833-150306855 CAGTAAGAACAGAATCACTAGGG - Intronic
915535554 1:156533425-156533447 GAGGAAGGACAGAATGAAGATGG - Intronic
915669969 1:157479963-157479985 CAGTAAGAAAGGAGAGAAAAGGG - Intergenic
915848205 1:159291630-159291652 CAGTAAGCAGAGAGGGAATAAGG - Intronic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
917133795 1:171768632-171768654 CAGGAGGAAAAGAGTGAAGCAGG + Intergenic
917696940 1:177534854-177534876 CAGAAAGAAGAGCGTGAAGGGGG + Intergenic
917763656 1:178193596-178193618 AAGAAAGAACAGGGTGAAGGAGG - Intronic
917810253 1:178651510-178651532 CAGTAAGGACATTGTGAAGGGGG - Intergenic
917932442 1:179832295-179832317 GAAAAAGAAAAGAGTGAAGATGG + Intergenic
917991267 1:180381709-180381731 CAGTAAAAACAGTGTTAAGAAGG + Intronic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918797552 1:188922186-188922208 CAGTAGAAACAGAGTGTAAAAGG - Intergenic
918837032 1:189479857-189479879 CAGTAAGAATTTAGTCAAGATGG + Intergenic
919579151 1:199349615-199349637 CAGCAGGAAGAGAGTGAAGTGGG - Intergenic
919630668 1:199957406-199957428 CAGTAATAATATAGAGAAGAAGG - Intergenic
920708218 1:208270805-208270827 CAGCAAGAAAGGAATGAAGATGG + Intergenic
921111543 1:212043009-212043031 CAGTCAGAAGGGATTGAAGAGGG - Exonic
921684753 1:218076991-218077013 CAGTGAGAACAGATATAAGAAGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922177912 1:223211406-223211428 CAGTAAGTTCAGGGTCAAGAGGG + Intergenic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
1063008473 10:1997544-1997566 CAGGAAGAACAGTGTGCAGACGG - Intergenic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1064304427 10:14152582-14152604 CATTAAGAATAGAGAGAAGCCGG + Intronic
1064688455 10:17888798-17888820 CAGTAAGAACATAGTTAAAGTGG - Intronic
1064751220 10:18531181-18531203 CTGTAATAACAGAGTAGAGATGG - Intronic
1065765864 10:29028820-29028842 CAGTAGAGACAGAGTGAAGGGGG + Intergenic
1065867433 10:29926219-29926241 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1066510984 10:36095629-36095651 CAGGAAGAAGAGTGTGAAGCGGG - Intergenic
1066674261 10:37872044-37872066 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1068559233 10:58494533-58494555 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070947175 10:80402281-80402303 CAGCTAGAACATAGTGGAGATGG - Intergenic
1071318276 10:84424843-84424865 ATGTAAGCACTGAGTGAAGATGG + Intronic
1071437287 10:85659258-85659280 CAGGAAGAAGAGAGGAAAGATGG + Intronic
1073398607 10:103238872-103238894 CAGAAAGGAGAGAGTGAGGATGG + Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074100038 10:110347707-110347729 CACTTGGGACAGAGTGAAGAGGG - Intergenic
1074338741 10:112605309-112605331 CTGTAAGAACAGTGTTGAGAGGG + Intronic
1074649939 10:115509524-115509546 CAGGAATGAGAGAGTGAAGAGGG - Intronic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1076770521 10:132660767-132660789 CAGTCAGAACTGGGGGAAGATGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079590668 11:22178744-22178766 CAAGAAGTACAGAGTGAAGGTGG - Intergenic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080759908 11:35238402-35238424 CAGAAAGAAGAGGGTGAAGGTGG + Intergenic
1081104582 11:39049199-39049221 CATTAAGATCAGAAAGAAGATGG + Intergenic
1081291802 11:41335449-41335471 CAGTAAGCAGAGAATAAAGATGG - Intronic
1081441345 11:43084952-43084974 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1082089789 11:48079901-48079923 GAGGAAGCACAGAGTGAAAAGGG + Intronic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084279306 11:68076771-68076793 CAGAAAGGACATAGAGAAGAGGG + Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1086048116 11:82556962-82556984 CCTTAGTAACAGAGTGAAGAGGG + Intergenic
1087882848 11:103439134-103439156 CAGTAAGAGAAGAGTGATAAAGG + Intronic
1087962679 11:104371672-104371694 CAGTAACAACAGAGTGCAAGGGG + Intergenic
1088044668 11:105433771-105433793 CAGGAAGCACTGAGTGAAGGGGG + Intergenic
1088325459 11:108596239-108596261 CAAGAAGAGTAGAGTGAAGATGG + Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088838525 11:113602245-113602267 CTCTAAGAACAGAGTGAAGGTGG + Intergenic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089195971 11:116694269-116694291 CAGGCAGAACAGAGCCAAGAAGG + Intergenic
1089490771 11:118882480-118882502 CAGTAAGCAAGGTGTGAAGAGGG + Intergenic
1091369986 11:135049694-135049716 CTCTAAGAAAAGTGTGAAGAGGG + Intergenic
1091673507 12:2469708-2469730 TAGTAAAAACAGCCTGAAGAAGG - Intronic
1092019679 12:5190901-5190923 CATTAAGAAAACAGTGAAGTTGG - Intergenic
1092021945 12:5210142-5210164 CAGTAAAAATAGAGAAAAGATGG - Intergenic
1092708565 12:11309989-11310011 CAGTAAGTACACAGGGATGATGG - Intronic
1092712777 12:11355144-11355166 CAGTAAGTACACAGGGATGATGG - Intronic
1092716575 12:11395120-11395142 CAGTAAGTACACAGGGATGATGG - Intronic
1092982238 12:13808282-13808304 TAGTAAGAACAGAGTTAAGTAGG + Intronic
1093257317 12:16886004-16886026 AAGTCAGAAAAAAGTGAAGAAGG - Intergenic
1093303847 12:17487639-17487661 AAATAAAAACAGGGTGAAGAAGG + Intergenic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094042662 12:26133861-26133883 CAATGAGGACAGAGTGGAGAAGG + Intronic
1094126214 12:27024625-27024647 TAATAAGGACAGAGTGAATATGG + Intronic
1095190875 12:39256668-39256690 CAGAAATACCAGAATGAAGAGGG - Intergenic
1095196854 12:39329421-39329443 CACTAAGAACAAAGAGAAGGAGG + Intronic
1096541899 12:52312701-52312723 CAGTAAGGAGAGAGGAAAGAGGG + Intergenic
1096841912 12:54384971-54384993 CAGGAAGAAGAGAGTCAAGTGGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097064377 12:56309997-56310019 CAGCAAGAACAGAGACAGGAAGG - Exonic
1097137005 12:56865355-56865377 CAGGAAGAAAAGAGTGAAGGGGG - Intergenic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097259524 12:57709097-57709119 CTGAAAGAAAAGAGTAAAGAAGG - Intronic
1097475312 12:60047913-60047935 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1097894440 12:64810266-64810288 CTGTAAGAACAGAGAAAACATGG - Intronic
1098655843 12:73028284-73028306 CAGGAGGAAGAGGGTGAAGAGGG - Intergenic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099163943 12:79278505-79278527 CAGCAAGAGCAGAGCTAAGAGGG + Intronic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099724903 12:86412974-86412996 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100409124 12:94297000-94297022 TCTTAAGAACAGCGTGAAGATGG - Intronic
1101047985 12:100830565-100830587 CTGTAAGAACAGAGGGCTGATGG - Intronic
1101147658 12:101856223-101856245 CAGGAAGTGCAGAGTGAAGGTGG - Intergenic
1101166114 12:102035621-102035643 CAGGTAGCACAAAGTGAAGAAGG + Intronic
1101442333 12:104713052-104713074 CAGTAAGGACATAGGGAAAATGG + Intronic
1101509790 12:105382708-105382730 AAGTAAGAATACAGTCAAGACGG - Intronic
1102039901 12:109794128-109794150 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1102555016 12:113721023-113721045 CAGCAAGGACAGAATGATGAAGG + Intergenic
1102712779 12:114943083-114943105 CAATAAGAAGAGAGTGTGGAAGG + Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104223374 12:126807773-126807795 GAGTAAGAACAGACAGAATAGGG + Intergenic
1105246755 13:18659756-18659778 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106618309 13:31350702-31350724 AAGGAAGGACAGAGAGAAGATGG - Intergenic
1106849009 13:33768203-33768225 AAGTAAGAAGAGACTGAAGAGGG + Intergenic
1107226031 13:38048379-38048401 CAGTAAAAACAGCATTAAGAGGG + Intergenic
1107408129 13:40134256-40134278 CAGTAAGAAATGAGTGCACAAGG - Intergenic
1108618968 13:52162407-52162429 CAGTAAGAATAGACTGGTGAGGG + Intergenic
1108758825 13:53537716-53537738 CAGAAAGAAAAGAGAGAAGGGGG - Intergenic
1108842614 13:54638781-54638803 CAGGCAGAAGAGAGTGAAGCAGG + Intergenic
1109175538 13:59150828-59150850 CAGCATGAACAAAGTCAAGAAGG + Intergenic
1109620880 13:64903044-64903066 CAGTAAAAAAAGAATAAAGAAGG + Intergenic
1109651544 13:65333783-65333805 CAGAAAGAACAGATTCAATAGGG + Intergenic
1110892910 13:80712783-80712805 CAGGAGGAAGAGAGTGAAGGTGG + Intergenic
1111137212 13:84063639-84063661 CAGTAAAAACAGTGCTAAGAGGG - Intergenic
1111509678 13:89244289-89244311 CAGGAAGAAGAGAGCAAAGAGGG - Intergenic
1111571408 13:90091787-90091809 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1111790368 13:92847500-92847522 AAGGAAGAAGAGAGTGAAGGGGG - Intronic
1111820016 13:93201805-93201827 AATTATGAACAAAGTGAAGAGGG + Intergenic
1112317108 13:98372619-98372641 TAATAAGAAAAGAGGGAAGATGG + Intronic
1112769982 13:102784218-102784240 CAGTAAAAACAGAGAGAATCTGG - Intergenic
1112926623 13:104683179-104683201 CAGTAAGTAGAAAGTGAAGCTGG + Intergenic
1112988806 13:105485753-105485775 CAGGAAGAACACCGTGATGATGG + Intronic
1113149781 13:107250876-107250898 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1113369853 13:109713861-109713883 CAGGAGGAAGAGAGTGAAGCGGG + Intergenic
1113606143 13:111608386-111608408 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1113794982 13:113051538-113051560 CAGGAAATACACAGTGAAGAAGG - Intronic
1114719772 14:24868792-24868814 TAGTAAAAACAGAGAGAAAAGGG + Intronic
1114938699 14:27577599-27577621 CAGCAACAACAGTGTTAAGAGGG + Intergenic
1115054520 14:29106503-29106525 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1116007149 14:39306413-39306435 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1116338991 14:43698372-43698394 CAGTAAGCAGACAGTGAAGAAGG + Intergenic
1116662864 14:47734447-47734469 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1116775319 14:49173738-49173760 AAGAAAGAACACATTGAAGAGGG + Intergenic
1116918039 14:50544297-50544319 TAGTAAGGACAGAGAAAAGAGGG - Intronic
1117732603 14:58738796-58738818 CAGAAAGAACGGACAGAAGAAGG + Intergenic
1117901162 14:60534929-60534951 CAAGAAGTACAGAGTGAAGTGGG - Intergenic
1118337912 14:64870107-64870129 CTGTAAGAAAGGAGTGAAAAGGG + Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120414978 14:84207873-84207895 AATTAAGAATAAAGTGAAGAGGG + Intergenic
1120625803 14:86824677-86824699 CTTAAAGAACCGAGTGAAGATGG - Intergenic
1120925806 14:89796142-89796164 GAGGAAGAACAGGGTGATGAGGG - Exonic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122045513 14:99020479-99020501 CAGGAAGAAGAGAGCCAAGAGGG + Intergenic
1122198771 14:100109227-100109249 CAGGGAGGACAGACTGAAGAAGG - Intronic
1122945382 14:105006240-105006262 TGGGAAGAACAGGGTGAAGACGG + Intronic
1126313305 15:47340794-47340816 CAGAAAGGACAGAGTGAGGGTGG - Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1128522191 15:68382805-68382827 CAGGAAGAAAAGATTCAAGAGGG + Intronic
1128764075 15:70240362-70240384 CAGGAAGAACAGGGAGAAGTGGG - Intergenic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129951181 15:79592913-79592935 CAGTAAGAACAGAGTCTAATAGG + Intergenic
1130146398 15:81277266-81277288 TAGAAAGAATAGAGTGAAAAGGG + Intronic
1131066170 15:89436164-89436186 GAGGAAGGACAGAGTGAAGGAGG + Intergenic
1131561159 15:93441370-93441392 CAGTGAGAACTGAGTGTATATGG + Intergenic
1132349597 15:101131351-101131373 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1132363681 15:101239896-101239918 CAGGAAGAACACAGTGAAAGAGG + Intronic
1133174072 16:4000587-4000609 CAGTAAGAACAGACAGCAGATGG + Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135055594 16:19229401-19229423 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1135385785 16:22038313-22038335 GAGTAAGACAACAGTGAAGATGG + Intronic
1135507987 16:23055613-23055635 CAGCAGGAACAGACTAAAGATGG + Intergenic
1135681980 16:24465253-24465275 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137534013 16:49303689-49303711 AAGTAGGAACAGAGTAAAGAAGG + Intergenic
1138577635 16:57918552-57918574 CAGCACGACCAGAGTGAAAAAGG + Intronic
1139132062 16:64158474-64158496 CAATAATATCAGAGTTAAGAGGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1142785763 17:2221343-2221365 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1142952497 17:3495070-3495092 CAATAATGACATAGTGAAGAAGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144162694 17:12577312-12577334 CAGTCAGAACTGTGTAAAGATGG + Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1144833612 17:18145088-18145110 TGGTCAGAACAGAGTCAAGAGGG + Intronic
1145304673 17:21666914-21666936 CAGTTAGCTCTGAGTGAAGATGG - Intergenic
1145995895 17:29104770-29104792 GAGTGAGAACAGAGTCAAGGGGG + Intronic
1146734351 17:35224921-35224943 CAGACAGATCAGACTGAAGAAGG - Intergenic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147549916 17:41433608-41433630 CACTAACAACAGAATGAAGAGGG - Intergenic
1147868418 17:43569843-43569865 AAGAAAGAAAAGAGTGAAGGAGG - Intronic
1148473781 17:47913406-47913428 CAGTAAGTACAGAAATAAGAGGG - Intronic
1149178232 17:53901241-53901263 GAGGAAGAAGAGAGTGAAGTGGG - Intergenic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1153185678 18:2483485-2483507 CATGAAGAAAAGAGTGATGAGGG - Intergenic
1154442102 18:14399366-14399388 GAGTCAGAGTAGAGTGAAGAAGG + Intergenic
1155396041 18:25387741-25387763 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1156151725 18:34251070-34251092 CAGGAAGAAGAGAGAGAATAGGG + Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156275020 18:35576071-35576093 TTGTTACAACAGAGTGAAGATGG - Intergenic
1156393800 18:36678879-36678901 AGATAAGAACAGTGTGAAGACGG - Intronic
1156740533 18:40322030-40322052 AAGAAAGAAGAGAGTGAAGGGGG - Intergenic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1156876404 18:42019001-42019023 CATGAAGAACAGAGTGGAAATGG - Intronic
1156958776 18:42997447-42997469 AAGAAAGAAGAGAGAGAAGAAGG + Intronic
1157482538 18:48064764-48064786 CAATAGGAACAGGGAGAAGAAGG + Intronic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1158258729 18:55585536-55585558 AAGAAAGAACAGAGTGATAATGG - Intronic
1158493870 18:57935347-57935369 AAGTAAGAAAAGAGTGAATTGGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159738016 18:72127678-72127700 AAGTAAGAAAAGAGAAAAGAAGG - Intergenic
1160111940 18:76041346-76041368 CAGTAAGAGCAGAATTAATATGG + Intergenic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162800513 19:13107792-13107814 CTGTAAGAACGCTGTGAAGACGG - Exonic
1163054632 19:14709095-14709117 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166195968 19:41206172-41206194 CAGTAAGCCCAGGGTGCAGAAGG - Intronic
1167909244 19:52688614-52688636 GAGAAGGAATAGAGTGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
925350031 2:3194544-3194566 CTGGAAGGACACAGTGAAGAAGG + Intronic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
926545846 2:14238797-14238819 CAGGAGGAAAAGAGTGAAGCAGG - Intergenic
926665340 2:15515884-15515906 TAGGAAGCACAGAGTGAAGAAGG + Intronic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
927295243 2:21445933-21445955 AGGTAAGAACAAAGTGGAGATGG - Intergenic
928238076 2:29562610-29562632 TGGAAAGAAGAGAGTGAAGAAGG + Intronic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
929463785 2:42126589-42126611 ATGTAACAACAGAGTCAAGAGGG + Intergenic
930036821 2:47091089-47091111 AAGAAAGAACAGAGAGAGGAAGG + Intronic
930868875 2:56149897-56149919 CAGGAAGAACAGAATGAAGGTGG + Intergenic
931012633 2:57935193-57935215 TAGTCAGAAAAGACTGAAGAAGG - Intronic
931227198 2:60341721-60341743 CAGTAAGAATACACTGGAGAGGG - Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931450713 2:62365555-62365577 CTGTAAGAACATAGGGCAGAGGG + Intergenic
932579103 2:72982081-72982103 CAGGAGGAACAGAGTGGAGCTGG + Intronic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933591155 2:84233990-84234012 CAGTAAAAACAAAATGAAGTTGG + Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935013430 2:99156928-99156950 CAGTAAGCACAGAATAGAGATGG + Intronic
935115866 2:100135793-100135815 CGCTAAGAACAGTGTGAAGGAGG + Intronic
935325071 2:101928411-101928433 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
935410596 2:102757881-102757903 CAGGAAAAAGAGAGTGAAGTGGG + Intronic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
935654067 2:105406851-105406873 CAGGCAGAAGAGAGTGAGGAAGG - Intronic
935697387 2:105782085-105782107 TAGTAAGAACAGAGTAAGGAAGG - Intronic
935789302 2:106576272-106576294 CGGTAAGAACAGAGAGGAGAAGG + Intergenic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
936895482 2:117422911-117422933 CACTGAGAACAAAGTGAGGAAGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
938450830 2:131418217-131418239 CAATAAGGACCGAGTGAAGGAGG + Intergenic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939214417 2:139217773-139217795 CGGAAAGAAGAGAGTGAAGCAGG - Intergenic
939273022 2:139964150-139964172 GAGAAAGAACAGAGTAAAGCCGG + Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939822167 2:146970536-146970558 CAGGAGGAAGAGGGTGAAGAGGG + Intergenic
940186397 2:150989038-150989060 CAGCAAAAACAGTGTTAAGAGGG + Intergenic
940616979 2:156060944-156060966 CTGTAAGAACAAATTGAAGCTGG + Intergenic
940910632 2:159206539-159206561 CAGCAAGAACAGCTTGATGAAGG - Intronic
941196280 2:162456088-162456110 CAGTTAAAACAGTGTTAAGAGGG - Intronic
941602602 2:167561295-167561317 CAGTCAGAGCAGTGTGTAGACGG + Intergenic
942409235 2:175690553-175690575 CAGTAATAACAGAGAAATGAAGG - Intergenic
942624476 2:177884792-177884814 CAGTAAAGACACAGTGAAGAAGG + Intronic
942855760 2:180545527-180545549 CACTAAGCACCGACTGAAGAAGG - Intergenic
942868423 2:180705071-180705093 CAGAAATAAAAGAGTGAGGAAGG + Intergenic
943128603 2:183827988-183828010 CAGGAAAGAGAGAGTGAAGAGGG + Intergenic
943828019 2:192420804-192420826 CAGGCAAGACAGAGTGAAGATGG - Intergenic
944199885 2:197095305-197095327 CAGTGAGAAAAGAATAAAGATGG + Intronic
944364276 2:198898260-198898282 AAGGAAGAAAAGAGAGAAGAAGG + Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
945112031 2:206369109-206369131 CAGTCAGAGCACACTGAAGAGGG + Intergenic
945529966 2:210940504-210940526 GAGGAAGAAGAGAGTGAAAAGGG - Intergenic
945547381 2:211173322-211173344 CAGGGAGTACAAAGTGAAGAGGG - Intergenic
946130611 2:217603817-217603839 GACGAAAAACAGAGTGAAGAAGG + Intronic
946214084 2:218170128-218170150 AAGAAAGTACAGAGAGAAGATGG - Intergenic
947048605 2:226017721-226017743 GAGAAAGAACTGAGTGAAGGGGG + Intergenic
947090472 2:226504661-226504683 AAGCAAGAACAGAGAGAAAAGGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947739780 2:232479858-232479880 CAGCAAGAACACAGCGAAGGTGG + Exonic
948842661 2:240662730-240662752 CAGTAAGAGCACAGTTAGGAGGG - Intergenic
1169424754 20:5487104-5487126 GAGCAAGGACAGAGGGAAGAAGG - Intergenic
1169425927 20:5497402-5497424 CAGCAGGAACTGAGAGAAGAAGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170053573 20:12174191-12174213 CAGATAGAACAGGGTGAATAAGG + Intergenic
1170446876 20:16437476-16437498 GAATAAGAACAGAGTAAAAAGGG + Intronic
1170487413 20:16832826-16832848 GAAGAAGAAAAGAGTGAAGAAGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171490861 20:25516107-25516129 CAGGAGGAATAGAGTGAAGCGGG - Intronic
1171522187 20:25784354-25784376 CAGTTAGCTCTGAGTGAAGATGG - Intronic
1171529937 20:25846299-25846321 CAGTTAGCTCTGAGTGAAGATGG - Intronic
1171554640 20:26071529-26071551 CAGTTAGCTCTGAGTGAAGATGG + Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1173139600 20:40470663-40470685 CAGTAAGAACAGAGTGCACTGGG + Intergenic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1174981582 20:55401479-55401501 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1175518660 20:59585542-59585564 CATTAACAAGAGAGTGAACAGGG - Intronic
1176134340 20:63514655-63514677 CAGCAGGAAGAGAGTGAAGGGGG + Intergenic
1176453969 21:6891806-6891828 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1176693017 21:9940871-9940893 CAGTAAGGACTAAGTGAGGATGG + Intergenic
1176832144 21:13756854-13756876 GAGTCAGAGTAGAGTGAAGAAGG - Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1176992255 21:15511399-15511421 GAGTAAGAACAGAATGAAAAAGG + Intergenic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1177798526 21:25804709-25804731 AAGAAAGAAATGAGTGAAGAAGG + Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178078549 21:29036648-29036670 CAGTAAGAACAGTGTAAGGCAGG - Intronic
1178748217 21:35274223-35274245 GAGCAAGAGCAGAGTGAACAAGG - Intronic
1178802277 21:35807267-35807289 CAGAAAACACAAAGTGAAGATGG + Intronic
1178899155 21:36585097-36585119 CAGGAAGAACAGAGCAAACATGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179432496 21:41333457-41333479 CAGAAACAAGAGAGAGAAGAGGG - Intronic
1181983043 22:26779842-26779864 CAGAGAGAACAGAGTGCACAAGG - Intergenic
1182407872 22:30153184-30153206 CAGTAAGAACAGGCTGGAAAGGG - Intronic
1182793252 22:32970947-32970969 TAGTAAGAATGCAGTGAAGATGG - Intronic
1182822881 22:33233866-33233888 CAGGAAGAACCAATTGAAGATGG - Intronic
1183050070 22:35253742-35253764 CTGAGAGAACAGAGTTAAGAGGG + Intergenic
1183240488 22:36654199-36654221 TAGTACAAACAGATTGAAGAGGG - Intronic
1183719271 22:39552897-39552919 CAGAGAGAAAAGAGTGGAGAGGG - Intergenic
949127826 3:467770-467792 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
949147885 3:725565-725587 CTGCAAGGGCAGAGTGAAGAGGG - Intergenic
949163525 3:910235-910257 GAGTAAGAACAGAGTGAGATCGG - Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949466203 3:4346518-4346540 CAGCTAAAACAGAGTTAAGAGGG + Intronic
949717780 3:6953237-6953259 CAGTTAGAAGACAGAGAAGAGGG + Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950237601 3:11337086-11337108 AAGAAAAAACAGAGTTAAGATGG - Intronic
950342169 3:12257327-12257349 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
951382876 3:22006606-22006628 CAGAAAGAAGAGAGTTAAGTAGG + Intronic
952082101 3:29771803-29771825 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
952507779 3:34023416-34023438 CAGTAAGAAAAGTGGGTAGAAGG + Intergenic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953179261 3:40581337-40581359 ATGTAAGAACAGAATCAAGAGGG + Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
955005551 3:54965407-54965429 CAGTAAGAAGCCAGGGAAGATGG - Intronic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
956098934 3:65747294-65747316 CTGTAAGATGAGAGTGAAAAGGG - Intronic
956353654 3:68366375-68366397 CAGAAAGAACAGAGGGCACAAGG + Intronic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957149940 3:76473842-76473864 AAGTTAGAACAAAGTGCAGATGG + Intronic
957174344 3:76786468-76786490 CAGAAAGAAGAGAGAGAAGGGGG + Intronic
957434507 3:80156399-80156421 AAGTAAGAGCAGAGCAAAGAAGG - Intergenic
957573739 3:81983102-81983124 CAGGAAAAACACATTGAAGAGGG - Intergenic
957925139 3:86799385-86799407 CAGAAAGAACATAGAGAAAAGGG - Intergenic
958472646 3:94540839-94540861 GAGTAAGAACTGATAGAAGAAGG - Intergenic
958665047 3:97126845-97126867 CAGTAAGAGCATAAAGAAGATGG + Intronic
958686018 3:97395811-97395833 AAGAAAGAAAAGAGTAAAGAAGG + Intronic
959176974 3:102925476-102925498 CATTAATAACAAAGTGAACAAGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960316160 3:116179619-116179641 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
960828164 3:121814257-121814279 CAGCTAGAACAGTGTGTAGAGGG + Intronic
962721045 3:138175093-138175115 CAGGAAGAAAAGAGTAAGGATGG - Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963690930 3:148501971-148501993 CAGAAAGGACAGAGTGAACCTGG + Intergenic
963913655 3:150837887-150837909 CAGTTAAAACAGTGTTAAGAGGG - Intergenic
963993379 3:151679278-151679300 CAGCATCAACAGAGTTAAGAGGG + Intergenic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
965635584 3:170777186-170777208 CAGTAAGAAAGGAGTTAGGAAGG + Intronic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966183983 3:177212078-177212100 CAATCAGAACAGAGAGCAGAGGG + Intergenic
967381727 3:188866415-188866437 CAGTAAGAACAGACTCCAAAAGG - Intronic
968334136 3:197898910-197898932 CAGTAAGAAAAAAGGAAAGAAGG + Intronic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
970099661 4:12505616-12505638 GAGTGAGAAAAGAGTGAAGGAGG - Intergenic
970105164 4:12574438-12574460 AAGGAAGAAGAGAGTGAGGAGGG + Intergenic
970153071 4:13110591-13110613 CAGTAAAAACAAGGTGAAAAAGG + Intergenic
970153174 4:13112324-13112346 CAGTAAAAACAAGGTGAAAAAGG + Intergenic
970820446 4:20205631-20205653 CAGTTAAAACAGAGAAAAGAGGG + Intergenic
971239144 4:24872049-24872071 AAGGAAGAGCAAAGTGAAGAAGG + Intronic
971533065 4:27713674-27713696 CAGCAACTAGAGAGTGAAGAGGG + Intergenic
974074532 4:57156648-57156670 CTTTAAGAAAACAGTGAAGATGG - Intergenic
974356414 4:60818484-60818506 TGTTAAGAACAGAATGAAGAGGG - Intergenic
974438687 4:61889321-61889343 CAGAAAGAACAGGGTGCAGCTGG + Intronic
975804696 4:78099667-78099689 CAGTGAGAACATAGTAAAGTGGG + Intronic
976025058 4:80677095-80677117 CAGTAAGAGCAGTGCTAAGAGGG - Intronic
976261421 4:83148610-83148632 AAGGAAGTACAGAGTGAAGGAGG + Intergenic
976775194 4:88699021-88699043 GAGGAAGAAGAGGGTGAAGAGGG - Intronic
976775203 4:88699069-88699091 GAGGAAGAAGAGGGTGAAGAGGG - Intronic
976775212 4:88699117-88699139 GAGGAAGAAGAGGGTGAAGAGGG - Intronic
976775221 4:88699165-88699187 GAGGAAGAAGAGGGTGAAGAGGG - Intronic
977400638 4:96527115-96527137 ATTTAAGAACAGAGAGAAGAAGG + Intergenic
977506834 4:97912735-97912757 CAGAAAGAACAGAATCAAGTTGG + Intronic
977517688 4:98042470-98042492 CAGCAAAAACAGTGTTAAGAGGG - Intronic
977580003 4:98714506-98714528 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
977962286 4:103099650-103099672 CAGTTAGATCAGTGTAAAGATGG - Intronic
978099213 4:104816320-104816342 CAGGAAGAACAGAGATGAGAGGG + Intergenic
978344733 4:107755416-107755438 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
979563882 4:122132290-122132312 CAGAAAGAACCGAATTAAGATGG - Intergenic
979595321 4:122528258-122528280 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
980365618 4:131801088-131801110 CAGTAAGGACTAAGTGAGGATGG + Intergenic
980406909 4:132365700-132365722 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
980973925 4:139592748-139592770 CAGAGAGAACAGTGTGAAAAAGG + Intronic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
981680349 4:147390338-147390360 CAATAAGAATAAAGGGAAGAAGG + Intergenic
981792107 4:148549860-148549882 CAGCACGTACAGAATGAAGAAGG - Intergenic
981816529 4:148837225-148837247 CAGAAAGAACACACTGAAGGTGG - Intergenic
982291127 4:153783776-153783798 CACAAAGAACAGAGGCAAGATGG + Intronic
982429901 4:155310911-155310933 CAGTAACTAGAGAGAGAAGAGGG + Intergenic
982843973 4:160226167-160226189 CAGTAAGTAGGGAGTGAACAGGG + Intergenic
983294591 4:165850143-165850165 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
983461823 4:168034353-168034375 AAGTAAAAACAGAGTTAAGAAGG - Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983569361 4:169187961-169187983 CAGAGACATCAGAGTGAAGAAGG + Intronic
983907745 4:173202518-173202540 GAGACAGAAAAGAGTGAAGAGGG - Intronic
984177024 4:176431748-176431770 AAATAAGAACAAAGTGAAGGTGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984384665 4:179040731-179040753 TAGTAAGAACAGACTGAGGCAGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985839763 5:2297719-2297741 CACTGATTACAGAGTGAAGATGG - Intergenic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986100325 5:4602605-4602627 CACAAAGAAGAGAGTGAAGCAGG + Intergenic
986511598 5:8512798-8512820 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
986680575 5:10229468-10229490 CAGTAACCACACAGTGAAGGTGG + Intronic
987135364 5:14894907-14894929 CAGGAAGAATAGAGTAATGAGGG + Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
987852251 5:23371229-23371251 CAGAAAGAACACAGTTAGGATGG - Intergenic
988027840 5:25722263-25722285 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
988078767 5:26388710-26388732 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
988282889 5:29173101-29173123 GAATGAGAACTGAGTGAAGAAGG + Intergenic
988436781 5:31185097-31185119 CAGTAAGAATATAGAGAAAAGGG + Intergenic
988658280 5:33236457-33236479 CAGTAAGAACAGAATATATAAGG + Intergenic
989144345 5:38234045-38234067 GAATGAGAACAGAGTGAAGGGGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989717559 5:44482161-44482183 CTGTAAGCACACAGTGATGAGGG + Intergenic
990110169 5:52313567-52313589 CATTCAAAACAGAGTGTAGAGGG + Intergenic
991163304 5:63531228-63531250 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991534239 5:67648991-67649013 CAATGACAACAGAGTGAAGAGGG - Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992836531 5:80647318-80647340 AAGAAAGAACAGCATGAAGATGG + Intronic
992959697 5:81946367-81946389 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
993189985 5:84669435-84669457 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993805066 5:92397056-92397078 CAGTAAGATCAGAGATAAGTTGG - Intergenic
994139879 5:96330404-96330426 TAGTAAGAACAGAGGAAACATGG + Intergenic
994266307 5:97720941-97720963 CATTAAAAGCAGTGTGAAGAGGG - Intergenic
994597000 5:101852085-101852107 CAGTAATAACAAAGTGTAAAGGG + Intergenic
994849932 5:105041353-105041375 GAATAAGAACATACTGAAGAAGG - Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995152955 5:108872674-108872696 CAAAAACAACAAAGTGAAGAAGG - Intronic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995272591 5:110238824-110238846 AAATAAGAACAGAATAAAGAAGG - Intergenic
995477451 5:112562518-112562540 CAGGAGGAAGAGAGTGAAGCGGG - Intergenic
995545982 5:113231548-113231570 CTGTAGGAACAAAGTGAACATGG - Intronic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
997273624 5:132563902-132563924 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
997285680 5:132676503-132676525 GAGTGAGGACTGAGTGAAGAGGG - Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
998521976 5:142809414-142809436 CAGGAAGAACAGAGTGCTGCTGG - Intronic
998803965 5:145900272-145900294 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
998930235 5:147173481-147173503 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1000739991 5:164956798-164956820 CAGTAAAACCAGAGTTTAGATGG + Intergenic
1001794617 5:174491636-174491658 CAGAAAGAACCGGGTGAAGGTGG - Intergenic
1001988804 5:176098715-176098737 AACTAAGAACTGATTGAAGATGG + Intronic
1002228064 5:177739421-177739443 AACTAAGAACTGATTGAAGATGG - Intronic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003019732 6:2499252-2499274 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1003272541 6:4620112-4620134 CACTACGAACAGAAAGAAGAGGG + Intergenic
1003714247 6:8628772-8628794 CAATAAGAACAGGCTGAAGAAGG - Intergenic
1003744893 6:8989721-8989743 AAGGAAGAAGAGAGTGAAGGAGG + Intergenic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004076990 6:12352718-12352740 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1004201152 6:13549226-13549248 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1005140565 6:22626888-22626910 TATTAATAACAGAGTGGAGATGG - Intergenic
1006825876 6:36936095-36936117 CAGTTACAACAGAGTAAAGATGG - Intergenic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1009449478 6:63784592-63784614 CAGGAGGAAAAGAGTGAAGGGGG + Intronic
1009894304 6:69728164-69728186 CAGGAAGAAGAGAGTGAAGTGGG + Intronic
1010887756 6:81264282-81264304 TAGGAAGAAAAGAGAGAAGAAGG + Intergenic
1011169333 6:84488734-84488756 AATTGAGAACAGAGTGAAGGGGG + Intergenic
1011762190 6:90579253-90579275 CTTTAAGAAAAGAGTGAAGTTGG + Intronic
1011848800 6:91600719-91600741 CAGGAGGAAGAGAGTGAAGGTGG - Intergenic
1012156932 6:95830880-95830902 CAGGAAGAAGAGAGTCAAGGGGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012763672 6:103335622-103335644 CAGGAGCAACAGAGTGAAGGAGG + Intergenic
1013064004 6:106665556-106665578 CAATAAGAAATGAATGAAGAAGG + Intronic
1013567508 6:111382403-111382425 GAGACAGAACAGAGTGAATATGG + Intronic
1013967437 6:115971898-115971920 GACTAAGAGCAGAGAGAAGAGGG + Intronic
1014331587 6:120073540-120073562 CAGTAAGCACAAACTGAAGTAGG + Intergenic
1015050839 6:128837599-128837621 CAGTAGGAAGAAAGTGAAGTGGG - Intergenic
1016527075 6:145013789-145013811 AAGTAAGATTAGAGAGAAGAAGG - Intergenic
1016633760 6:146263104-146263126 TTCTAAGAACAGAGTCAAGAAGG - Intronic
1016737504 6:147495156-147495178 GAGTAAAAACTGAGTGAAGGGGG + Intergenic
1016931399 6:149414241-149414263 GAGGAAGAACGGAGTAAAGAAGG - Intergenic
1017355500 6:153501632-153501654 AAATAGGAAAAGAGTGAAGATGG + Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019254838 7:42815-42837 CAGTAAAAACAGAGAAAAGGTGG + Intergenic
1019692410 7:2423646-2423668 CAGGAAGCACTGAGTGAAGGTGG + Intronic
1019964055 7:4484571-4484593 GAGGAAGAAGAGAGTGGAGAGGG + Intergenic
1020458444 7:8400928-8400950 GAATAAGAAAAGAATGAAGATGG - Intergenic
1022759165 7:33328250-33328272 CAGTAAGAAGAGAGTGCAATGGG - Intronic
1023275538 7:38515411-38515433 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023613119 7:41991715-41991737 CACTAATAAAATAGTGAAGAAGG + Intronic
1023620745 7:42069655-42069677 AAAGAAGTACAGAGTGAAGATGG + Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024666797 7:51555283-51555305 CATTTAAAACAGAGTGTAGAGGG - Intergenic
1025302040 7:57825888-57825910 CAGTTAGCTCTGAGTGAAGACGG + Intergenic
1025638173 7:63342847-63342869 CAGTGAAGACAGAGTGAAGCAGG + Intergenic
1025644523 7:63405242-63405264 CAGTGAAGACAGAGTGAAGCAGG - Intergenic
1026054281 7:66971084-66971106 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1026128598 7:67601485-67601507 CAGTAAGAGCAGTGTGAACCAGG - Intergenic
1027586181 7:80061681-80061703 CAGTAAGGAAAGAGAGAAGCAGG + Intergenic
1029050799 7:97684603-97684625 CAATAAGCAGAGATTGAAGAAGG + Intergenic
1029596848 7:101542577-101542599 CACTCAGAACAGAGGGCAGAGGG - Intronic
1030021481 7:105279235-105279257 CAGGCAGAAGAGAATGAAGAAGG + Intronic
1030695202 7:112577634-112577656 CAGGAGCAAGAGAGTGAAGAGGG + Intergenic
1031310757 7:120194397-120194419 CAGGAAGAAAAGAGTGAGGGAGG - Intergenic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1031716361 7:125113773-125113795 AAGAAAGAACAGAATAAAGAGGG + Intergenic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1032926073 7:136606421-136606443 CAAAAAGAACAGGGTGCAGAGGG + Intergenic
1033246345 7:139719435-139719457 CAGAGAGAACAGAGTCAAAACGG - Intronic
1033483519 7:141764871-141764893 AAGTAAGAAGAGAAAGAAGAAGG - Exonic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1035587830 8:789348-789370 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1036617235 8:10397927-10397949 CATTAACAAGAGAGGGAAGAGGG - Intronic
1036666741 8:10749480-10749502 CAGTAAAAACAGTATTAAGAGGG - Intronic
1037131950 8:15417180-15417202 CAGGAGGAAGATAGTGAAGAGGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037482815 8:19320695-19320717 TAGTGAGAACGGAGTGAGGAGGG - Intronic
1037609031 8:20460899-20460921 TAGAAAGAGCAGAGTGAACAAGG - Intergenic
1037719126 8:21427839-21427861 CAGAAAGAACAAAGTCAAAATGG - Intergenic
1038078251 8:24102264-24102286 CATTTAGAACTGAGTGAAGTAGG + Intergenic
1038917074 8:32036527-32036549 CAGGAAGAACAGAATCAAGTTGG - Intronic
1038973768 8:32668450-32668472 CAGTAAGCACACAGCCAAGAGGG - Intronic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1041386797 8:57312787-57312809 CAGAAGGAAGAGAGTGAAGTAGG - Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1042469724 8:69171881-69171903 CAGTAAAAGCAGTGTGAAGAGGG - Intergenic
1043705733 8:83347623-83347645 CATTAAGCACAGATTGAAAATGG - Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044108437 8:88240444-88240466 CAGCAAGGACAGAGTGGAGAGGG + Intronic
1044548986 8:93491242-93491264 GAATAAGAACAGGGCGAAGAGGG - Intergenic
1044681712 8:94785667-94785689 CAGAAAGAACAGATTGAAGCAGG + Intronic
1045431861 8:102122525-102122547 CAGCAGGAACTGAGAGAAGAGGG + Intronic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1045889280 8:107135194-107135216 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1046662415 8:116962486-116962508 CAGTAAGAACAGTTTGGGGACGG - Intronic
1046783282 8:118238808-118238830 CACAAAGAAAATAGTGAAGATGG + Intronic
1046926554 8:119795917-119795939 CAGTAAGAACAGAGTTGGGCAGG - Intronic
1048021692 8:130545539-130545561 CAGAAACAAGAGAGTCAAGAGGG - Intergenic
1048526377 8:135206601-135206623 CAGAAAGAAGAGCGTGAAGGGGG - Intergenic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1051019337 9:12522629-12522651 TAGTAAGAACCAAGTGAATAGGG + Intergenic
1051165038 9:14252908-14252930 CAGTAAGAAAAGACTGGTGATGG + Intronic
1051547397 9:18291973-18291995 TAATAAGAACTGAGTGAAGTAGG + Intergenic
1052426022 9:28306418-28306440 CAGTCAAAACAGTGTGTAGAGGG + Intronic
1052477862 9:28984076-28984098 AAATGAGAAGAGAGTGAAGAAGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053278555 9:36801472-36801494 CAGGAAGAGCAAAGAGAAGATGG + Intergenic
1053291510 9:36882477-36882499 CAGAAACAACAGTGTGGAGATGG - Intronic
1054673562 9:67831632-67831654 CAGTAAGGACTAAGTGAGGATGG + Intergenic
1055136522 9:72835274-72835296 TGGGATGAACAGAGTGAAGATGG - Intronic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056891587 9:90499134-90499156 GAGTGAGGACAGACTGAAGACGG - Intergenic
1057055816 9:91959868-91959890 TATTAAGAACAGAGAGAAGCAGG - Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1059117314 9:111611291-111611313 AAGAAAGAAAGGAGTGAAGATGG - Intergenic
1059620178 9:115996004-115996026 CAGTAAAAACTGAGTTATGATGG - Intergenic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059901313 9:118929206-118929228 AAGAAAGAACAGAGAGTAGAGGG - Intergenic
1059917721 9:119122349-119122371 CAGTAAGAGCACAGGGAATAAGG - Intergenic
1060049238 9:120365599-120365621 CAGAAAGGAGAGAGAGAAGAGGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060385040 9:123218162-123218184 TAGTAAGAAGAGAGAGAAGGAGG - Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1062097913 9:134712262-134712284 CAGGAAGAAGAGAGTCAGGAAGG - Intronic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1186157739 X:6743175-6743197 CAATAAGAACAGAGCAAAGCAGG - Intergenic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1186515747 X:10165140-10165162 CGTCAAGAACAGTGTGAAGATGG - Intronic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187277854 X:17832170-17832192 CACTGATAACAGAGTGAAAAGGG + Intronic
1187539620 X:20179402-20179424 CAGTCAGGAAAGAGTGCAGAGGG + Intronic
1188115456 X:26237996-26238018 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1188168846 X:26895618-26895640 CAGCAAAAGCAGTGTGAAGAGGG + Intergenic
1188427168 X:30062314-30062336 CTGTAACTACAGAGTGAAGGTGG + Intergenic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189069797 X:37851235-37851257 CAGGAAGAAGAGAGAGAGGAGGG - Intronic
1189139868 X:38592049-38592071 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1189195317 X:39147616-39147638 AAGTAAGAGCACAGTGAAGGGGG + Intergenic
1189618803 X:42813825-42813847 CAGTTAGAGCAGTGTGTAGAGGG - Intergenic
1190067386 X:47250794-47250816 CAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1190153915 X:47972504-47972526 CCCTAAGAACAAGGTGAAGAAGG + Intronic
1190569225 X:51764865-51764887 CAGGCAGAAAAGAGTTAAGAGGG - Intergenic
1192040476 X:67615382-67615404 CAGAAATAACAGAGAGCAGAAGG + Intronic
1192097469 X:68227745-68227767 CAGTTAGAGCAGTGTGTAGAGGG + Intronic
1192121923 X:68464554-68464576 CAGCCAGATCAGAGTGAGGAGGG + Intergenic
1192755239 X:74040229-74040251 CAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1193060521 X:77201727-77201749 CAGCAAGGACAGTGTTAAGAGGG - Intergenic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1193861266 X:86671539-86671561 CAGGAGGAACAGAGTAAAGGGGG - Intronic
1194790737 X:98146267-98146289 AAGTAAGAAAAGAGGGAAGGAGG + Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1196081450 X:111637225-111637247 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1196630644 X:117935621-117935643 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1197692312 X:129515094-129515116 CAGGAAGCACAGAGTCAAGATGG - Intronic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1198482491 X:137053483-137053505 CATTAAGAACACAGAGAAGGGGG - Intergenic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198675920 X:139130009-139130031 TAGTAAGAACTGAATGAATAGGG + Intronic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1199135909 X:144252937-144252959 GGGTAAGAAGAGAATGAAGAAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199740401 X:150730139-150730161 CAGGAAGAACAGAGTAAACTAGG + Exonic
1200273357 X:154709136-154709158 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic