ID: 1017903564

View in Genome Browser
Species Human (GRCh38)
Location 6:158739001-158739023
Sequence CTGTGTGAGTGGGAGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1016
Summary {0: 1, 1: 1, 2: 8, 3: 101, 4: 905}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017903564_1017903575 8 Left 1017903564 6:158739001-158739023 CCTTTCCCCTCCCACTCACACAG 0: 1
1: 1
2: 8
3: 101
4: 905
Right 1017903575 6:158739032-158739054 GTCTGGCTCCCTGCAAAAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 136
1017903564_1017903570 -9 Left 1017903564 6:158739001-158739023 CCTTTCCCCTCCCACTCACACAG 0: 1
1: 1
2: 8
3: 101
4: 905
Right 1017903570 6:158739015-158739037 CTCACACAGCCCTCCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017903564 Original CRISPR CTGTGTGAGTGGGAGGGGAA AGG (reversed) Intronic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901626567 1:10628381-10628403 CTGGGTGAGTGGGAGGGTGCAGG + Intronic
902177285 1:14660116-14660138 CAGTGGGGCTGGGAGGGGAAGGG + Intronic
902265187 1:15258231-15258253 CTGGGGGGCTGGGAGGGGAAGGG - Intronic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902578901 1:17396093-17396115 CTGTGGGAGTGGGCTGGGCATGG + Intronic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
903904191 1:26672142-26672164 TTGTGTGAGGAGGAGGGGAGTGG - Intergenic
904237860 1:29125531-29125553 CTCTGTGAGTGGGATGAGAGGGG - Intergenic
904694531 1:32321353-32321375 CTGGGGGAGTGGGAGAGAAAGGG - Intronic
904899092 1:33842180-33842202 TGGTGGGAGTGGGAGGGGATGGG - Intronic
904929872 1:34078227-34078249 CTGTCTGTGTGGGAAGGGAGAGG + Intronic
905075819 1:35269278-35269300 CTGGGTGGGGGGGAGGGGAGGGG + Intronic
905233967 1:36532950-36532972 CTGGGTGTGTGGGGGTGGAAAGG - Intergenic
905249095 1:36636589-36636611 CTGTGTGTGTCGGGTGGGAATGG + Intergenic
905308758 1:37035456-37035478 CTGGGTGTGAGGGAAGGGAAAGG + Intergenic
905893066 1:41529058-41529080 GTGTGTGAGTGTGAGGGTGAGGG - Intronic
906073433 1:43034559-43034581 CTATGTGGAAGGGAGGGGAAAGG - Intergenic
906306981 1:44725598-44725620 TTGTGTGTGTGGAGGGGGAAGGG + Intergenic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
906635268 1:47405524-47405546 CAGCCTGGGTGGGAGGGGAAGGG + Intergenic
906932013 1:50179160-50179182 GTGGGTGAGGGGGTGGGGAAAGG - Intronic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
908486197 1:64596178-64596200 CTGTTTGAATGGTAGAGGAAAGG - Intronic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909764196 1:79334322-79334344 CTGTGTGACTGGGAGGAGACTGG + Intergenic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
910683865 1:89896213-89896235 GTGGGTGAGTGGGAGGGTAGAGG + Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
910947961 1:92614491-92614513 TTGAGTCAGTGGGATGGGAAAGG + Intronic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
911515663 1:98865779-98865801 CTATGTGAGTGGGAGGGACCCGG - Intergenic
911580239 1:99625609-99625631 TTGTGTGAGTAGGAGGGGAAAGG + Intergenic
912249459 1:107995716-107995738 TTGTGTGTGTGTGAGGGGAAGGG + Intergenic
912257513 1:108075985-108076007 CTGTTTGAGTGGGAGATGATAGG - Intergenic
912302415 1:108531815-108531837 CTCTGTGAGTGGGAAGAGCAGGG - Intergenic
912499764 1:110114105-110114127 GTGTGTGAGTGGGAGGGAGTGGG + Intergenic
912953888 1:114139351-114139373 GTGTGTGGGTGTGAGGGGAATGG - Intronic
913039088 1:115005615-115005637 CTGAGTCAGTGGGTTGGGAAAGG - Intergenic
913045802 1:115072677-115072699 CCGTGTGAGGGCAAGGGGAAGGG + Intronic
913059185 1:115189063-115189085 CTGTTAGAGGGGGAGGGGAGAGG - Intergenic
913197590 1:116470897-116470919 GTGTGAGAGAGGGAGAGGAAGGG - Intergenic
913308962 1:117466196-117466218 GTGTGTGTGTTGGAGGGGCAGGG - Intronic
913450157 1:118987680-118987702 CTGCGAGACTGGGAGGAGAAGGG - Intronic
914457256 1:147847640-147847662 CGGTGAGGGTGGGAGGGGAAAGG - Intergenic
915138770 1:153753030-153753052 GTGTGTGTGTAGGAGGGGAGCGG - Intronic
915227794 1:154423517-154423539 CTGAGTGGGTGGGAGGGAAGGGG + Intronic
915250175 1:154582462-154582484 CTGTGTGACTCAGAGGGGCATGG + Exonic
915364260 1:155305387-155305409 CTGTTTCAGTGGGTGGGAAAGGG + Intergenic
915881455 1:159676606-159676628 GAGTGTGATTGGGAGTGGAATGG + Intergenic
915938003 1:160100038-160100060 GTGAGTGAGTGGGAGGGAAGGGG - Intergenic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
916450719 1:164917891-164917913 GTGGAGGAGTGGGAGGGGAATGG - Intergenic
916970380 1:170007186-170007208 GTGTTTGTGTGGGAGGTGAAGGG + Intronic
916990822 1:170242920-170242942 CTGTGTGTGTGTGTGGGGAGGGG + Intergenic
917655384 1:177120674-177120696 CTGTTTGAGTGAGATAGGAAGGG - Intronic
917684115 1:177398549-177398571 GTGTGTCTGTGGGAGGGGACAGG - Intergenic
917693156 1:177489883-177489905 GTGTGTGTGTGGGGGGGGCAGGG - Intergenic
917999858 1:180482858-180482880 GTGTGTGAGTGTGTGGGGCAAGG + Intronic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
918578752 1:186099317-186099339 CTGTGTGTCTGGGAGGTGCAGGG + Intronic
918614230 1:186525987-186526009 CTGTGGGAGGAGCAGGGGAAGGG - Intergenic
919773401 1:201177345-201177367 GTATGTGACGGGGAGGGGAATGG + Intergenic
919792748 1:201302748-201302770 CTGTGGGGGCGGGAGGGGAGGGG - Intronic
919933098 1:202234335-202234357 CTGTGGGAATGGGTGGGGATAGG - Intronic
919971315 1:202581270-202581292 TTGAGTGAGGGGGTGGGGAAGGG - Exonic
920506377 1:206518192-206518214 CTGGGGGAGGTGGAGGGGAAAGG + Intronic
920650697 1:207835257-207835279 CTGTGTGGGTGGGCAGGGAAGGG - Intergenic
921249228 1:213281023-213281045 GTGTGTGTGTGGGTGGGGAGGGG - Intergenic
921254825 1:213329835-213329857 CTGTGTGACTGGGAGGGGTTGGG - Intergenic
921324939 1:213980363-213980385 GTGTGTGTGTGGGAGGGGCAAGG - Intergenic
921604126 1:217136226-217136248 CGGAGTGAGTGGGAGGGAAAGGG + Intronic
921678145 1:218000358-218000380 CTGAGAGAGTGGTAGGGGATGGG - Intergenic
921748483 1:218765554-218765576 CTTTGTGAGTGGTAGGAGAACGG + Intergenic
921906150 1:220497437-220497459 GTCTGGGTGTGGGAGGGGAAGGG - Intergenic
922412138 1:225387236-225387258 ATGTGTGGGGGGGAGGGGGAGGG + Intronic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922792168 1:228316603-228316625 CTGCGTGGGTGGGAGGGGTCTGG - Intronic
923144436 1:231188028-231188050 CTGTGAGAGTGGGAGAGCATGGG - Intronic
923219980 1:231884008-231884030 CAGGGTGGGTGGCAGGGGAATGG + Intronic
923672963 1:236056735-236056757 CTGTGTCCCTGGGAGGGGAGTGG - Intronic
923856437 1:237849822-237849844 ATGAGAGAGAGGGAGGGGAAGGG + Intergenic
924102912 1:240622621-240622643 ATGAGTGAGTGGGTGGGGCATGG - Intergenic
924472894 1:244358797-244358819 CTGAGTGAATGGTAGGGCAAGGG + Intronic
924526274 1:244853180-244853202 TTGTCTGGGGGGGAGGGGAAGGG + Intronic
924598236 1:245465555-245465577 CTGTGTAAATGGGAAGGAAACGG - Intronic
924643987 1:245860166-245860188 ATGTGGGAGTGGGAGGGGTGTGG - Intronic
1062805147 10:413866-413888 CTGTGCGAGGGGGTGGGCAAAGG + Intronic
1063185726 10:3649536-3649558 GTGTGCGAGTGGGGGGGCAAGGG - Intergenic
1063482146 10:6385332-6385354 GAGTGTGAGTGGGAGGAGGAGGG - Intergenic
1064741582 10:18440134-18440156 ATGTGGGAGAGGGAGTGGAAGGG + Intronic
1064792774 10:18977019-18977041 ATGTGTCAGTGGGAGGGAAAAGG + Intergenic
1065044447 10:21734058-21734080 TTGTGTGGGTGAGAGGGGTAGGG - Exonic
1066157429 10:32692838-32692860 CTGTGTGAGTGGGCATGGGATGG + Intronic
1066225590 10:33379979-33380001 CTGAGTGGATGGGTGGGGAAAGG + Intergenic
1066625782 10:37404122-37404144 ATGTGTGGGTGGCATGGGAAGGG + Intergenic
1067066140 10:43105339-43105361 CTGTCCTAGGGGGAGGGGAAGGG + Intronic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1067473313 10:46551051-46551073 TGGTTTGTGTGGGAGGGGAAGGG + Intronic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067974703 10:51011199-51011221 GTGTGTGTGTGGGTGGGGAGGGG + Intronic
1067985254 10:51136575-51136597 GTGTGTGTGTGGGAGGGGGGCGG + Intronic
1069117237 10:64522994-64523016 CTGTGAGAGGGAGAGGGCAAAGG + Intergenic
1069191992 10:65503887-65503909 TTGAGTCAGTGGGATGGGAAAGG - Intergenic
1069244637 10:66188566-66188588 CTGTGTGTGTGTGGGGGGAGGGG + Intronic
1069828711 10:71269932-71269954 ATGTGTGTGTGGGAGGGGTTGGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070997611 10:80799847-80799869 CGGTATGAATAGGAGGGGAAAGG - Intergenic
1071158247 10:82716361-82716383 ATATGTGAGTGGGTGGGGATTGG - Intronic
1071514658 10:86289272-86289294 CTGAGTGAGGAAGAGGGGAAGGG + Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072295677 10:94007316-94007338 ATCTGTGGGTGGGAGGGGAGGGG + Intronic
1072554060 10:96501330-96501352 CTCTGTGGGTGGGAGGGGTCCGG - Intronic
1072658246 10:97345732-97345754 CTGAGTGAGTGGGAGGGGTGTGG - Intergenic
1073144845 10:101273725-101273747 ATGTGTGGGTGGGTGGGGATGGG + Intergenic
1073192642 10:101662740-101662762 CTGTTTGCCTGGGAGGGGAAGGG - Intronic
1073592131 10:104767630-104767652 GAGTGGAAGTGGGAGGGGAAGGG - Intronic
1074126237 10:110530708-110530730 AGGGGTGAGTGGAAGGGGAAAGG - Intergenic
1074307070 10:112288815-112288837 AAGAGTGAGTGGGAGGGGGATGG - Intronic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074852304 10:117448669-117448691 CTGTGGGAGGGGGACGGGGAGGG - Intergenic
1074890115 10:117728848-117728870 ATGTGTGAGTGGGTTGGGAGTGG + Intergenic
1075096963 10:119478354-119478376 CTGTGTGTGTGGCAGGGGCGTGG + Intergenic
1075442335 10:122489783-122489805 CTGGGGGTGTGGGAGAGGAAGGG + Intronic
1076007084 10:126956435-126956457 CTGAGTGAGTGGGAGGAGAGGGG + Intronic
1076319462 10:129567215-129567237 CTGTGAGAGGTGGAGGGGACGGG - Intronic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076347532 10:129789915-129789937 CTGTTGGTGTGGGTGGGGAAAGG + Intergenic
1076405186 10:130207125-130207147 GTGTGTGTGTGGGGGGGGACAGG - Intergenic
1076439249 10:130469152-130469174 GTGTGTGAGAGAGAGGGGAAGGG - Intergenic
1076758788 10:132589675-132589697 CTTGGTGAGTGGGAGAGGGATGG + Intronic
1077058989 11:609572-609594 CTCTGCGAGTGGGAGGGTACAGG + Exonic
1077332232 11:1988756-1988778 CGGGGTGAGAGAGAGGGGAAAGG - Intergenic
1077443999 11:2581861-2581883 TTGTGTGTGTGGCAGGGGCATGG + Intronic
1077537657 11:3132131-3132153 GTGTCTGAGTGTGAGGTGAATGG - Intronic
1077889243 11:6406787-6406809 CTGTGAGAGTGGTGGGGGAGAGG - Intronic
1078772745 11:14365884-14365906 CTGAGTCAGTGGGCTGGGAAAGG - Intergenic
1079368093 11:19826948-19826970 ATGGGTGAGTGGGAGTGGAAAGG + Intronic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1079763354 11:24357814-24357836 CTGGTAGAGTGGGAGGGGCATGG - Intergenic
1080094253 11:28385805-28385827 GTGTGTGTGTGTGAGGGGATAGG + Intergenic
1080853367 11:36090760-36090782 CTGTGTCTGTAGGAGAGGAAAGG - Intronic
1081591093 11:44423723-44423745 CTCTGTGTGTGGGAGTGGAGTGG + Intergenic
1081744577 11:45463958-45463980 CTGTGGCAGTGGGAGGGATATGG - Intergenic
1081930049 11:46863144-46863166 CTATGTGAGTGAGTGTGGAAGGG + Intronic
1082028180 11:47587586-47587608 GTGCGTGAGAGGGAGGGGAAAGG + Intronic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082922047 11:58506050-58506072 GTGTGTGTGTGGGAAGGGAGTGG - Intergenic
1083173632 11:60936607-60936629 CTGTGAGAGTGGGGGAGGAGGGG + Exonic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1084555843 11:69875398-69875420 CTGTGTGTGTGAGTGGGGAGGGG - Intergenic
1084931798 11:72561956-72561978 TTGTGTGGTTGGGAGGGGAAGGG - Intergenic
1085322467 11:75583446-75583468 CTGTGCGAGTGCGCGGGGACGGG + Intergenic
1085416335 11:76321449-76321471 CTGGGGGAGTGGCAGGGGATGGG - Intergenic
1085456043 11:76665959-76665981 CTGTGTAAGGCGGAGAGGAAAGG + Intronic
1086278186 11:85156987-85157009 TTGAGTGAGTGGGATGGGAAAGG + Intronic
1086561060 11:88170019-88170041 ATTTGAGAGTGGGAGGGGATTGG - Intronic
1086609404 11:88736596-88736618 ATATGTGAGTGTGAGGGGCATGG + Intronic
1086917390 11:92546720-92546742 CTCTTTTAGTGGGTGGGGAACGG + Intronic
1088010802 11:104998702-104998724 ATGTGTGTGTGGGAGGGGGAAGG + Intronic
1088326758 11:108608843-108608865 CTGTGTGAGAGAGAGGGGGAGGG + Intergenic
1088441650 11:109877685-109877707 CAGTGGGAGTGGGAGGGGAGTGG - Intergenic
1088504071 11:110512234-110512256 CAGGGTGAGTGGGTGGGGGATGG + Intergenic
1088544318 11:110944648-110944670 CTGAGTCAGTGGGCTGGGAAAGG - Intergenic
1088596494 11:111444877-111444899 CTCTGTGAGAGGCAGGGGAGTGG + Intronic
1088624700 11:111721354-111721376 GTGTGTGTGTGGCAGGAGAAGGG - Intronic
1089423528 11:118350420-118350442 CTCTGTGGGTGGCAGGGCAAGGG - Intronic
1089576231 11:119446318-119446340 CTGTGTGTGTGGGTGAGGAGGGG + Intergenic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1090244602 11:125206966-125206988 CTGTGAGAGAGGGAGGGGCTGGG + Intronic
1090264206 11:125343911-125343933 CTGTGTGAGTCAGAGCGGCATGG + Intronic
1090265952 11:125353055-125353077 CTGGCTGAGTGGAATGGGAATGG - Intronic
1090397464 11:126428531-126428553 GTGTGTGCGGGGGAGGGGAGGGG + Intronic
1090419187 11:126562308-126562330 CTGAGTAAGAGGGAGGGGTAGGG + Intronic
1090524572 11:127518688-127518710 CTATGTGTGTGGCAGGGGAAAGG - Intergenic
1091272638 11:134328615-134328637 ATATGTGAGTGGGACTGGAAGGG - Intergenic
1202815214 11_KI270721v1_random:43932-43954 CGGGGTGAGAGAGAGGGGAAAGG - Intergenic
1091650667 12:2306838-2306860 GTATGTGAGATGGAGGGGAAGGG - Intronic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092282593 12:7109002-7109024 ATGTGTGTGTGGGGGGGGTAGGG + Intronic
1092578539 12:9814856-9814878 GTGTGTGTGTGGGAGGGGGGAGG + Intergenic
1092845641 12:12582409-12582431 CTTTGTGGTTGGGAGGAGAAAGG + Intergenic
1093587271 12:20854660-20854682 CTGGCTAACTGGGAGGGGAATGG - Intronic
1093663551 12:21785395-21785417 CTGAGTCAGTGGGTTGGGAAAGG - Intergenic
1094016576 12:25871048-25871070 CTTGGTGGGTGGGAGGGGAGAGG + Intergenic
1094102845 12:26781741-26781763 CTGAGTCAGTGGGCTGGGAAAGG + Intronic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1094331964 12:29303559-29303581 AGGTGTGAGAGGCAGGGGAATGG + Intronic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094450287 12:30576723-30576745 CTGAGTCAGTGGGCTGGGAAAGG + Intergenic
1094748889 12:33381679-33381701 CGGGGAGAGTGGGAGGGCAAAGG + Intronic
1095182787 12:39165376-39165398 CTGAGTAAGTGGGAGAGGAAGGG + Intergenic
1095818342 12:46449520-46449542 CATTGTGAGTGGGATGGAAAGGG + Intergenic
1095862476 12:46933334-46933356 CTGTATGTGTGGGAGGGCAAGGG + Intergenic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1095968225 12:47883558-47883580 GGGTGTGAGTGGAAGTGGAAAGG - Intronic
1096465977 12:51848072-51848094 GTGTGTGTGTGGGAGGGGTGGGG - Intergenic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1096973376 12:55684754-55684776 CAGGGTGAATGGGAGAGGAAGGG + Exonic
1097293451 12:57939888-57939910 TGGGGAGAGTGGGAGGGGAAGGG + Intergenic
1097713062 12:62935415-62935437 CTTTGGGAGCAGGAGGGGAAAGG + Intergenic
1097981620 12:65742105-65742127 CAGTGTGAGTGTGAGGGGGCCGG - Intergenic
1098024704 12:66189429-66189451 CTGGGTGAGTCGGCGGGGACCGG + Exonic
1099105047 12:78486565-78486587 CTCTGTGGGTGGGAGGGGAAGGG + Intergenic
1100021259 12:90072006-90072028 GTGTGTGTGTGGGAGAGGGAGGG + Intergenic
1100085965 12:90911269-90911291 TTGTGGGAGTGAGAGGGGAGTGG + Intronic
1100341284 12:93681918-93681940 TTGTGTGTGTGGGAAGGAAAGGG + Intronic
1101743794 12:107522528-107522550 GAGTGTGGGTGGGAGGGGAGGGG - Intronic
1102251133 12:111388267-111388289 CTGACTTAGCGGGAGGGGAAGGG - Intergenic
1102456696 12:113075343-113075365 CTGTGTGAGAGGGAAGGGCTGGG + Intronic
1103238986 12:119397943-119397965 CTGTGTGGGAGGGGGAGGAAGGG + Intronic
1103293647 12:119867679-119867701 GTGTGTGAGTTTGGGGGGAAGGG - Intronic
1103338991 12:120211183-120211205 CTGTTTCTGTGGGAGGAGAAGGG - Exonic
1103937477 12:124484226-124484248 CTGCGTGGGTGAGAGGGAAATGG - Intronic
1104038271 12:125113529-125113551 CTGTGTGTCTGGCAGGGGCAGGG - Intronic
1104058782 12:125250484-125250506 CAGTGTGAGCAAGAGGGGAAGGG - Intronic
1104064891 12:125298309-125298331 CTGGGTGGGTGGGAGGGAGATGG - Intronic
1104508539 12:129355401-129355423 CTGTGTGAGTGCTTGGGGTAAGG + Intronic
1104795499 12:131514367-131514389 CTGTGGCAGTGGGTGGGGATGGG - Intergenic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104871201 12:131997740-131997762 GTGGGGGAGGGGGAGGGGAAGGG + Intronic
1105007360 12:132729578-132729600 GTGGATGGGTGGGAGGGGAAGGG + Intronic
1105510036 13:21043505-21043527 AAGTGTGAGTTGGAGGGGAAAGG + Intronic
1105800946 13:23903130-23903152 GATTGTGAGTGAGAGGGGAATGG - Intergenic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1106912375 13:34476632-34476654 CTGTGTGTGTGGGAGGGTGTAGG - Intergenic
1107368194 13:39709435-39709457 TTGGGAGGGTGGGAGGGGAATGG - Intronic
1108601717 13:52000632-52000654 CTGTGGGAGCAGCAGGGGAAGGG - Intronic
1108803079 13:54123323-54123345 GTGTGTGTGTGTGAGGGGATGGG + Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1109592614 13:64505933-64505955 CTGTGTGTGTGTGTGGAGAAAGG - Intergenic
1110436486 13:75482168-75482190 CTGGGTGGCTGGGCGGGGAATGG + Intergenic
1111588558 13:90312833-90312855 TTGTGTGGCTGGGAGAGGAAAGG - Intergenic
1112281184 13:98064392-98064414 GTATGTGTGTGGGAGAGGAAAGG - Intergenic
1112579838 13:100669203-100669225 CTGTGTGTGTGGCAGGGGAGAGG + Intronic
1112787256 13:102964862-102964884 ATGTGTGAGGGAGAGGGGAGGGG - Intergenic
1113245859 13:108394617-108394639 ATGTGTGTGTGGGGGGGGAGGGG - Intergenic
1114263715 14:21058456-21058478 TTGAGTGTGTGGGAGGGAAATGG - Intronic
1114454205 14:22844945-22844967 CCGTGTGAGTGGGATGTGACCGG + Intronic
1114455293 14:22849785-22849807 CTGGGTCAGCGGGAAGGGAAGGG + Intergenic
1114646124 14:24257192-24257214 CTGAGTGAGAGGGAGGGCACTGG + Intronic
1114909399 14:27171395-27171417 CTCTGTGTGTGTGAGGGGAGGGG + Intergenic
1115003048 14:28444131-28444153 CTCTGTGTGTGGGGGGGGAGAGG + Intergenic
1115091159 14:29577548-29577570 CTGTTAGAGTGGAAGGAGAAGGG - Intronic
1115557139 14:34552849-34552871 CTGTGTGCGGGGGCGGGGAGGGG - Intergenic
1116304204 14:43229640-43229662 CTGTGTGAGTGGTAGTGTAAAGG - Intergenic
1116653440 14:47623162-47623184 ATGTGTGAGAGAGAGTGGAAGGG - Intronic
1116673892 14:47879992-47880014 GTGTGTGTGTGGTGGGGGAATGG + Intergenic
1117040822 14:51767466-51767488 GTGGGTGAGAGGGAGAGGAATGG - Intergenic
1117591301 14:57270730-57270752 ATCTGTCAGTGGGAAGGGAACGG - Intronic
1117595954 14:57327422-57327444 CTGAGTCAGTGGGCTGGGAAAGG - Intergenic
1117769054 14:59113670-59113692 CTGTGGGAGTGGGAGTTGACAGG - Intergenic
1118966443 14:70590735-70590757 CTGTGTGATTTGGAGGGGCAGGG - Intronic
1118977129 14:70687519-70687541 ATGTGCCAGTGGGAGGGTAAAGG - Intergenic
1118978095 14:70694598-70694620 GTGTGGGCTTGGGAGGGGAAGGG - Intergenic
1119482120 14:74964468-74964490 CTGTGTGCAGGGGAGGGGAAGGG + Intergenic
1119771209 14:77221434-77221456 AGGTGTGAGTGGGAGGTGAGTGG - Intronic
1119863180 14:77951774-77951796 CTGTGTCTGTGAGAGTGGAAGGG + Intergenic
1119884871 14:78131728-78131750 CAGTGACAGTGGGAGGGGAGGGG + Intergenic
1120203440 14:81562956-81562978 CCCTGTGGGTGGCAGGGGAATGG - Intergenic
1120240387 14:81943140-81943162 TTGTGTGTGTGGTGGGGGAAGGG + Intergenic
1120294020 14:82615937-82615959 CTGTGTGTGGGGGCGGGGAGGGG + Intergenic
1120306952 14:82782861-82782883 CTGTCTGATTAGGAAGGGAATGG + Intergenic
1120878024 14:89392582-89392604 CCGTGTGAGTGTGAGGGCAGGGG - Intronic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121496184 14:94392673-94392695 CTGTGTGTTGGGGAGGGGAGGGG + Intergenic
1121646021 14:95517220-95517242 CTGTGGGGGTGGGAGAGGACGGG - Exonic
1121840804 14:97132228-97132250 CTGTGTGAGGGTGCAGGGAAGGG - Intergenic
1121866275 14:97365591-97365613 CAGGGTGAGTGGGAGTGGAGAGG + Intergenic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1122664147 14:103317130-103317152 CGGGGTGAATGGGAAGGGAAGGG - Intergenic
1122882537 14:104696569-104696591 CTGAGTGTGAGGGAGGGGAATGG + Intronic
1123490228 15:20774884-20774906 GTGGGGGAGTGGGGGGGGAAGGG - Intergenic
1123546729 15:21343971-21343993 GTGGGGGAGTGGGGGGGGAAGGG - Intergenic
1123691858 15:22844786-22844808 TTCTGTGTGTGGGAGGGGAAGGG - Intronic
1123948075 15:25248512-25248534 CTCTGTGTGTGGGAGGTGTAGGG + Intergenic
1124017158 15:25886994-25887016 GTGTGTGTCTTGGAGGGGAAAGG + Intergenic
1124057441 15:26254985-26255007 CAGTGTGAATGGGAGGGGTCTGG + Intergenic
1124157654 15:27241250-27241272 CAGTGTGAGTGTGAGGGAATGGG + Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1125045301 15:35238180-35238202 CTGTGGGAACGAGAGGGGAAAGG + Intronic
1125074496 15:35597579-35597601 TTGTGTGTGTGGTAGGGGAGAGG - Intergenic
1125138047 15:36367178-36367200 CCCTGTTATTGGGAGGGGAAGGG - Intergenic
1125268429 15:37911297-37911319 CAGTGAGAGTGGGAGCGGCAAGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125889132 15:43252670-43252692 GTGTGGGACTGGGATGGGAATGG + Intronic
1126256772 15:46636539-46636561 GTGTGTTGGTGGTAGGGGAAGGG + Intergenic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1127300729 15:57651071-57651093 CTGGGTGAATAGGAGGGGAGAGG + Intronic
1127786591 15:62360932-62360954 GTGTGTGTGTGTGAGGGGAAGGG - Intergenic
1127808365 15:62541602-62541624 GTGTGTGTGTTGGAGGGGAGAGG + Intronic
1127958990 15:63877056-63877078 CAGTGGGAGTGGGAGGGGAGTGG - Intergenic
1127984091 15:64055213-64055235 CTGCGTAAGTGGGTTGGGAATGG - Intronic
1128005574 15:64237123-64237145 GTGAGGGAGTGGGAGGGGGAAGG + Intronic
1128055404 15:64695693-64695715 GTGTGTGAGTGGGGGTGGAGGGG + Intronic
1128078087 15:64840997-64841019 GTGTGTGTGTGAGAGGGGAGCGG + Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128393986 15:67204831-67204853 CTGTGAAAGTGGGATGGGCAGGG - Intronic
1128528455 15:68428406-68428428 CTGTGTGGATGGGCTGGGAATGG + Intronic
1128559641 15:68656146-68656168 CGGTGCGAGGGGGAGGGGGAGGG - Intronic
1128744414 15:70103503-70103525 CGGGGTGAGGGGGAAGGGAAGGG - Intergenic
1128761535 15:70219434-70219456 CTGTGTGTGTGAGAGCTGAAAGG + Intergenic
1129235365 15:74220589-74220611 ATGTGTGCGAGGGAGGGGAAAGG + Intergenic
1129350093 15:74951015-74951037 CTGTGTAAGTGGGAGTGGATTGG - Intergenic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1130095306 15:80851153-80851175 ATGTGGGAGGGGGAGGGGCAGGG + Intronic
1130333404 15:82938770-82938792 CTGTGGGAGTGGGAGTGTTAGGG - Intronic
1130669572 15:85899621-85899643 TGGTGGGAGAGGGAGGGGAAAGG + Intergenic
1131116610 15:89799925-89799947 CTGGGTGAATGGGAGGGGAAGGG - Intronic
1131864739 15:96695618-96695640 CTGTGTGAGTGGGTGTGGGAGGG + Intergenic
1132510461 16:338427-338449 CTGTGTGGGTGGGTTGTGAAAGG - Intronic
1132629328 16:909235-909257 GTGAGTGAGGGGGAGGGAAAAGG + Intronic
1132726280 16:1339655-1339677 TGGTGTCAGTGGGTGGGGAAGGG - Intronic
1132973450 16:2700199-2700221 CTCTGTGTGAGGGAGGGGACTGG + Intronic
1133038513 16:3047315-3047337 CTGGGTGCCTGGGAGGGGCAGGG + Intronic
1133388193 16:5387642-5387664 CTCTGAGAGAGGGAGGGGAGTGG + Intergenic
1134106843 16:11491667-11491689 GTGTGTGTGTGGGAGGGGTGTGG - Intronic
1134407888 16:13978198-13978220 GTTTGTGTGTTGGAGGGGAAGGG + Intergenic
1134711159 16:16327434-16327456 CAGGGTGAAAGGGAGGGGAAGGG - Intergenic
1134770636 16:16806117-16806139 GAGAGTGAGAGGGAGGGGAAGGG - Intergenic
1134948415 16:18341149-18341171 CAGGGTGAAAGGGAGGGGAAGGG + Intergenic
1135131934 16:19860284-19860306 CTGTGTGTGTGGCAGGGGAGGGG + Exonic
1135631008 16:24035591-24035613 CTGTGTGATTGAGAAGGGGAGGG + Intronic
1135763098 16:25153432-25153454 CTGTGTGAGAGAGAGGTGAAGGG + Intronic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136612533 16:31375352-31375374 ATGTGAGAGTGAGAGGGAAAGGG - Intronic
1137548629 16:49421485-49421507 CTGTGAACGTGGGTGGGGAAGGG + Intergenic
1137776052 16:51055107-51055129 CTGTGTGTGTGTTAGGGGTAGGG + Intergenic
1137860532 16:51842020-51842042 ATGCCTGGGTGGGAGGGGAAGGG - Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138418965 16:56886932-56886954 CCCTGTGGGTGGGAGGGGCAGGG - Exonic
1138457681 16:57130817-57130839 CTGGCTGTGAGGGAGGGGAAGGG + Intronic
1138531448 16:57636558-57636580 CTATGTGAGGGGTAGGGGATAGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140932995 16:79645077-79645099 AGGTGTGTGTGGGAGGGGGATGG + Intergenic
1141089648 16:81121485-81121507 CCTTGTAAGTGGGATGGGAAAGG - Intergenic
1141339712 16:83191847-83191869 TTGTGTCAGTGGGCTGGGAAAGG - Intronic
1141547602 16:84781713-84781735 TTGTGTCAGTGGGCTGGGAAAGG + Intergenic
1141588159 16:85048971-85048993 GTGTGTGAGAGGGAGAGGGAGGG + Intronic
1141596322 16:85099249-85099271 CTCTGTGAGTGGGTGGTTAAGGG - Exonic
1142169593 16:88614786-88614808 CTGTGTGTGCTGTAGGGGAAGGG - Intronic
1142833954 17:2570654-2570676 GTGTTTATGTGGGAGGGGAAGGG + Intergenic
1142869182 17:2809410-2809432 CCGTGTGAGTGTGAGGGTATGGG + Intronic
1143220990 17:5261760-5261782 CTGAGTCAGTGAGAGGGGATTGG - Intergenic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143470936 17:7174649-7174671 CTGTGTGAGTGTGTGTGTAAGGG - Intronic
1143470979 17:7175212-7175234 GTGTGTGAGTGGGTGTGTAAGGG - Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143542997 17:7580631-7580653 GTGTGGGATTGGGAGGGGAGGGG - Intronic
1143563589 17:7708868-7708890 ATGGGAGGGTGGGAGGGGAATGG + Intronic
1143582989 17:7837032-7837054 TTTTGTGAGGGGGAGGGGCACGG + Intergenic
1143766588 17:9141701-9141723 GTGTGTGAGAGAGAAGGGAAAGG + Intronic
1143820398 17:9556882-9556904 GTATGGGAGTGTGAGGGGAAGGG - Intronic
1144209971 17:13005902-13005924 CAGTGTGAGTGTGGGGGGTAAGG - Exonic
1144752941 17:17662632-17662654 CGGTGTGGGTGGGATGGGCAAGG - Intergenic
1145779118 17:27550413-27550435 CTGTTTGCAGGGGAGGGGAAAGG - Intronic
1145818774 17:27815000-27815022 GTGTGTGGCTGGGAGGGGAAGGG + Intronic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145902287 17:28496782-28496804 CTATGTGAGAGGGAGGGAAGTGG + Intronic
1146208147 17:30922234-30922256 CGGTGTGGGTGGGAGGGGTCGGG - Intronic
1146596712 17:34175694-34175716 AGGTGGGAGTGGGTGGGGAAGGG + Intergenic
1146699232 17:34940173-34940195 CTGGGGCAGTGGGAGGGGAGGGG - Intronic
1146918732 17:36695509-36695531 CTGTGTGATAGGGTGGGGAAGGG + Intergenic
1146939774 17:36836420-36836442 CTGGGCCAGTGGGAGGGGAGAGG + Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147703698 17:42411843-42411865 CAGTGGGGATGGGAGGGGAATGG - Intronic
1147756901 17:42774537-42774559 ATATGTGTGTGGGAGAGGAAGGG + Intronic
1147932927 17:43994377-43994399 CTGTGAGTGGGGCAGGGGAAGGG - Intronic
1147986280 17:44309217-44309239 CTGTGTGAGGGGGAAGGGGGTGG + Intronic
1148597118 17:48865575-48865597 ATGTGTGGGTGCGAGGGGGATGG - Intronic
1148679727 17:49466671-49466693 CTGGGAGAGAAGGAGGGGAAGGG + Intronic
1148688971 17:49515812-49515834 CTGGGGGCGTAGGAGGGGAATGG - Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149370716 17:55991341-55991363 GTGTGTGAGGGAGAGAGGAAAGG - Intergenic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150395090 17:64815374-64815396 CTGTGTGAGGGGGAGTGCAGTGG - Intergenic
1150478619 17:65492386-65492408 ATGTGTGATGGGGAAGGGAATGG - Intergenic
1150571149 17:66388170-66388192 ATATGTGGGTGGGAGGGGCAGGG + Intronic
1150586619 17:66524103-66524125 GTGTGTGAGTGGGAGGAGATGGG + Intronic
1150632144 17:66887294-66887316 GTGGGTGGGTGGGAGGGGAGTGG - Intergenic
1150717495 17:67584217-67584239 TTGTGTGAGTGGGAGTGGAATGG - Intronic
1150856540 17:68758558-68758580 CTGTGTGCTTAGGAAGGGAAGGG + Intergenic
1151038068 17:70823875-70823897 TTGAGTCAGTGGGATGGGAAAGG - Intergenic
1151081681 17:71336510-71336532 CCGAGTGGGTGTGAGGGGAAAGG + Intergenic
1151370473 17:73643966-73643988 CTGGGAGAGTGGGCGGGGGAGGG - Intronic
1151552620 17:74830827-74830849 CAGTGTGCGAGGGAGGGGAGTGG + Intronic
1151612324 17:75184182-75184204 AGGAGTGAGTGGGAGGGGAGGGG - Intergenic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1152211677 17:79005685-79005707 CTCTGGGTGTGGGAAGGGAAAGG - Intronic
1152225437 17:79090579-79090601 GTGGGGGAGTTGGAGGGGAAGGG - Intronic
1152269351 17:79314838-79314860 CTGGGTGTAGGGGAGGGGAACGG + Intronic
1152481292 17:80555312-80555334 CTGTGTGATTGTGAGGGCAGTGG + Intronic
1152524431 17:80879426-80879448 ATGTGGGAGTGGGAGGAGAAAGG - Intronic
1152618429 17:81348559-81348581 CTGGGACAGTGGGAGGGGGATGG + Intergenic
1152688902 17:81708526-81708548 CTGGGGGAGCGGGAGGGGCAGGG + Intergenic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1153021051 18:629556-629578 CTGTGTGAATGAGAAGGCAATGG - Intronic
1153052042 18:908693-908715 CTGTTTCTGGGGGAGGGGAAAGG + Intronic
1153296999 18:3556205-3556227 CTGTGTGTGTGTCGGGGGAAGGG - Intronic
1153835918 18:8963657-8963679 CTGTGTGTGTGGGTGGGGACGGG - Intergenic
1153848367 18:9069991-9070013 CTGCGTGAGTGGGACGGGCCTGG - Intergenic
1153917236 18:9757157-9757179 CAGTGTGGGTGGCTGGGGAAGGG + Intronic
1154017983 18:10637407-10637429 ATGTGTGAGTGGGAGGGGCAGGG + Intergenic
1154186887 18:12192175-12192197 ATGTGTGAGTGGGAGGGGCAGGG - Intergenic
1155167104 18:23240349-23240371 CTGTGTGTGTGTAGGGGGAAGGG - Intronic
1155306741 18:24485940-24485962 CTGTGAGAATGGAAGAGGAAGGG + Intergenic
1156519784 18:37712578-37712600 GTGTGTGTGAGGGAGGGGAGGGG - Intergenic
1157868970 18:51211952-51211974 GTGTGTGTGTTGGAGGTGAAGGG + Intronic
1157888203 18:51389176-51389198 TTGTGTCAGTGGGCTGGGAAAGG - Intergenic
1157909667 18:51603993-51604015 GTGTGTGTGTGGCAGGGGATGGG + Intergenic
1158446473 18:57526534-57526556 CTGAGTCAGTGGGATGGGAAAGG + Intergenic
1158553102 18:58453704-58453726 CAGGGTGAGTGGGAGTGAAAAGG - Intergenic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159170923 18:64765656-64765678 GTGGGTGGGTGGGTGGGGAAAGG - Intergenic
1159380198 18:67646492-67646514 GTGAGAGAGAGGGAGGGGAAAGG + Intergenic
1160312770 18:77811290-77811312 CTGGGTGGGAGGGAGGAGAAAGG + Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160598091 18:79991277-79991299 CTGAGGGAATGGGAGGGAAATGG - Intronic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1161556573 19:4945970-4945992 GTGTGTGTGTGGGAGGGGTGGGG + Intronic
1161709448 19:5839633-5839655 CTGCAGGAGTGGGTGGGGAAAGG - Exonic
1161715760 19:5875430-5875452 CTGCAGGAGTGGGCGGGGAAAGG - Intronic
1161726368 19:5931575-5931597 CTATGTGAGTGGGGGTGGGAGGG - Intronic
1162333129 19:10042662-10042684 CTGTGTGAGTTGGAAGGGTTGGG + Intergenic
1162504904 19:11077824-11077846 CTGTGTGATTAAGAGGAGAAAGG - Intergenic
1163064248 19:14781492-14781514 TTGTGTGTGTGTGAGGGGGACGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163546517 19:17943994-17944016 CTAAGTGAGTGGGTGGGGAGAGG + Intergenic
1164157793 19:22607082-22607104 CTGTGTGAGTGGCAGCGGCTTGG + Intergenic
1164235398 19:23328286-23328308 CTTTGTGTATGGGAGAGGAATGG + Intronic
1164534790 19:29077007-29077029 CTGAGTGTGTGGTGGGGGAAAGG - Intergenic
1164565098 19:29320162-29320184 ATGTGTGTGTGGGATGGGGATGG - Intergenic
1164950845 19:32335730-32335752 GTGTGTGTGTGGGTGGGGAAGGG - Intergenic
1165879261 19:39031455-39031477 CTGAGCTGGTGGGAGGGGAAGGG - Intronic
1165920376 19:39293909-39293931 CTGTGGGGGTGCGATGGGAATGG + Intergenic
1166361706 19:42255238-42255260 GTGTGTGAGTGCGCGGGGAGGGG - Intergenic
1166383549 19:42368432-42368454 CTGTATGGGGGGGAGGGGATGGG - Intronic
1166623400 19:44326388-44326410 GTGTGTGAGTGGGAGAAGTATGG + Intergenic
1166762839 19:45235458-45235480 CGGTGGGAGTAGGAGGGGCAGGG + Intronic
1166863586 19:45823309-45823331 ATGTGGGACTGGGAGGGGCAGGG - Intronic
1168153238 19:54460188-54460210 CTGTGTGTGTGGAAAGGGTAGGG + Intronic
1168682558 19:58326746-58326768 CTGTGTGAGGGTGAGGGTGAGGG - Intergenic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925130874 2:1493196-1493218 GTGTGTGAGTGGGTGGGGGGGGG + Intronic
925454521 2:4003725-4003747 GTGTGTGTGTGGCAGGGGAGGGG - Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925826439 2:7852725-7852747 ATGTGTGAGTGGGAGGGGGTAGG - Intergenic
925991751 2:9260080-9260102 CTATGGAGGTGGGAGGGGAAAGG + Intronic
926012022 2:9416102-9416124 GTGAGTGAGTGGGATGGGATGGG - Intronic
926069559 2:9875282-9875304 CTGTAGGAGTGGGATGGGACAGG - Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926218987 2:10922757-10922779 CAGTGGGGGTGGGAGGGGAGGGG - Intergenic
926841755 2:17088836-17088858 CAGTGAGGGTGGGAGGGCAAGGG + Intergenic
926896418 2:17694198-17694220 GTGTGTCAGTGGGATGGGAGGGG + Intronic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927687208 2:25179336-25179358 GTGTGTGTGTGTGATGGGAAGGG + Intergenic
927826830 2:26315168-26315190 CTGAGGGAGTGGGAGTGAAAGGG + Intronic
928018926 2:27685570-27685592 CTGTGTGAGTTGGAGGGCAGTGG + Intronic
928082999 2:28326604-28326626 CAGTCTGAGAGGGAGGGGGATGG + Intronic
928107170 2:28478018-28478040 CTGTGTGAGAGGGAGTGGCTGGG - Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929659606 2:43770435-43770457 GAGTGGGGGTGGGAGGGGAAGGG + Intergenic
929828768 2:45330817-45330839 CTGTGTGTGTTGGGGAGGAAAGG - Intergenic
930070031 2:47358812-47358834 CTGTCTGCGTGGGGGGGAAAAGG + Intronic
930242380 2:48949288-48949310 CTATGTGAGTTGGAGGAGGATGG - Intergenic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
931748049 2:65307946-65307968 CTGTGTGAATGGGGGGGGCGGGG - Intergenic
932113581 2:69024149-69024171 GTGAGTGAATGGGAGAGGAAAGG + Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932705438 2:74020934-74020956 ATGAGTGAGTGGGAAGGGGAGGG - Intronic
933124589 2:78588384-78588406 CTTTGTGAGTGGTAGGGGACAGG - Intergenic
933685178 2:85135721-85135743 CTGACTGAGAGAGAGGGGAATGG + Intronic
933894125 2:86795008-86795030 GTCTGGGAGTGGGAGGGGGAAGG - Intronic
934610121 2:95729301-95729323 GTGTGTGTGTTGGAGGGGAGGGG + Intergenic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935703697 2:105837421-105837443 CTGTGTGATTGTGTGGGGAGTGG + Intronic
935747408 2:106200804-106200826 GTGTGTGTGTGTGAAGGGAAAGG - Intergenic
935895890 2:107737151-107737173 CTCTGTCAGTGGGTGAGGAAAGG + Intergenic
936451068 2:112634478-112634500 CTGGGGCAGTGGGAGGGGTAGGG + Intergenic
936543456 2:113370902-113370924 GTGTGTGTGTTGGAGGGGAGGGG + Intergenic
937209890 2:120261664-120261686 GTGAGTGAGATGGAGGGGAAGGG + Intronic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937310140 2:120897031-120897053 CTGTGTGAGGGAGAGGGGCTGGG + Intronic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938870878 2:135474960-135474982 GTGTGTGAATGGGAGTGCAAGGG - Intronic
939425649 2:142032848-142032870 CTGAGAGAATGGGAAGGGAAGGG - Intronic
939875656 2:147574475-147574497 ATGTGTGAGAGTGAGGGGTATGG - Intergenic
940078501 2:149771480-149771502 CTTGGTGAGGGGGAGGGGAAAGG + Intergenic
940210149 2:151248454-151248476 CTGTAAGAAGGGGAGGGGAAAGG + Exonic
940906009 2:159170602-159170624 CTGTGTTTGTGGGAAGGGATTGG + Exonic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
941874324 2:170417941-170417963 CTTTCTGAGTGGGAGGGAATGGG + Intronic
941937583 2:170997366-170997388 CTGTGTGTGTGGGTGGGGTGGGG + Intronic
942948779 2:181699587-181699609 GTCGGTGAGTGGGAGGGGAGAGG + Intergenic
943240917 2:185382844-185382866 CTGTGTGTGTGGGAAGGGGTGGG - Intergenic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
944995859 2:205292593-205292615 CTGTGTGTCTGGGAGGGAACAGG - Intronic
945154763 2:206827022-206827044 CTGTGTGAGCTGGATGGGAATGG + Intergenic
945741093 2:213662161-213662183 AGGGGTGAGGGGGAGGGGAAAGG + Intronic
946073103 2:217051192-217051214 CTGAGTGAGAGGGAAGGAAAGGG + Intergenic
946333268 2:219022152-219022174 CTCTGTGAGTGGGAGGGCTCTGG - Exonic
946620603 2:221558312-221558334 GTGTGTGTGTGGGCAGGGAATGG + Intronic
947111754 2:226726117-226726139 CTGTGTGTGTGGGTGGGGTGAGG + Intergenic
947257667 2:228183132-228183154 CTGTATGTGTGGAATGGGAAGGG - Intergenic
947403969 2:229755552-229755574 CTGTGGGAGGGCGAGGGGAGTGG + Intergenic
947531892 2:230914642-230914664 TTGTGGGTGGGGGAGGGGAACGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
948227326 2:236321493-236321515 GTGTGTGAGTGGGTGTGGAGAGG - Intergenic
948265361 2:236631991-236632013 CAGTGTGTGTGAGCGGGGAAAGG + Intergenic
948283886 2:236769351-236769373 CTATGAGAGCGGGAGGGAAAGGG + Intergenic
948578224 2:238967599-238967621 CTGTGTGAGTGCGTGAGGAGAGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948982280 2:241500529-241500551 CTGTGGGAGTGGGCGGGGGCAGG - Intronic
949004603 2:241637896-241637918 CGGTGGGAGCGGGAGGGGGACGG + Intronic
1169224197 20:3846358-3846380 CTGTGGGAGTGGGAGCGGGCGGG - Intergenic
1169286940 20:4316862-4316884 GTGTGAAAGAGGGAGGGGAAAGG + Intergenic
1169648565 20:7841879-7841901 CTGTATGAGTAGGAGAGAAATGG + Intergenic
1170428462 20:16257941-16257963 GTGTGTGTTTGGGATGGGAAAGG - Intergenic
1170428651 20:16258744-16258766 GTGTGTGTTTGGGATGGGAAGGG - Intergenic
1170428713 20:16258973-16258995 GTGTGTGTTTGGGATGGGAAGGG - Intergenic
1170602814 20:17854569-17854591 CTGTGTGATGGGGATGAGAAGGG + Intergenic
1170848807 20:19985005-19985027 CAGTGGCAGTGAGAGGGGAAGGG + Intronic
1171186505 20:23127404-23127426 CTGCCTGAGTGGGAGAAGAAAGG + Intergenic
1171330376 20:24332187-24332209 CTGGGAATGTGGGAGGGGAATGG + Intergenic
1171378239 20:24710258-24710280 ATGTGTGAGTGAGTGAGGAATGG + Intergenic
1172038675 20:32028698-32028720 CTGTGCAAAAGGGAGGGGAAAGG + Intronic
1172175227 20:32968127-32968149 CTGGGTGATGGAGAGGGGAAGGG + Intergenic
1172361660 20:34316938-34316960 CTGTGTGAGTGGGCAGGGCTGGG + Intergenic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172716736 20:36969905-36969927 TTGTGGGAGTGGTAGGGTAAAGG - Intergenic
1172780411 20:37433366-37433388 GTGTGTGGCTGGGTGGGGAAGGG + Intergenic
1173125200 20:40330149-40330171 CTGAGTGAGTGGGTTGGGGAGGG + Intergenic
1173316394 20:41948620-41948642 CTGTGGGAGTGGGAAGAGACAGG - Intergenic
1173381689 20:42550328-42550350 TGATGTGAGTGGGAAGGGAAAGG + Intronic
1173564964 20:44032076-44032098 CGGTGTGAGGGGCAGGGGAGCGG + Intronic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173846362 20:46191246-46191268 TTGTATGAGGGGGATGGGAAAGG + Intronic
1174459333 20:50671848-50671870 ATGAGTGAGTGGGTGGGGATGGG + Intronic
1174941052 20:54927855-54927877 TTGGGTGAGTAGGAGGGGTAAGG - Intergenic
1175027126 20:55914201-55914223 CTGTGTGACTTGGAGAGGAGGGG + Intergenic
1175050032 20:56146691-56146713 ATGTGTGTGTGGGGGGGGATGGG - Intergenic
1175597653 20:60248138-60248160 GTGTGTGTGTGGGAGGGGGGGGG - Intergenic
1175770877 20:61623360-61623382 CTTTGTGATGGGGTGGGGAAAGG - Intronic
1175875900 20:62229372-62229394 GAGTGTGAGTGTGTGGGGAATGG - Intergenic
1176137751 20:63531874-63531896 TTGTGTGAGGGCGAGGGGTACGG + Intronic
1176259001 20:64169170-64169192 CTGCCTGAGTGGGAGGAGAGTGG + Intronic
1176894146 21:14355983-14356005 CTCTGTGAATGGGAAGGGAGAGG + Intergenic
1178266986 21:31152501-31152523 GTGTCTGAGAGGGAGGGGAATGG - Intronic
1178393006 21:32214787-32214809 GTGAGTGAGTGGCAGGGCAAGGG - Intergenic
1178393058 21:32215005-32215027 CTCTGTGAGAGGGAGGGCAATGG + Intergenic
1178439201 21:32584614-32584636 CGGTGTGAGTGGGATGTGAGTGG + Intronic
1178999857 21:37447000-37447022 CTGTGTGAGAGGGATGGGTTGGG + Intronic
1179534954 21:42045375-42045397 CTGTGTGGGTGGGGGTGGATGGG + Intergenic
1180013978 21:45071137-45071159 CTGTGTGGCTGGAAAGGGAAAGG + Intergenic
1180148958 21:45937948-45937970 CTGTGTGCAGAGGAGGGGAAAGG + Intronic
1180296793 22:10946222-10946244 TTGTGTGGGTGGGGGGGAAAAGG + Intergenic
1180742181 22:18061364-18061386 CAGTGTGTGTGGGAGGAGAACGG + Intergenic
1180871605 22:19150006-19150028 CTGGGTGAGTGGGCGCGGAGCGG - Exonic
1181990379 22:26832495-26832517 CTATGTGGGTCGGAGGGAAATGG - Intergenic
1182436392 22:30333239-30333261 CTGGGTGAGAGGGAGAGGCAGGG + Exonic
1182826845 22:33273056-33273078 CTGCAAGAGTGGGAGGGGAATGG + Exonic
1183353867 22:37348397-37348419 CTGTGTTAGGGGGCAGGGAAGGG + Intergenic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183656865 22:39190989-39191011 GTGTGGGGGTGGGAGAGGAATGG + Intergenic
1183799612 22:40150936-40150958 ATGTGTGTGTAGGAGGGGAGGGG - Intronic
1183896349 22:40972287-40972309 CTGTAAGATGGGGAGGGGAAAGG + Intronic
1184073890 22:42163891-42163913 CAGTGTGAGCGAGAAGGGAAGGG - Intronic
1184114997 22:42417152-42417174 CTGTGTGAGGGTGAGGGGCGAGG - Intronic
1185083040 22:48720307-48720329 CAGTGTCAGAGGGATGGGAACGG - Intronic
1185227540 22:49661417-49661439 CTGTGTGAGTGGCAGGGCCAAGG - Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
1185396953 22:50597321-50597343 CGGTGTGAGGAGCAGGGGAAAGG + Intronic
949141587 3:640164-640186 GTGTGTGTGTTGGAGAGGAAGGG + Intergenic
950043419 3:9934258-9934280 CTGTGGGGATGGGTGGGGAAAGG - Intronic
950428740 3:12938824-12938846 CTGTGTGTGTTGGGGGCGAAGGG + Intronic
950520536 3:13495283-13495305 GTGGGAGAGTGGGAGGTGAAGGG - Intronic
950717292 3:14858239-14858261 GTGAGTGAGTGTGAGGGGATGGG + Intronic
950953852 3:17029791-17029813 CTGTGTGTGGTTGAGGGGAAGGG - Intronic
951078700 3:18425803-18425825 GTGTGTGAGTGGGAGGGAGGAGG + Intronic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
952546240 3:34422560-34422582 TTGTGAGAGTGGGGGGGGTATGG + Intergenic
952726995 3:36597034-36597056 ATGTGAGAGAGGGAGGAGAAGGG - Intergenic
953005644 3:38976748-38976770 GTGTGGGAGAGAGAGGGGAAGGG - Intergenic
953129627 3:40125497-40125519 CTGAGTCAGTGGGCTGGGAAAGG - Intronic
953393596 3:42548875-42548897 CATTGTGTGTGGGAGGAGAAAGG - Intronic
953607024 3:44418935-44418957 TTGTGTGTGTGGTAGGGAAAGGG - Intergenic
953921401 3:46954417-46954439 GGGTGTGTGTGGGAGGCGAAAGG - Intronic
954092073 3:48292975-48292997 CTGTGGGACTTGGAGGGCAAGGG + Intronic
954270355 3:49503128-49503150 CTGTGTGCCTAGGAGTGGAAGGG + Intronic
954466003 3:50655179-50655201 CTGTGAGACTGGGAGAGGTAAGG + Intergenic
954529677 3:51308145-51308167 CTGTGGAGGTGGGAGGGGAAGGG + Intronic
954615661 3:51967667-51967689 CTCTGGGAGTGGCAGGGGAAGGG - Intronic
954631840 3:52052001-52052023 CTGGGAGGGTTGGAGGGGAAAGG - Intronic
955782076 3:62495379-62495401 CTGTGTGACCGGGTTGGGAAAGG + Intronic
956362618 3:68465121-68465143 CTGGGTGGATGGGAGGGGAGAGG + Intronic
956789449 3:72669169-72669191 TTGTGTGGGTGTGGGGGGAATGG - Intergenic
956825929 3:72996933-72996955 GTGTGTGCGAGGGAGGGGGAGGG + Exonic
956996952 3:74837352-74837374 CTGAGTCAGTGGGCTGGGAAAGG - Intergenic
957453323 3:80408506-80408528 CTGTGTAAGTGACAGGGGAAAGG - Intergenic
957853562 3:85843888-85843910 ATGTGTGTGTGGGGGGGGAGCGG + Intronic
958420671 3:93926756-93926778 TAGTGTTAGAGGGAGGGGAAAGG - Intronic
959063051 3:101633253-101633275 CTGTGTGAGTGTGTTGTGAATGG + Intergenic
961389957 3:126546563-126546585 CTGTGTGAGAGGGAGAGGCGGGG - Intronic
961648598 3:128406005-128406027 CTGTGAGAGTGGCATGGGACAGG - Intronic
962429804 3:135308545-135308567 CTGTGTGTCTGGGATGAGAATGG - Intergenic
962463559 3:135636531-135636553 GTGTGTGTGTGTGATGGGAATGG - Intergenic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
963973281 3:151453001-151453023 CTGTGTGCCTGGGATGGGCAGGG + Intronic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964654792 3:159054474-159054496 CAGGGAGAGAGGGAGGGGAATGG - Intronic
964838094 3:160962896-160962918 CTGCTTGAGAGGGAGGTGAAGGG - Intronic
965422225 3:168475382-168475404 TTATGTGTGTGGGAGGGGAGGGG - Intergenic
965502207 3:169470564-169470586 GTGTATGAGGGGGAGGGGACAGG + Intronic
965505447 3:169510220-169510242 CTCTGTGATTGGGATGTGAAGGG + Intronic
965616925 3:170603420-170603442 CTGAGTGAATGGGATGGGAGAGG + Intronic
966863373 3:184242773-184242795 CTGGGGGAGTGGGAAGGGATAGG - Intronic
966917985 3:184595127-184595149 GTGTGTGTGTGGTGGGGGAAGGG + Intronic
967971924 3:195005561-195005583 CAGGGAGAGTGGGAGGGAAAGGG - Intergenic
968032831 3:195517312-195517334 TTGTGTGAATGGGGGAGGAAAGG + Intronic
968298866 3:197598415-197598437 TTGTGGGTGTGGGAAGGGAATGG + Intergenic
968597932 4:1494951-1494973 CTGTGTGAGGGGGACAGGATAGG + Intergenic
969439164 4:7207329-7207351 CTGTGTGGGCGGGAGGGGCTCGG - Intronic
970236814 4:13967048-13967070 CAGAGGCAGTGGGAGGGGAAGGG + Intergenic
970503400 4:16702382-16702404 TTAGGGGAGTGGGAGGGGAACGG - Intronic
971529084 4:27661909-27661931 GTGGGTGGGTGGGAGGGGGATGG - Intergenic
972288886 4:37672610-37672632 CTGGGTGGGTGGGAGGGATAGGG - Intronic
972654870 4:41054892-41054914 CTGTTTGATCGGGAGGGGCAGGG - Intronic
972807859 4:42548694-42548716 ATGTGTGAGTGGGAGGGGAAGGG - Intronic
972822767 4:42721216-42721238 ATGTGTGTGTGGGTGGGGAGTGG + Intergenic
972919682 4:43922818-43922840 GTGATTGAGTAGGAGGGGAAAGG + Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973791553 4:54382682-54382704 GTGTGTGTGTGGGAGGGCAGGGG + Intergenic
974798234 4:66781000-66781022 GTGAGTGAGTTGGAGGTGAATGG - Intergenic
975677780 4:76844240-76844262 TTGTGTCAGTGGGCTGGGAAAGG + Intergenic
975818830 4:78248360-78248382 CTTTGTGAAAGGGAGGGGAAAGG + Intronic
976058485 4:81098061-81098083 TTGTGTTAGTGGGCTGGGAAAGG + Intronic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977132963 4:93266459-93266481 ATGTGTGTGTGGGAGGGGAGTGG - Intronic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977627057 4:99198982-99199004 TTGAGTCAGTGGGATGGGAAAGG - Intergenic
977718173 4:100207746-100207768 CTTTTTGAGTGGGAGAGGAAGGG + Intergenic
978067594 4:104424737-104424759 CAGTGTCAGTGAGAGGGGGAGGG + Intergenic
978379652 4:108113448-108113470 TTGTGGGGGTGGGAGGGAAACGG + Intronic
978387956 4:108194826-108194848 TTGTGGGAGTGGGAGGGCAGGGG - Intergenic
978419285 4:108512955-108512977 GTGTGTGAGTGGGGGTGGAGGGG - Intergenic
978560739 4:110031035-110031057 GTGTGTGTGTGGGAGGGGGCTGG + Intergenic
978624857 4:110673698-110673720 GTGAGTGAGTGGTGGGGGAATGG - Intergenic
979084448 4:116388990-116389012 CTGAGAGACTGGGTGGGGAAGGG + Intergenic
979342353 4:119541048-119541070 CTAAGCCAGTGGGAGGGGAAGGG + Intronic
979511168 4:121555667-121555689 CTGTGAGAGTGGTAAGGCAAGGG - Intergenic
980407626 4:132374032-132374054 ATCTGTCAGTGGGAGGGGGAAGG - Intergenic
980549195 4:134311738-134311760 TTGAGTGAGTGGGCTGGGAAAGG + Intergenic
980964604 4:139508966-139508988 ATGTGTGTGTGTGAGGGGAGGGG + Exonic
981011373 4:139928668-139928690 CTGTGTGTCTGGGTGGGAAATGG + Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
983523604 4:168736883-168736905 CAGTGGGAGGGGGAGGGGAGTGG + Intronic
983815592 4:172122556-172122578 AAGTGTTAATGGGAGGGGAATGG + Intronic
983942310 4:173548009-173548031 CTGTGTGAGTGGAACAGGAATGG - Intergenic
985190837 4:187370926-187370948 ATGTGTCAGCTGGAGGGGAATGG + Intergenic
985547207 5:515746-515768 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547214 5:515774-515796 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547221 5:515800-515822 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547228 5:515828-515850 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547235 5:515854-515876 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547242 5:515882-515904 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547249 5:515910-515932 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547256 5:515936-515958 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547263 5:515966-515988 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547270 5:515992-516014 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
985547285 5:516045-516067 GTGTGTGTGTGTGAGGGGCAGGG - Intronic
986464944 5:8011760-8011782 CTGTGTGAGAGGGTGCGAAATGG + Intergenic
986791612 5:11166592-11166614 TGGTGGGAGTGGGAGGGGGAGGG + Intronic
986835038 5:11627691-11627713 CTGGGTGTGGGGGAGGGCAATGG + Intronic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
987957376 5:24757863-24757885 CTGAGTTAGTGGGCTGGGAATGG + Intergenic
988267924 5:28975014-28975036 TTGAGTCAGTGGGATGGGAAAGG - Intergenic
988281203 5:29149520-29149542 CTGTGTGTGTCTGAGGGGAGAGG - Intergenic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
988735980 5:34021758-34021780 CTGTGGCAGGGTGAGGGGAAAGG + Intronic
989092882 5:37752595-37752617 TTGCATGAGTGGGAGGGGTATGG + Exonic
990181931 5:53170789-53170811 CTAGGTGAGGGGGAGGAGAAGGG - Intergenic
990390699 5:55317037-55317059 GTGTGTGTGTGGGAGGGGGGAGG - Intronic
990760345 5:59122399-59122421 GTGTGTAGGTGGGAGGGGAGGGG + Intronic
991584184 5:68186088-68186110 CTGTGTGTGTGGGTGGGGTCCGG + Intergenic
991634372 5:68689647-68689669 GGGTGTGAGTGAGAGGGGAGGGG + Intergenic
991645498 5:68796694-68796716 ATGTGAGAGTAAGAGGGGAAAGG - Intergenic
991932357 5:71766229-71766251 CTTTGTGAGTGGGAGGAGGCAGG + Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992162541 5:74016866-74016888 CAGTGTAAGGGGGAGGTGAATGG + Intergenic
992217212 5:74537929-74537951 CTTTCTCAGTGGCAGGGGAAGGG - Intergenic
992333903 5:75745715-75745737 GAGTGTGGGAGGGAGGGGAATGG - Intergenic
992487756 5:77211488-77211510 CTGGGGGACTGGGCGGGGAAGGG + Intronic
992556345 5:77907105-77907127 CTGTGGAAGTGGGATGGCAAAGG + Intergenic
992673545 5:79083085-79083107 TTGTGGGAGGTGGAGGGGAATGG + Intronic
992981783 5:82182713-82182735 GAGTGTGAATGGGAGGGAAATGG + Intronic
993877278 5:93322525-93322547 GTGTGAGAGAGGGAGGGCAAGGG + Intergenic
994127906 5:96190322-96190344 CAGTGTGTGTGAGTGGGGAAGGG + Intergenic
995027218 5:107438291-107438313 CTGTGTAATTGGGATGGCAATGG - Intronic
995183708 5:109251144-109251166 GTTGGTGTGTGGGAGGGGAAAGG - Intergenic
995507989 5:112880350-112880372 GTGTGTAAGATGGAGGGGAAAGG + Intronic
995518754 5:112979894-112979916 GTGTGTGTGTGGGTGGGGAAGGG + Intronic
995746970 5:115414432-115414454 CTTTATGAGTGGGAGTGGGAAGG - Intergenic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
997242168 5:132315486-132315508 CTGTGTGAGCGGGTGAGGCAGGG + Intronic
997283924 5:132665000-132665022 CAGCGGGAGTGGGAAGGGAAAGG + Intergenic
997305304 5:132831551-132831573 CTGTGGGAGCGGGAGGGCAGCGG - Intergenic
997335485 5:133106148-133106170 GTGTGTGTGTGTGTGGGGAAGGG + Exonic
997514273 5:134475480-134475502 GTGTGTGGGAGGGAGTGGAATGG + Intergenic
997774471 5:136588417-136588439 GTGAGTGGGTGGGAGGGGAAAGG + Intergenic
998093461 5:139383996-139384018 TTATGTGGCTGGGAGGGGAAAGG - Intronic
998150139 5:139752325-139752347 ATGTGTGGGTGGGAGTGGAAGGG - Intergenic
998153733 5:139772130-139772152 GAGTGGGAGTGGGAGTGGAAGGG + Intergenic
999102722 5:149039943-149039965 GTGTGTGGGAGGGAGGTGAAGGG + Intronic
999320852 5:150614282-150614304 CTGTGTGTGTGGTGGGGGAAGGG - Intronic
999532914 5:152482004-152482026 GTGTGTGTGGGGCAGGGGAAGGG - Intergenic
999645592 5:153714039-153714061 CTGGGTGACAGGGAGAGGAAGGG + Intronic
999756824 5:154670724-154670746 GTGTGGGAGTGGGAAGAGAAAGG - Intergenic
999831031 5:155320258-155320280 CTGTGTGGGTGGTTGGGGAGGGG + Intergenic
999849598 5:155523915-155523937 CTGTGTGCTTGGGAGGGGGATGG - Intergenic
1000843290 5:166248492-166248514 CTGCTTGAGTGGGTGAGGAATGG - Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001379357 5:171293443-171293465 CTTGGAGAGAGGGAGGGGAATGG - Intronic
1001550247 5:172597640-172597662 GTGTCTGTGTGGGAGGGGAGCGG + Intergenic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001758192 5:174186686-174186708 CTGTGTGTGTGGCCGGGGAGTGG - Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002082505 5:176745880-176745902 CTGTGTGTGTGCGCGGGGACTGG + Intergenic
1002250135 5:177923687-177923709 CTGAGGCAGTAGGAGGGGAAGGG + Intergenic
1002330269 5:178436111-178436133 CAGGCTGAGTGGGAGGGGAGAGG + Intronic
1002578714 5:180194152-180194174 CTGTGTGAGCCGGACGGGGAGGG + Intronic
1002639551 5:180624195-180624217 CTGGGTGAGGGAGATGGGAAGGG + Intronic
1002758487 6:183542-183564 CTCTGGGAGTGGGAGCAGAAGGG + Intergenic
1002804883 6:563381-563403 CTGTGTAAATGGGAAGGGAATGG - Intronic
1002987580 6:2205767-2205789 GTGTGTGTGTGGGGGGGGAGGGG + Intronic
1003159619 6:3624062-3624084 ATGCCTGAGTGGGAGGGAAAAGG - Intergenic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003764742 6:9222279-9222301 ATGTGTGTGTGGGAAGGGTAAGG + Intergenic
1004497370 6:16177188-16177210 CTTTGGGAGTGGGAGAAGAAAGG - Intergenic
1004739856 6:18448244-18448266 CCTTGAGAGTGTGAGGGGAACGG + Intronic
1006004092 6:30988774-30988796 CTCTGTGTGTGGGGGGGGAGGGG + Exonic
1006179599 6:32146879-32146901 CTGTGTGTGTGTCGGGGGAAGGG + Intergenic
1006188360 6:32192707-32192729 CTGTTTGGGTGGGAAGAGAATGG - Exonic
1006343035 6:33457416-33457438 ATATGTGGGTGGGATGGGAAAGG - Exonic
1006349791 6:33512685-33512707 CTGGGTGAATTGGAGGAGAAGGG - Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1006815776 6:36848849-36848871 CCATGTGTGTGGGAGGGGAAGGG + Intergenic
1006829747 6:36961641-36961663 CTGAGGGAGTGGGAGGAGAGGGG + Intronic
1006839447 6:37019119-37019141 CTGGGTCAGGGAGAGGGGAAAGG - Intronic
1006995406 6:38255254-38255276 CTGGGAGAGTTGGAGGGAAATGG + Intronic
1007099496 6:39235659-39235681 TGGTGGGAGCGGGAGGGGAAAGG + Intergenic
1007103665 6:39268640-39268662 GTGTGTGTGAGGGGGGGGAATGG + Intergenic
1009437653 6:63636201-63636223 CTGTGCGTGTGGAAGGGGATGGG - Intronic
1009671387 6:66756269-66756291 CTTTTTGAGTGGGAAAGGAAGGG + Intergenic
1009851579 6:69206341-69206363 TTGAGTCAGTGGGCGGGGAAAGG - Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1010753581 6:79641576-79641598 TTGTGTAAGTGGGATAGGAATGG + Intronic
1010765911 6:79777279-79777301 ATGTCTGGGTGGGTGGGGAAGGG - Intergenic
1011045308 6:83075432-83075454 ATATGTGAGTGTTAGGGGAATGG + Intronic
1011735167 6:90303192-90303214 CTGTGTGACTAGGAGGGAACTGG + Intergenic
1013575953 6:111483457-111483479 CTGGGTGAGGGGCAGCGGAAGGG + Intronic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1015413894 6:132926736-132926758 GTGTGTGAGCGGGAGGGGTAGGG - Intergenic
1015649989 6:135446145-135446167 GGGTGTGAGTGGGAGGAGAGAGG - Intronic
1015875615 6:137819038-137819060 CTGGGTGTGTGTTAGGGGAAAGG - Intergenic
1016031737 6:139344849-139344871 GAGTGTGATTGGGAGGTGAAGGG + Intergenic
1016134989 6:140530023-140530045 CTGAGTGAGGGAGTGGGGAATGG - Intergenic
1016540093 6:145154682-145154704 CTGTGTGAGTGAGGGTGGGAGGG + Intergenic
1016825715 6:148386789-148386811 GTGTGTGAGTTTGAGGGCAAAGG - Intronic
1016923417 6:149317759-149317781 CTGGCTGAGGGGGAGGGGAGGGG - Intronic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017769052 6:157631013-157631035 GTGTGTGAGTGGGTGTGTAAAGG - Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018659509 6:166073278-166073300 CTGCGTGAGTGGGAGCAGCAGGG - Intergenic
1018705645 6:166461581-166461603 ATGGGGGAGGGGGAGGGGAAGGG + Intronic
1018822422 6:167383585-167383607 CGGTGTGAGTGGGATGTGAGTGG + Intronic
1019171524 6:170135930-170135952 CTCTGCGAGTGGGAGCGGGAGGG - Intergenic
1019727392 7:2610734-2610756 CGGTGTGAGCGGGTGGGGCATGG - Exonic
1020182681 7:5934545-5934567 CTGGGTGAGTGGGATGGGATGGG - Intronic
1020300231 7:6790212-6790234 CTGGGTGAGTGGGATGGGATGGG + Intronic
1020353026 7:7244207-7244229 CTGTGTGTGTGGGTGTGGTAGGG - Exonic
1020462579 7:8441931-8441953 CTGTGGGGGTGGGCGGGGAGGGG + Intronic
1020899177 7:13982618-13982640 ATGTGTGTGTGGGCGGGGAGAGG - Intronic
1021912678 7:25401878-25401900 CTGTGTGCATGGTGGGGGAAGGG - Intergenic
1022229869 7:28404393-28404415 CTGACTGAGTGGGATGGGAGAGG - Intronic
1022244536 7:28545818-28545840 CTGTGTGTGTGTGAAGTGAATGG + Intronic
1023340756 7:39216923-39216945 GTGTGTGTGTGGGTGGGGAGGGG - Intronic
1023731604 7:43197314-43197336 CTGTGTGAGTGTGTGGGGGTGGG - Intronic
1023915043 7:44582356-44582378 CTGTGTGAGGGGGCGGGGCGCGG - Intergenic
1024117828 7:46209854-46209876 CTGTGGCAGTGGGAGAGAAAGGG - Intergenic
1024120298 7:46229973-46229995 CTGGCTCAGTGGGAGGGGAAAGG + Intergenic
1024683401 7:51717943-51717965 CTGCCTGAGGGGGAGGGAAAAGG + Intergenic
1024747273 7:52422484-52422506 CTGAGTCAGTGGGTGGGGAAAGG - Intergenic
1024903330 7:54347386-54347408 CTGTGTGAGCCGGTGGGGGAGGG + Intergenic
1024928483 7:54643472-54643494 ATGAGTGAGTAGGAGGGGACAGG + Intergenic
1026188801 7:68105631-68105653 CTGTGTGTGTGAGAAGGGGAAGG + Intergenic
1026576981 7:71580624-71580646 TTGTGACAGTGGGAGAGGAATGG + Intronic
1026867526 7:73832712-73832734 CTGTGGAGGTGGGTGGGGAAGGG + Intergenic
1028487259 7:91373592-91373614 CTGTGGGCCTGGGAGTGGAAAGG - Intergenic
1028899242 7:96077267-96077289 GTGTGTGTGTGGGAGGGGGCAGG + Intronic
1029239964 7:99153174-99153196 TTATGTAAGTGGGAGGAGAAAGG + Intergenic
1029241792 7:99168405-99168427 TTGTGTATGTGGGAGGGGAGGGG - Intergenic
1029432450 7:100539727-100539749 CGGTGTGGTGGGGAGGGGAAAGG + Intronic
1030493132 7:110264435-110264457 CTCTGTCAGTGTGAGGGCAAAGG - Intergenic
1030536204 7:110770484-110770506 AAGTGTGACTGGGAGGGGGAAGG - Intronic
1031112672 7:117630837-117630859 CTGTCTCAGTGGGTGGGAAAGGG + Intronic
1031331979 7:120476630-120476652 CTGTGTGTGGGGGAAGGGAGAGG + Intronic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032016663 7:128384274-128384296 CCGGGAGAGTGGGAGGGGCAGGG + Intergenic
1032132249 7:129239888-129239910 CTCTGTGTGTGGGAAGGGACTGG - Intronic
1032756055 7:134891768-134891790 ATGTGGGAGTGGGAGGGGAGAGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033898582 7:146107297-146107319 ATGTGCGAGTGTGGGGGGAATGG - Intergenic
1034192332 7:149222077-149222099 CAGGGTGGGTGGGAGGGGGAAGG + Intronic
1034701182 7:153097837-153097859 CTGAGAGAGAGAGAGGGGAAGGG + Intergenic
1034896316 7:154878589-154878611 CTGTGGGAGTGGGAGGAGTCAGG - Intronic
1034937281 7:155208395-155208417 CTGTGTGTGGGGGGAGGGAATGG + Intergenic
1035172289 7:157023664-157023686 CTGTGGGACTGAGAGGGAAAGGG + Intergenic
1035172314 7:157024154-157024176 CAGGGGGAGCGGGAGGGGAATGG - Intergenic
1035273026 7:157731612-157731634 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273034 7:157731644-157731666 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273042 7:157731676-157731698 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273050 7:157731708-157731730 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273058 7:157731740-157731762 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273140 7:157732090-157732112 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273176 7:157732250-157732272 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273184 7:157732282-157732304 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273192 7:157732314-157732336 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273200 7:157732346-157732368 CTGGGCGTGTGGGACGGGAAAGG - Intronic
1035273247 7:157732538-157732560 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273255 7:157732570-157732592 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273263 7:157732602-157732624 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273271 7:157732634-157732656 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273279 7:157732666-157732688 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273287 7:157732698-157732720 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273295 7:157732730-157732752 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273313 7:157732824-157732846 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273357 7:157733016-157733038 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273399 7:157733206-157733228 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273417 7:157733300-157733322 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035273518 7:157733778-157733800 CTGGGCGCGTGGGACGGGAAAGG - Intronic
1035336759 7:158134289-158134311 GTGTGTGAGAGGGAGCGGGAGGG - Intronic
1035675718 8:1454397-1454419 CTGCGTGAGTTTGAGGGCAAGGG + Intergenic
1036663968 8:10726767-10726789 CTCTGTGGCTGGGAGGGGGAAGG - Intronic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037360350 8:18067711-18067733 CTGTGAGTGTGGGAAGGAAATGG - Intronic
1037383971 8:18317876-18317898 CTGTGTGGGTGGCAAAGGAAGGG - Intergenic
1037459547 8:19095214-19095236 CCGTGTAAGTAGGAGAGGAAAGG + Intergenic
1037824728 8:22154541-22154563 ATCTGTGTGTGGGAGGGAAAGGG - Exonic
1037895667 8:22652515-22652537 ATGTGTGGTGGGGAGGGGAAGGG + Intronic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038940049 8:32294197-32294219 CCATGTGAGTGGGAAAGGAAAGG - Intronic
1040582716 8:48710302-48710324 CTGTGTGTGTGTGTGGGGGAGGG + Intergenic
1040885359 8:52256962-52256984 CTGGGTGAGAGGGAGGGAATTGG - Intronic
1041170859 8:55141118-55141140 AGGCGTGGGTGGGAGGGGAATGG - Intronic
1041207202 8:55511173-55511195 CTGTGTGTCTGGGGTGGGAAGGG - Intronic
1041223154 8:55671655-55671677 ATGTGAGAGGGAGAGGGGAAGGG - Intergenic
1041253840 8:55961869-55961891 GGGTGTGGGTGGGAGGGGATGGG - Intronic
1041970785 8:63740044-63740066 GTGTGTGGGGGGGCGGGGAAGGG - Intergenic
1042012553 8:64264073-64264095 CTGTGAGAGTGTGTGGTGAAAGG - Intergenic
1042359830 8:67869929-67869951 CTCAGTGAATGGGAGGGGGACGG + Intergenic
1042688120 8:71463638-71463660 GTGTGTGTGTGGGAGGGGGGAGG - Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1042841064 8:73124347-73124369 TTGTGTTAGTGGATGGGGAAAGG - Intergenic
1043375226 8:79641589-79641611 GTGTGTGAGAGGGAGGAGCAGGG - Intronic
1044469258 8:92547382-92547404 CTGAGTGAGGGAGAGAGGAAGGG - Intergenic
1044748590 8:95394904-95394926 CTGTGGGATTGGGATTGGAATGG - Intergenic
1044951209 8:97437257-97437279 GTGTGTGTGGGGGAGGGCAAGGG - Intergenic
1044971269 8:97622554-97622576 CTGTGAGAATGGGATAGGAAGGG - Intergenic
1045388477 8:101692649-101692671 CTGGGTGGGTAGGAGGGGAGAGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1046001652 8:108427393-108427415 TTGAGTGAGTGGGCTGGGAAAGG + Intronic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1046616618 8:116484783-116484805 GTGTGTGAGTGGGAGGACAGGGG - Intergenic
1047192399 8:122690117-122690139 GTGTGTGTGTGGGCGGGGAGAGG - Intergenic
1048061700 8:130925563-130925585 CTGAGTGAGTGGGATGGGTTGGG - Intronic
1048084358 8:131160928-131160950 TTGAGTCAGTGGGATGGGAAAGG - Intergenic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1048499127 8:134960017-134960039 AAGTGGGAGTGAGAGGGGAATGG + Intergenic
1048911058 8:139135532-139135554 CTGTGTGGGTGAGAGGCCAAAGG + Intergenic
1049055514 8:140233544-140233566 GTGTGTGAGAGAGAGAGGAAGGG - Intronic
1049270625 8:141693736-141693758 CTGAGGGAGAGGGAGGGGCACGG + Intergenic
1049443856 8:142621284-142621306 GTGTGTGAGTGGGTGGGCCAGGG + Intergenic
1049598147 8:143494080-143494102 CCTGGGGAGTGGGAGGGGAAGGG + Intronic
1049654271 8:143790886-143790908 CTGTGCTAGTGGGTGGGGGATGG + Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1050359926 9:4820231-4820253 CAGGGTGTGTGGGAGGTGAATGG + Intronic
1050534409 9:6619384-6619406 TTTTGGGGGTGGGAGGGGAAGGG + Intronic
1051008419 9:12379513-12379535 AGGTGTGGGTAGGAGGGGAAAGG - Intergenic
1051160438 9:14201346-14201368 GGGTGTGAGGGGGAGGGTAAAGG - Intronic
1051337336 9:16077670-16077692 ATCTGTGAGTGGGAGGGGTTTGG - Intergenic
1051376246 9:16405426-16405448 CTGGGTGAGTGATTGGGGAATGG - Intergenic
1051843844 9:21429504-21429526 CTTTGTAAGTGGGAGAGGAGAGG + Intronic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052756345 9:32546343-32546365 CTGTGTGTGTGGTAGAGGGAAGG + Intronic
1053379335 9:37636129-37636151 CTGGGAGTGTGGGAGGGGAGAGG + Intronic
1053477001 9:38389634-38389656 CTGTGTGGATTGAAGGGGAAAGG - Intergenic
1054969012 9:71062795-71062817 GGGTGTGAGTGAGAGGGGAGGGG - Intronic
1055202941 9:73689747-73689769 GTGTGTTTGGGGGAGGGGAAAGG + Intergenic
1055471984 9:76621064-76621086 ATGTGTGTGTGTGAGGGGAGAGG + Intronic
1055762922 9:79628739-79628761 TTGTGTGATGGGCAGGGGAAGGG + Intronic
1056141769 9:83688298-83688320 CTGTATCAGTGTGAGGGGAAGGG - Intronic
1056219022 9:84433033-84433055 CCATGTGAGTGGAAGGTGAAAGG + Intergenic
1056232063 9:84557135-84557157 GCATGTGAGTTGGAGGGGAAAGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056561500 9:87733866-87733888 CTGTGTGACTGAGAGGTGCATGG - Intergenic
1056836295 9:89958274-89958296 GCGTGTGTGTGGCAGGGGAAGGG + Intergenic
1056897950 9:90568392-90568414 CTGTGTGGGTGGGAGAGGTCTGG - Intergenic
1056914326 9:90731613-90731635 CTGTGTGTGTGTGTGGGGAGGGG + Intergenic
1057115686 9:92519123-92519145 CTGAGTTAGTGGTCGGGGAAAGG - Intronic
1057476956 9:95411283-95411305 CTGTGGGAGTGGGCGGGGGCGGG + Intergenic
1057685390 9:97229590-97229612 GTGTGTGAGTGAGAGGGGTGAGG + Intergenic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1057941687 9:99290554-99290576 CTGAGTCAGTGGGCTGGGAAAGG - Intergenic
1058020302 9:100079118-100079140 CTGAGTCAGTGGGCTGGGAAAGG + Intronic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058330487 9:103754131-103754153 TTGAGTCAGTGGGATGGGAAAGG + Intergenic
1058347562 9:103982072-103982094 CTGAGTCAGTGGGCTGGGAAAGG + Intergenic
1058625307 9:106927974-106927996 TTGTGAGAGAGGGAGGGGATGGG - Exonic
1059332087 9:113542106-113542128 CTGTGTGTGGGGGTGGGGATGGG + Intronic
1059505424 9:114794876-114794898 GTGTGTGAGTGGGAGAGGATGGG + Intronic
1059750191 9:117240338-117240360 CTGTGTGTGTGACAGCGGAAGGG + Intronic
1059842037 9:118228426-118228448 GTGTGTGTGTGTGAGGGGACAGG - Intergenic
1060132920 9:121122597-121122619 AGGTGTGAGTGGGAGGGCAAAGG + Intronic
1060681219 9:125566954-125566976 CTGTGTGACTAGGAGGGATAGGG - Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061256523 9:129456757-129456779 CTGTATGAGTGGGTGGTGAGTGG + Intergenic
1061512804 9:131071276-131071298 CCGTGAGGATGGGAGGGGAAGGG + Intronic
1061552928 9:131348558-131348580 CAGTGAGGGTGGGAGGGGAATGG - Intergenic
1061600746 9:131668560-131668582 CTGTGAAAATGGGAGGGGAGGGG - Intronic
1061661628 9:132134055-132134077 GTGTGTTAGTGGGAGGGAAGAGG - Intergenic
1061682526 9:132250097-132250119 CTCTGTGGGCAGGAGGGGAAAGG - Intergenic
1062035643 9:134381428-134381450 CTGTCTGAGCGGGAGAGGGAAGG + Intronic
1062242882 9:135549409-135549431 CTGGCTGTGTGGGATGGGAAGGG - Intronic
1062267650 9:135694732-135694754 GTGTGGGAGGGGGAGGGGAGGGG - Intronic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062532279 9:137007204-137007226 CTGCGTGTGTGGGTTGGGAAGGG - Intergenic
1062589455 9:137266844-137266866 CTGGGGGAGTGGGAGGGCCAGGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062733374 9:138121286-138121308 CTGTGTGCGGGGGAGGGCGATGG - Intronic
1185650277 X:1642507-1642529 CTGTGTGTGTGTGATGGGGACGG + Intronic
1185666190 X:1767243-1767265 ATGGGAGAGTGGGAGGGAAAAGG + Intergenic
1185842496 X:3405511-3405533 CCTTGTGGGTGGGATGGGAAGGG - Intergenic
1186148406 X:6648607-6648629 TTGTGTGTGTGGCAGGGGGATGG + Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186344377 X:8676488-8676510 CTGTTGAAGTGTGAGGGGAAGGG + Intronic
1186658357 X:11640988-11641010 CTGTGTAAGTGACAGGGGCATGG + Intronic
1186928116 X:14357631-14357653 CTGTGGGTGTGGGAGGGCATAGG + Intergenic
1187826558 X:23336967-23336989 GTTTGTGGGTGGGGGGGGAAAGG - Intronic
1187869771 X:23754934-23754956 CTTTGTGTGTGGGAGGGGTAAGG - Intronic
1188472246 X:30553794-30553816 ATGGGAGAGTGGGAGGGGGAAGG + Intergenic
1188567501 X:31543505-31543527 ATGTGTGTGTGGGAAGGGAGGGG - Intronic
1188726077 X:33583816-33583838 CTGTGTGTGGGGGTGGGGAGGGG - Intergenic
1188780203 X:34273945-34273967 GTGAGGGATTGGGAGGGGAATGG - Intergenic
1188947725 X:36327945-36327967 CTGTGAGGGTGGGAGGGAAGGGG + Intronic
1189393868 X:40602734-40602756 TTGTGTGTGGGGGATGGGAATGG + Intronic
1189509377 X:41646631-41646653 CTGAGAGAGTGGGATGGTAATGG - Intronic
1189555803 X:42144128-42144150 CTGTGGGAGAGGGAATGGAAAGG + Intergenic
1189761054 X:44322048-44322070 CTGGGGGTGGGGGAGGGGAAAGG - Intronic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1189938601 X:46097038-46097060 CTGAGTCAGTGGGCTGGGAAAGG + Intergenic
1190135629 X:47794873-47794895 ATGTGTGTGTGAGAGAGGAAGGG - Intergenic
1190325937 X:49206856-49206878 CTGTGTGGGTGGGAGGGCCAGGG + Intronic
1190741072 X:53289158-53289180 ATGTGTGTGTGGAGGGGGAAGGG - Intronic
1192072756 X:67958495-67958517 ATGTGTGTGTGGGTGGGGGAGGG - Intergenic
1192157724 X:68758924-68758946 CAGCCTGACTGGGAGGGGAAGGG + Intergenic
1192180761 X:68914357-68914379 ATGTGTGTGGGGGAGGGGAGCGG - Intergenic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1192990565 X:76450646-76450668 TAGTGTGTGTGGGAGGGGAGTGG - Intergenic
1193166429 X:78285894-78285916 CTGGGTGATAGGGAGGGTAAAGG + Intronic
1193331456 X:80239336-80239358 GTGTGTGTGTGGTAGGGGAGGGG + Intergenic
1193400987 X:81042232-81042254 GTGTGAGAGTGGGAGGGATAAGG - Intergenic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1193862583 X:86688416-86688438 CAGTGTCAGTGGGAATGGAAGGG + Intronic
1193934814 X:87604835-87604857 CTGTGACATTGGGAGGGGCAAGG - Intronic
1194584413 X:95715504-95715526 TTGTGTCAGTGGGCTGGGAAAGG + Intergenic
1194665856 X:96676728-96676750 CTGTGTGCATGGCAGGGGAGGGG + Intergenic
1194820533 X:98500861-98500883 ATGGGGGAGTGGGAGGTGAAGGG + Intergenic
1194889702 X:99363813-99363835 GTGTGTGTGTGGGCGGGGAGGGG - Intergenic
1194988493 X:100518320-100518342 CTGTGGGAGTTAGAGGGGAAGGG + Intergenic
1195000466 X:100638564-100638586 CGTTGTGAGTGGTAGAGGAAGGG - Intronic
1195169251 X:102249879-102249901 GTGTGTGTGTGTGAGGGGAGGGG - Intergenic
1195189606 X:102437209-102437231 GTGTGTGTGTGTGAGGGGAGGGG + Intronic
1195405564 X:104509209-104509231 GTGTGTGTGTGGGAGGGGGTTGG + Intergenic
1195594602 X:106673675-106673697 GTGTGTGTGTGGGGGGGGATGGG - Intronic
1195708775 X:107757713-107757735 CTGTGGGAACGGGAGGGGAAAGG - Intronic
1195979070 X:110558822-110558844 CAGTGTGGGGGGGAGGGGAAGGG + Intergenic
1196141032 X:112263754-112263776 CTGTGTGTGAGGGAGGGGTGAGG - Intergenic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196303505 X:114072921-114072943 CTTTGTAAGTTGGAGGGGGAGGG + Intergenic
1197244744 X:124156525-124156547 CTGAGTCAGTGGGCTGGGAAAGG - Intronic
1197757038 X:130002700-130002722 GTGTGTGAGAGAGAGGAGAAAGG + Intronic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199712910 X:150484384-150484406 CTGGGTAGGTGGGTGGGGAAAGG - Intronic
1199990815 X:152986938-152986960 GTGTGTGAGTGGGAGGGTGTGGG - Intergenic
1200033904 X:153316412-153316434 GTGTGTGAGTGGGAGGGTGTGGG - Intergenic
1200965041 Y:9027949-9027971 GTGTGTGTGTGGGAAGGGCAGGG - Intergenic
1201423351 Y:13823242-13823264 CTCTTTAAGTGTGAGGGGAAGGG - Intergenic
1202148070 Y:21820830-21820852 GTGTGTGTGTGGGAAGGGCAGGG + Intergenic