ID: 1017903071

View in Genome Browser
Species Human (GRCh38)
Location 6:158734832-158734854
Sequence TACCATTTATTGAAAGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017903067_1017903071 23 Left 1017903067 6:158734786-158734808 CCTCAATAAATGTTTGTTGAGTG 0: 1
1: 15
2: 111
3: 375
4: 1092
Right 1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017903071 Original CRISPR TACCATTTATTGAAAGCCCA AGG Intronic
901586599 1:10299849-10299871 TGGCATTTAATGAAAGCCGAAGG + Intronic
902472054 1:16655737-16655759 TACAATGAATTGAAAGCTCATGG - Intergenic
902486749 1:16751709-16751731 TACAATGAATTGAAAGCTCATGG + Intronic
904637394 1:31893509-31893531 TTCCATTTATTGAATGCACGGGG + Intergenic
905501623 1:38444104-38444126 TACCACATATTGCTAGCCCAGGG - Intergenic
905711065 1:40103786-40103808 TAGAATCTATTGTAAGCCCAAGG - Intergenic
906901188 1:49837952-49837974 CACCATTTATAGTAACCCCAGGG + Intronic
908044435 1:60153309-60153331 AACCATCTATTAAAAGCACAAGG + Intergenic
909209729 1:72808157-72808179 TAATGTTTATTCAAAGCCCAAGG + Intergenic
910125973 1:83842906-83842928 TAACATTTATTGAGTGCCCTCGG - Intergenic
912764273 1:112394953-112394975 TACCATTAAATGAAAGTACATGG + Intergenic
913976800 1:143465455-143465477 TAACATTTATTGAGCGCCTACGG + Intergenic
914071202 1:144291082-144291104 TAACATTTATTGAGCGCCTACGG + Intergenic
914107953 1:144675273-144675295 TAACATTTATTGAGCGCCTACGG - Intergenic
915777513 1:158506863-158506885 TGTTATTTATTCAAAGCCCAAGG + Intergenic
915873335 1:159585554-159585576 TAACATTTCTTGAGAACCCAGGG - Intergenic
919210454 1:194476197-194476219 TACCCTTTATTTAAAGAACAAGG + Intergenic
924370001 1:243337691-243337713 TAAAATTTATTAAATGCCCACGG - Intronic
924954087 1:248910732-248910754 TTGGATTTACTGAAAGCCCATGG + Intronic
1063079350 10:2750791-2750813 TAATATTTATTGAGAACCCATGG + Intergenic
1064253853 10:13727586-13727608 TACCATTTGTTGTTAGTCCAGGG + Intronic
1066068774 10:31783161-31783183 TACCATTTATTGAGACTTCATGG - Intergenic
1066743877 10:38585235-38585257 CACCATTGAATGAAATCCCATGG + Intergenic
1068578370 10:58710040-58710062 TACCATTTGTTGAAACCTCCTGG + Intronic
1069261360 10:66402577-66402599 TACCACTTTTTAAAAGCCTATGG + Intronic
1071487134 10:86109788-86109810 TTCCAGCTCTTGAAAGCCCATGG - Intronic
1073844280 10:107535510-107535532 TGCCATTTATTAAAAGCTCTTGG - Intergenic
1073872405 10:107880278-107880300 TGCCATTTATTTAATGCCTAAGG - Intergenic
1074067885 10:110035197-110035219 TACCATCTAATGAAACCCTAAGG - Intronic
1074196363 10:111189252-111189274 TACAATCTATTGAATGCTCAGGG + Intergenic
1075056093 10:119219576-119219598 TACCATCTATTGTGACCCCAAGG - Intronic
1075327814 10:121548614-121548636 TTCCATTTATTTTGAGCCCAGGG + Intronic
1078349177 11:10578734-10578756 TCCCATTTCATGAAACCCCAGGG - Intronic
1079069204 11:17328624-17328646 TGATATTTACTGAAAGCCCAAGG + Intronic
1084430657 11:69109125-69109147 TACCATTTATTGAATGCTGCTGG + Intergenic
1084724858 11:70934851-70934873 TCCCATTTATTGAAAACCTGGGG - Intronic
1085372002 11:76017172-76017194 TAGCAATTCTTGGAAGCCCAGGG - Intronic
1086931951 11:92703452-92703474 TGCCATTTTTTGAGGGCCCATGG - Intronic
1088226264 11:107623475-107623497 TAACATTTATTGAGTGCCCGTGG - Intronic
1088684002 11:112270058-112270080 TAACATTTATTAAATACCCACGG + Intergenic
1088817803 11:113433431-113433453 TACCCGTTAGTGGAAGCCCAGGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090571256 11:128049099-128049121 TGCCGTGTCTTGAAAGCCCATGG - Intergenic
1093013058 12:14128760-14128782 TCCCATTTATGAAGAGCCCAGGG - Intergenic
1097607908 12:61778547-61778569 TACTATTTATTAGATGCCCATGG + Intronic
1099357432 12:81656021-81656043 TATTATTTTTTGAAAGACCATGG + Intronic
1100265471 12:92971736-92971758 TATCATTGAATGAAAGCACATGG - Intergenic
1101245497 12:102880391-102880413 TGCCATTCATTGAAACCCCTTGG - Intronic
1103366586 12:120388770-120388792 TGCCATTTTTATAAAGCCCATGG - Intergenic
1105572190 13:21613116-21613138 AACAATTTATTGAAAGCTCACGG + Intergenic
1108320453 13:49284716-49284738 TACCATGTATTAAAAGTCCCTGG - Intronic
1109402796 13:61857401-61857423 TAATGTTTATTCAAAGCCCAAGG + Intergenic
1109437711 13:62327889-62327911 TAACATTTATTTGAAGCTCAGGG - Intergenic
1110063222 13:71067673-71067695 TGACATTTATTCAAGGCCCAAGG + Intergenic
1111611743 13:90615194-90615216 GGCCATGTATTGAATGCCCAAGG + Intergenic
1112576217 13:100639018-100639040 TGACATTTATAGAAAGTCCATGG - Intronic
1115716810 14:36114630-36114652 TACAATTTTTTTAAAGCCCGGGG - Intergenic
1116849899 14:49898029-49898051 TACCATTTAATTAAAGCAAAAGG - Intergenic
1120136885 14:80880342-80880364 AGCCATTTATGAAAAGCCCATGG + Intronic
1121951408 14:98173990-98174012 TACCAATTGTTGAATGCCCACGG + Intergenic
1123038278 14:105480129-105480151 AACCGTTTATTGACAGCACAAGG - Intronic
1128208296 15:65871864-65871886 TACCATTTATTGAGTCCTCATGG - Intronic
1129847040 15:78772810-78772832 TACCATTCTTTGGAAGGCCAAGG + Intronic
1130174095 15:81549441-81549463 TACCAATTATAGAATGCCTAAGG + Intergenic
1132984799 16:2759716-2759738 TAATATTTATTGAGCGCCCACGG + Intronic
1133601370 16:7343143-7343165 TAACATTTATTAAGCGCCCACGG - Intronic
1136060812 16:27725130-27725152 TGCCATTTATTGAATGCCGCAGG + Intronic
1141174319 16:81709311-81709333 TACCAAATGTAGAAAGCCCAGGG - Intronic
1147898995 17:43771573-43771595 TAACATTTATTGAGTGCACATGG - Intronic
1147916100 17:43887639-43887661 TACCATTTATTAAAAATTCATGG + Intronic
1149033239 17:52106788-52106810 ATGCATTAATTGAAAGCCCACGG + Intronic
1149805087 17:59609686-59609708 AAGTATTTATAGAAAGCCCAGGG + Intergenic
1151715047 17:75827039-75827061 AGCAATTTATTCAAAGCCCACGG + Intergenic
1152004214 17:77667982-77668004 AAACATTTATGGAAAGCCAAAGG + Intergenic
1155539799 18:26857290-26857312 TTCCATTTATTGAAATCCTATGG - Intronic
1164844264 19:31418607-31418629 TTCTATTTTTTGAAAGCCCGAGG - Intergenic
1164880117 19:31725844-31725866 TAGTATTTATTGAAAGACAATGG - Intergenic
1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG + Intronic
926562913 2:14437439-14437461 TTCCATTTATAGGAAGCTCAAGG + Intergenic
927165868 2:20320628-20320650 TACCAGTCATTTACAGCCCAGGG - Intronic
927814366 2:26201364-26201386 TAACGTTTATTGAATGTCCATGG + Intronic
931842486 2:66168987-66169009 TCCCATTCACTGTAAGCCCAAGG - Intergenic
931900035 2:66778329-66778351 TACCATATATTGGAACCCTAGGG - Intergenic
933091199 2:78119482-78119504 TACAATTATTTGTAAGCCCATGG - Intergenic
933269468 2:80217535-80217557 TAACATTTCTTGAAAGCCATGGG - Intronic
934291804 2:91700659-91700681 TAACATTTATTGAGCGCCTACGG + Intergenic
937506456 2:122543061-122543083 AAACATTTATTGAATGCCTATGG + Intergenic
939873656 2:147552299-147552321 TAACATTTATTGAGAGCACCTGG - Intergenic
943733693 2:191330562-191330584 TTGCATTTATTAAAAGCACAAGG - Intronic
944368311 2:198950598-198950620 TACCATTTATTTGAAGCCCGGGG - Intergenic
1172193044 20:33073811-33073833 AGTCATTTATTGAAAGCTCAGGG - Intergenic
1172361579 20:34316436-34316458 TGCCTTTTATTGTAAGCACATGG + Intergenic
1175267656 20:57712184-57712206 TACCATTTATTGAGTGCTGATGG + Intergenic
1177275892 21:18912895-18912917 CAACGTTTATTCAAAGCCCAAGG + Intergenic
1178083068 21:29085717-29085739 TAACATTAATTGAATGCCAACGG + Intronic
1184547769 22:45183775-45183797 GACCATTTAATGAACACCCAAGG + Intronic
949832590 3:8231677-8231699 TACAAGTTAATGAAAACCCAGGG + Intergenic
949941906 3:9161563-9161585 CAGCATTTATTGAGTGCCCAAGG - Intronic
951119296 3:18906021-18906043 TACAATGAATTGAAAGCTCATGG + Intergenic
952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG + Intronic
955567170 3:60259776-60259798 TACCCTTTCTAGAAAACCCATGG - Intronic
956602771 3:71040617-71040639 TAACATTCATGTAAAGCCCAGGG + Intronic
956612445 3:71137820-71137842 TTACCTTTATTGAAAGCCCATGG - Intronic
957549665 3:81687381-81687403 TACCAACTTTTGAAAGCACATGG + Intronic
957572870 3:81970411-81970433 TACCTCTTAATCAAAGCCCATGG - Intergenic
957976132 3:87447581-87447603 TAACATTTATTCAAGGCCCAAGG + Intergenic
959965027 3:112344343-112344365 TAGCATTTAGTGAAAGCAGAGGG + Intronic
962509884 3:136087388-136087410 TCCCATTTTATAAAAGCCCAGGG - Intronic
963709540 3:148730985-148731007 TACCATGTCTTCAAAACCCAGGG - Intronic
965464095 3:169005622-169005644 TTCCATTTATTGAAATTCCTGGG + Intergenic
966662790 3:182432924-182432946 TACCATTTATTGAATACCTTGGG + Intergenic
966938380 3:184729587-184729609 AATCAATTATTAAAAGCCCAGGG - Intergenic
971102273 4:23480903-23480925 TACCATTTATTGGAATCACCTGG - Intergenic
974926829 4:68309831-68309853 TAACATTTTATGTAAGCCCATGG - Intergenic
975398901 4:73910913-73910935 TACCATTTAATGGATGCCTACGG - Intergenic
976391747 4:84512747-84512769 TTCCATTTTTTGAAAGCTCCTGG - Intergenic
976603657 4:86962414-86962436 ATACATTTATTTAAAGCCCATGG + Intronic
977409011 4:96637455-96637477 TACCATTTGAAGAAAGGCCACGG - Intergenic
979717958 4:123864410-123864432 TAACGTTTCTTGGAAGCCCATGG + Intergenic
980924956 4:139127222-139127244 TATCTTTTATTTTAAGCCCATGG - Intronic
981818130 4:148854858-148854880 TAGCACTTAGTGAAGGCCCATGG + Intergenic
984129969 4:175862697-175862719 TTCCATTTACTCAAAGCACAAGG + Intronic
986795901 5:11211565-11211587 ACTCATTTATTAAAAGCCCAAGG - Intronic
987207977 5:15647029-15647051 TACCATTTCTGGTAAGCCTAGGG + Intronic
987327640 5:16826922-16826944 CACCAGTCATTGAAAGCACAGGG - Intronic
987976933 5:25026618-25026640 TATTATTTAATGAAAGACCAGGG + Intergenic
988864145 5:35316406-35316428 GGCCATTTTTGGAAAGCCCAGGG + Intergenic
995154679 5:108896455-108896477 TACCATTTATTGAATTCCACTGG + Intronic
996956377 5:129187855-129187877 TGCCATTTATTCAAGGCCCAAGG - Intergenic
999642199 5:153682957-153682979 TACCCTTTACAGGAAGCCCAAGG + Intronic
999884873 5:155911085-155911107 TACCATTTTTAGAAAGGCCATGG + Intronic
1000966170 5:167659410-167659432 TATGATTTTATGAAAGCCCAGGG - Intronic
1001120710 5:168977722-168977744 AAGCATTTATTGAAAGACTATGG - Intronic
1003457021 6:6292608-6292630 TAGCATTTATGGAAAGCCAGCGG - Intronic
1003706397 6:8535951-8535973 TAATATTTATTGAATGCCAAGGG + Intergenic
1004453014 6:15764951-15764973 AACCATTTATTGAAACTCTATGG + Intergenic
1005909576 6:30296592-30296614 TACTATTTTTTGAAAGCACTAGG + Intergenic
1006939828 6:37744280-37744302 TACCATGTATTGAGCGCCTATGG + Intergenic
1011544566 6:88469327-88469349 TACCATTTAATGACTGCCCTTGG + Intergenic
1012077569 6:94710914-94710936 AACCATTTATTAAAAGCAGAGGG + Intergenic
1012526009 6:100178505-100178527 TACCATTTTTTGATATACCAAGG - Intergenic
1014539535 6:122657370-122657392 TAACATCTATTGCAAGCCAACGG - Intronic
1014752824 6:125272662-125272684 TGACATGTATTGAATGCCCAAGG - Intronic
1015657295 6:135533154-135533176 TAACATTTGTTGAATGCCTATGG - Intergenic
1016037910 6:139402333-139402355 CACCATTTTTTCAAAGCCCCTGG + Intergenic
1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG + Intronic
1019968416 7:4520325-4520347 TACCTTTCATTGCAAGCCCCTGG + Intergenic
1020150599 7:5679093-5679115 TACCATTTATTGAGTGCTTATGG + Intronic
1021023928 7:15641145-15641167 TACCAATTAAAAAAAGCCCAGGG - Intronic
1021030671 7:15729965-15729987 TACCATTGTTTGAAATCCAATGG - Intergenic
1025718179 7:63983222-63983244 TAACATTTATTCAAGGCCCAAGG - Intergenic
1028418052 7:90600506-90600528 TACCATTTCTTTAAAGGACATGG + Intronic
1028686833 7:93599629-93599651 TACTAGTTATTAAAAGCACAGGG - Intronic
1030020347 7:105269092-105269114 TACCATTTCTTTAAAGCAGAGGG + Intronic
1030723515 7:112898200-112898222 TGACATTTATTGGGAGCCCAGGG - Intronic
1030891009 7:114999163-114999185 TACCATTTATAGAAACCCAATGG + Intronic
1036740022 8:11352235-11352257 TATTTTTTATTGAAAGCACAGGG - Intergenic
1037050929 8:14373240-14373262 TTCCATTTAGTGAATGCCAACGG - Intronic
1037354107 8:17998967-17998989 TAATATTCATTTAAAGCCCAAGG + Intronic
1039736027 8:40333881-40333903 AACAGTTTTTTGAAAGCCCAGGG + Intergenic
1039905955 8:41786494-41786516 TCCCATTTATTCAAAGGCTAGGG + Intronic
1041415993 8:57609372-57609394 TTCTATTTATTCAAAGCCCGAGG - Intergenic
1041635188 8:60134695-60134717 TGGTATTTATTGAATGCCCACGG + Intergenic
1042330721 8:67577634-67577656 TAACATTTCTTGAAAGCAAAAGG + Intronic
1044486279 8:92758051-92758073 TACCACATATTGCTAGCCCAGGG + Intergenic
1045648140 8:104319165-104319187 AAACATTTATTCAAAGCCAATGG + Intergenic
1045674741 8:104594377-104594399 TACAATATATTGAATGCCTAGGG + Intronic
1046213160 8:111105634-111105656 CACCAATTATTTGAAGCCCAAGG + Intergenic
1046993353 8:120486642-120486664 AACCCTTTATTGGAAGCCGAGGG + Intronic
1049174344 8:141182468-141182490 TACCATGTATTCAAATGCCACGG - Intronic
1053293939 9:36899916-36899938 CAGCATTAAATGAAAGCCCAAGG - Intronic
1053653634 9:40193995-40194017 GATCATTTATGGAAAGCACATGG - Intergenic
1053904033 9:42823286-42823308 GAACATTTATGGAAAGCACATGG - Intergenic
1054530952 9:66182228-66182250 GATCATTTATGGAAAGCACATGG + Intergenic
1055336369 9:75236941-75236963 GACCATGTATTGAACACCCAAGG + Intergenic
1055490086 9:76795783-76795805 TCCCATTAATTCAAAGCCCCAGG + Intronic
1055628103 9:78195107-78195129 CACCACTTGATGAAAGCCCAGGG + Intergenic
1056473660 9:86930995-86931017 TACCATTTTTTTAAATCCAATGG - Intergenic
1060298225 9:122357351-122357373 TACCCTTTAATGAAGCCCCAAGG - Intergenic
1061497794 9:130985585-130985607 TACCATCTGTTGAAAGGCCATGG - Intergenic
1061673800 9:132204067-132204089 TACCATTTATTGGGAACCCATGG + Intronic
1186335339 X:8581023-8581045 CACCATTTTTTGAAACACCACGG + Intronic
1186533938 X:10328013-10328035 TTTCATTCATTTAAAGCCCAGGG - Intergenic
1186676696 X:11824753-11824775 TAACATTTGTTGAAAGCCAGAGG + Intergenic
1186880016 X:13855805-13855827 TACCAATTATCTAAACCCCATGG + Intronic
1187003113 X:15202398-15202420 TATTATTAATTGAAAGCTCAAGG - Intergenic
1187889410 X:23920164-23920186 TACCATTTACTCAAGGCCCAAGG + Intronic
1188251526 X:27901540-27901562 TACAAGATATTGAAAGTCCAAGG - Intergenic
1188299331 X:28488132-28488154 TAACTTTTATTGTAAGGCCAGGG + Intergenic
1189223603 X:39394189-39394211 AACCATTTATTGAACACCTATGG - Intergenic
1191194138 X:57703588-57703610 TGATATTTATTCAAAGCCCAAGG + Intergenic
1192958815 X:76104345-76104367 TTACATTTATTCAAAGCCCAAGG + Intergenic
1195377601 X:104243074-104243096 TACCATTTAGAGAAGTCCCAGGG - Intergenic
1196771985 X:119303585-119303607 TATCATTTCTTGAAAGCCTCAGG + Intergenic
1198937137 X:141910366-141910388 TGCCATTTATTAAAATTCCAAGG + Intergenic
1198961914 X:142192499-142192521 TGCCATTTATTAAAATTCCAAGG - Intergenic
1198989574 X:142496446-142496468 TACCATTTATTGACAATCTATGG - Intergenic