ID: 1017904914

View in Genome Browser
Species Human (GRCh38)
Location 6:158751341-158751363
Sequence GACATGTCCTGTCCTGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017904914_1017904920 6 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904920 6:158751370-158751392 TCCGCCTGGATTTCAGGGGCTGG No data
1017904914_1017904917 1 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904917 6:158751365-158751387 TCCTCTCCGCCTGGATTTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 144
1017904914_1017904915 -8 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904915 6:158751356-158751378 GACATGTCTTCCTCTCCGCCTGG 0: 1
1: 0
2: 1
3: 4
4: 123
1017904914_1017904916 0 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904916 6:158751364-158751386 TTCCTCTCCGCCTGGATTTCAGG 0: 1
1: 0
2: 0
3: 13
4: 179
1017904914_1017904919 2 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904919 6:158751366-158751388 CCTCTCCGCCTGGATTTCAGGGG 0: 1
1: 0
2: 6
3: 30
4: 574
1017904914_1017904922 7 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904922 6:158751371-158751393 CCGCCTGGATTTCAGGGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 178
1017904914_1017904924 20 Left 1017904914 6:158751341-158751363 CCTAGAACAGGACAGGACATGTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1017904924 6:158751384-158751406 AGGGGCTGGGTGAGTGCAGATGG 0: 1
1: 0
2: 8
3: 81
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017904914 Original CRISPR GACATGTCCTGTCCTGTTCT AGG (reversed) Intronic
901669265 1:10845785-10845807 GACATGTCCCCTCCTGTTTTTGG + Intergenic
902613510 1:17610717-17610739 GATGTGTTTTGTCCTGTTCTTGG + Intronic
903171570 1:21557837-21557859 GAAATGTTCTGTCTTGATCTGGG - Intronic
905020348 1:34806577-34806599 GACACGTCCTGCTCTGTTCTTGG - Intronic
907279978 1:53340993-53341015 GACACATCCAGCCCTGTTCTGGG - Intergenic
908287060 1:62618076-62618098 GACATGTCAAGTTCTGGTCTCGG + Intronic
908644169 1:66259295-66259317 GACAAGTCCTCTCCTCTTTTAGG + Intronic
910863417 1:91765257-91765279 TAGATGTCCTGCCCTGTGCTAGG - Intronic
914439694 1:147693610-147693632 GATATAGCCTGTCCTGTTTTAGG - Intergenic
914803714 1:150977548-150977570 GAGATGGCCTGTCCTCTCCTTGG - Intergenic
917898167 1:179513533-179513555 GATATGTCCTTTCCTGGTTTTGG + Intronic
919343595 1:196345963-196345985 GACATCTCCTCTCTTTTTCTAGG - Intronic
919397950 1:197073621-197073643 GTCATGTCCTTTCCTGGTTTTGG - Intergenic
919485383 1:198140015-198140037 GTCATGTCCTTTCCTGGTTTTGG + Intergenic
920979009 1:210814506-210814528 GTCATGTCATCTGCTGTTCTGGG + Intronic
921116425 1:212095842-212095864 GTCATGTCCTTTCCTGGTTTTGG + Intronic
921485979 1:215716034-215716056 AACATGTCACGTCCTGTTTTTGG + Intronic
921496699 1:215851711-215851733 GTCATGTCCTTTCCTGTTTTTGG - Intronic
922917862 1:229272827-229272849 GACTGGTACTGCCCTGTTCTTGG + Intronic
922995642 1:229957114-229957136 GATATGTCCTTTCCTGCTTTTGG + Intergenic
923099761 1:230802969-230802991 GACATGCCATCTCCTGTGCTCGG + Intergenic
923496740 1:234531938-234531960 CACATTGCCTGTCCTGTTCTTGG - Intergenic
1067782447 10:49218669-49218691 GACATCTACTGTGCTGTCCTGGG - Intergenic
1067815960 10:49477037-49477059 GCCATGGCCTGTCCTGCTCCAGG + Intronic
1070554666 10:77518349-77518371 GCCATGTGTTGGCCTGTTCTGGG - Intronic
1073201696 10:101740639-101740661 TACAGGTCCTGTCCTCATCTTGG - Intergenic
1073539349 10:104305797-104305819 GCCATTTCCAGTCCTGTCCTGGG + Intergenic
1073668501 10:105560814-105560836 GGCATGACCTGTCTTCTTCTTGG + Intergenic
1074665193 10:115714408-115714430 AACGTGGCCTCTCCTGTTCTAGG - Intronic
1075659465 10:124183402-124183424 GTCCTGTCCTGTCCTGTCCTGGG - Intergenic
1077423979 11:2465945-2465967 GACCTGCCCTGTCCTTTCCTTGG + Intronic
1079647583 11:22885526-22885548 GATATGTATTCTCCTGTTCTGGG - Intergenic
1089850297 11:121490089-121490111 AACATGTCAAGTCCTTTTCTTGG + Exonic
1092156411 12:6284559-6284581 GACATGTCCAGAGCTGTGCTGGG - Intergenic
1092194032 12:6538374-6538396 TACTTGTCCTGTCTTATTCTAGG + Intronic
1094789562 12:33896020-33896042 GTTATGTCCTTTCCTGGTCTTGG - Intergenic
1096012121 12:48227643-48227665 GTCATGTCCTTTCCTGGTTTTGG - Intergenic
1096425136 12:51495055-51495077 GACCTGTCTCGTCCTGCTCTGGG + Exonic
1100290683 12:93211706-93211728 GATATGTCCTCTCCTGGTTTTGG + Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104183693 12:126407731-126407753 GACTTGTTCTGTTCTGTTCTTGG + Intergenic
1105315228 13:19253270-19253292 GTTATGTCCTTTCCTGTTTTTGG - Intergenic
1106015597 13:25866095-25866117 CACATTTCCTGACCTGGTCTAGG - Intronic
1106908891 13:34441014-34441036 GACAGGCCCTGGCCTGTTGTGGG + Intergenic
1109125428 13:58511758-58511780 GTTATGTCCTGTCCTGGTTTTGG - Intergenic
1109567422 13:64135374-64135396 GTTATATCCTGTCCTGTTTTTGG - Intergenic
1112317673 13:98378225-98378247 AACTTGTTCTGTCCTGTTCTTGG + Intronic
1113966691 13:114156542-114156564 GACACTTCCTCTCCTCTTCTGGG - Intergenic
1114879851 14:26770795-26770817 GGCATGTCCTGTAGTGTGCTAGG + Intergenic
1116905043 14:50396329-50396351 AACATGTGCTGTTCTGTTCTAGG - Intronic
1118186862 14:63545525-63545547 GACATCTCCTATGCTGTTCTAGG - Intergenic
1120428206 14:84378333-84378355 GACATGACCTGACATATTCTAGG + Intergenic
1120776422 14:88442758-88442780 GATATGTCCTTTCCTGGTTTTGG + Intronic
1121324072 14:93009678-93009700 AACAGATCATGTCCTGTTCTGGG - Intronic
1121968974 14:98338977-98338999 AACATTACCTGTCCTTTTCTAGG - Intergenic
1122896340 14:104759314-104759336 GTCATGTCCTGAGGTGTTCTGGG + Intronic
1124047991 15:26168738-26168760 GACATGTCCTTTCCAGTGTTAGG - Intergenic
1125794762 15:42395979-42396001 AACATCTCCTTTCCTGTGCTGGG - Intronic
1126977580 15:54201336-54201358 GATATGTCCTGTCCTGGTTTTGG - Intronic
1126984174 15:54283576-54283598 GACATGTCCTTTGCTGTTAAGGG + Intronic
1127014781 15:54671996-54672018 GTTATGTCCTGTCCTGGTTTTGG - Intergenic
1128765716 15:70249983-70250005 GACAAGTCCTGGCCCCTTCTCGG + Intergenic
1129006193 15:72375689-72375711 GACTTGTCCCGCCCTGTTCCTGG - Intronic
1130827782 15:87567097-87567119 GACACGTGCTGTCCTATTCAGGG - Intergenic
1130834764 15:87639015-87639037 GAAATGTCCAGTCCTTTTCTTGG + Intergenic
1132271137 15:100526797-100526819 GACATGTTGGATCCTGTTCTAGG - Intronic
1132539669 16:502870-502892 GACAGGTCCTCCCCTGATCTGGG - Intronic
1133418504 16:5625197-5625219 AAAATATCCTGCCCTGTTCTGGG - Intergenic
1135142649 16:19934936-19934958 GACATGTCCTTTCCTGATCATGG + Intergenic
1136227751 16:28870403-28870425 GGCATGTCCTCTCCTCTCCTCGG - Intronic
1139386078 16:66572129-66572151 GGCATATCCTGTGCTGTGCTAGG - Intronic
1142249057 16:88982855-88982877 GAAGTGCCCTGTCCTGTCCTGGG + Intergenic
1144739880 17:17575923-17575945 AACATGTCCTGTTCTGCCCTGGG + Intronic
1147256567 17:39185414-39185436 GACATATCCTACCCTCTTCTGGG + Intronic
1149505766 17:57192589-57192611 GACATTTCCTGTCTCTTTCTGGG + Intergenic
1150208013 17:63423737-63423759 GACAAGTCCTGGCCTGTTTTAGG - Exonic
1152587541 17:81195743-81195765 TCCAAGTCCGGTCCTGTTCTGGG + Intronic
1153237099 18:2998659-2998681 GTCATGTATTTTCCTGTTCTGGG - Intronic
1153997569 18:10454964-10454986 GACATTTCCAGTCCTGCTCTGGG - Exonic
1155074146 18:22340571-22340593 TGCATGACCTGCCCTGTTCTCGG - Intergenic
1156383569 18:36585889-36585911 GAGATGTTCTGCCCTTTTCTAGG + Intronic
1156411000 18:36828568-36828590 GCGATGTCCACTCCTGTTCTGGG + Intronic
1158338424 18:56438459-56438481 GTCATGTCCTTTCCTGGTTTTGG - Intergenic
1159091130 18:63850788-63850810 AACATGTCCCATCCTGATCTCGG + Intergenic
1162640002 19:12000919-12000941 GACATTTCCTGTTCTGCTGTTGG + Intergenic
1163340679 19:16704904-16704926 GACATGCCCTCTCCTGTTATGGG + Intergenic
1164798681 19:31057826-31057848 TACATGCCATGTACTGTTCTTGG + Intergenic
1166202446 19:41247158-41247180 GGCAGGTCATGTTCTGTTCTTGG + Intronic
1167020960 19:46875369-46875391 GACCTGTCAGGTCATGTTCTAGG - Intergenic
1168621263 19:57881379-57881401 GGCATGTCCTGTGCTGAGCTGGG + Intronic
925931095 2:8708621-8708643 GACTTTTCCTGTAATGTTCTGGG + Intergenic
926797356 2:16629886-16629908 GACAAATCCTTTCCTTTTCTAGG - Intronic
928473243 2:31595726-31595748 GTTATGTCCTTTCCTGGTCTTGG - Intergenic
928495053 2:31822978-31823000 GACACGTACAGTCCAGTTCTTGG - Intergenic
930238016 2:48906223-48906245 GACATGTCCTTCTCTGCTCTGGG - Intergenic
931563212 2:63586783-63586805 GGAATGTCCTGTCCTGCTATAGG + Intronic
931855663 2:66299504-66299526 GACATGTCCTTTCTTCTCCTGGG - Intergenic
932035340 2:68240577-68240599 AACATGACCTGACCTGCTCTGGG + Intronic
932437334 2:71710279-71710301 CACATGTCCTGACCTATACTGGG + Intergenic
937071808 2:119069572-119069594 CACATGTCCAGTTCTGCTCTAGG + Intergenic
938108555 2:128549615-128549637 GAAATCTCTTGTCCTGTTTTGGG + Intergenic
940198821 2:151127390-151127412 AACATGTCCTGTCCCGTTCCTGG + Intergenic
940822123 2:158367377-158367399 GACCTCTCCTGTCCTCTTATTGG + Intronic
941460091 2:165760427-165760449 TGCATGTGCTGTCCTATTCTGGG + Intronic
941852676 2:170199786-170199808 TACATGTCCTATCCTGTGATAGG + Intronic
945865088 2:215165349-215165371 GTCATGTCCTTTCCTGGTTTTGG - Intergenic
948791265 2:240378028-240378050 CAGATGTCCTGGCCTCTTCTGGG + Intergenic
948804233 2:240446630-240446652 GCCATCTCTTGTCCTGTCCTCGG + Intronic
948806814 2:240456613-240456635 GACCTGTGCTCTCCTGGTCTGGG + Exonic
948923102 2:241075651-241075673 GGCTTGTCCTTCCCTGTTCTTGG + Intronic
1168790582 20:573321-573343 GACATGTGGTGTCATGATCTGGG + Intergenic
1169335310 20:4751052-4751074 CACATGTCAGGTACTGTTCTAGG - Intergenic
1169426404 20:5500744-5500766 GCCTGGTCCTGTCCTGTTCCGGG + Intergenic
1169709400 20:8544456-8544478 GACAAGTCATGTATTGTTCTTGG + Intronic
1171489055 20:25503823-25503845 TGCATGGCCTGTCCAGTTCTTGG + Intronic
1172239687 20:33404459-33404481 GACACGTCGTGTCTTGTTCATGG + Intergenic
1173004371 20:39128375-39128397 AACATGTCATTTCCTTTTCTTGG + Intergenic
1173437866 20:43048802-43048824 GAGAAGCCCTGTCCTGTCCTTGG + Intronic
1174111987 20:48203486-48203508 GAAATGTCATGGCCTGTTCTTGG - Intergenic
1174379862 20:50149538-50149560 GAGCCGTTCTGTCCTGTTCTGGG - Intronic
1174783533 20:53412172-53412194 AACACGTCCGGTCCTGCTCTGGG + Intronic
1177934509 21:27327285-27327307 GCCATATCCTGTTCTGTTGTTGG + Intergenic
1178660343 21:34502496-34502518 GACATGTCCTGTCCTTTATATGG + Intergenic
1178974320 21:37208632-37208654 CTCATGTGCTGCCCTGTTCTAGG + Intergenic
1180887613 22:19258413-19258435 GAGATGTCCAGTCCAGTCCTTGG + Intronic
1180891578 22:19292294-19292316 GACATTTCCTCTCCTGTATTTGG + Intergenic
1181056108 22:20261220-20261242 TACCTGTCCTGTCCTGCCCTGGG - Intronic
1181100200 22:20533776-20533798 GACGGGCCCTGTCCTGTCCTGGG - Intronic
1184254314 22:43278458-43278480 GACATCCCCTGCCCTGTTCCAGG - Intronic
952298695 3:32085138-32085160 GATCTTTCCTGTGCTGTTCTCGG - Intergenic
952434942 3:33263820-33263842 GTTATGTCCTGTCCTGGTTTTGG + Intergenic
952883343 3:37998690-37998712 GACATGGCCTGTCCTGCACGAGG + Intronic
954208322 3:49077349-49077371 GACATTTACTGTCCAGTGCTTGG - Intronic
956012312 3:64844777-64844799 TACATGTCTGGTGCTGTTCTAGG - Intergenic
957433202 3:80140704-80140726 GTCATGTCCTTTCCTGGTTTTGG - Intergenic
959756671 3:109907742-109907764 GTTATGTCCTTTCCTGGTCTTGG + Intergenic
961241325 3:125414383-125414405 TGTATGTCATGTCCTGTTCTGGG - Intergenic
961386507 3:126526009-126526031 CACCTGGCCTGTCCTGCTCTTGG + Intronic
962698996 3:137978853-137978875 GACATTTCCGGACCTGTCCTGGG - Intergenic
962803775 3:138912630-138912652 GTCCTGTCCTGTCCTGTCCTGGG + Intergenic
963319150 3:143794028-143794050 AACATGGCCTGACTTGTTCTAGG + Intronic
967394763 3:188995223-188995245 GACAGGTCCTTTCCTGTTAAAGG + Intronic
968042116 3:195597495-195597517 GACCTGTCTTTTCCTGTTCTTGG - Intergenic
968334506 3:197901458-197901480 GGCATTTCTGGTCCTGTTCTGGG + Intronic
969836420 4:9845973-9845995 TACATGTCAAGTCCTGTGCTAGG + Intronic
971203179 4:24531732-24531754 GACATGTTCTGTTCTTTTTTAGG - Intronic
971753048 4:30675973-30675995 AACAAGTCCTGCTCTGTTCTAGG - Intergenic
972125368 4:35758686-35758708 GGCAAGTCCTGTTCTGTGCTGGG - Intergenic
972736872 4:41850783-41850805 GACATGTTCTGTCTTAGTCTGGG - Intergenic
973635460 4:52858111-52858133 GACATGATCTGTCCTTTTCTGGG + Intergenic
974868032 4:67603921-67603943 GGCAAGTCCTGTGCTGTGCTGGG - Intronic
975760899 4:77618746-77618768 GACCTGTCCTGGGCTGGTCTTGG - Intergenic
977034325 4:91930453-91930475 TATAAGTCCTGTCTTGTTCTGGG - Intergenic
978598590 4:110404736-110404758 GATATGCCCTCTCCTGTTCTTGG + Intronic
979020606 4:115492400-115492422 GTTATGTCCTGTCCTGGTTTTGG - Intergenic
979498839 4:121415618-121415640 GATATGTCCTTTCCTGGTTTGGG + Intergenic
980033712 4:127859830-127859852 GTCATGTCTTTTCCTGGTCTTGG - Intergenic
981400629 4:144310016-144310038 GATATGTCCTTTCCTGGTTTTGG + Intergenic
985499363 5:232050-232072 GACTTGTCCTATACTTTTCTGGG + Intronic
986351190 5:6881068-6881090 CAAATGTCCTATCCTGTTCCAGG + Intergenic
990154599 5:52861479-52861501 GACATCTCCAGTTCTGTTTTTGG - Exonic
992577372 5:78129476-78129498 CACATGTCCTCTTCTGTACTGGG + Intronic
993141207 5:84036209-84036231 AACATGGCATGTCCGGTTCTTGG + Intronic
993250039 5:85510074-85510096 GATATGTCCTTTCCTGATTTTGG + Intergenic
993694520 5:91045210-91045232 GTTATGTCCTTTCCTGGTCTTGG - Intronic
995187310 5:109285714-109285736 GATGTGTCCTTTCCTGTTTTCGG - Intergenic
996835055 5:127782285-127782307 GATATGTCCTTTCCTGGTTTTGG + Intergenic
999226830 5:150032623-150032645 CACATCCCCTGGCCTGTTCTGGG + Intronic
1000116185 5:158155657-158155679 AACCTGGCTTGTCCTGTTCTGGG - Intergenic
1001693479 5:173650805-173650827 GTTATGTCCTTTCCTGTTTTTGG + Intergenic
1002590404 5:180287519-180287541 GCCATCTCCTGTGCTGTGCTAGG - Intronic
1005581867 6:27242837-27242859 GAGATCTCCTGCCCTCTTCTTGG - Intergenic
1005610444 6:27518790-27518812 GACAAGTCATGTCCGGGTCTTGG + Intergenic
1005845217 6:29771782-29771804 GAGTTTTCCTGTCCTGCTCTCGG + Intergenic
1006520560 6:34568728-34568750 GACACGGCCTGCCCTGTGCTCGG + Intergenic
1006741445 6:36311899-36311921 GATACTGCCTGTCCTGTTCTGGG + Intergenic
1008115822 6:47548725-47548747 GTTATGTCCTTTCCTGGTCTTGG - Intronic
1011005847 6:82644800-82644822 GACATGTCAGGCCCTTTTCTCGG - Intergenic
1011156354 6:84337612-84337634 GTTATGTCCTTTCCTGTTTTTGG + Intergenic
1013913650 6:115309230-115309252 GTCATGTCCTTTCCTGGTTTTGG + Intergenic
1016289663 6:142515089-142515111 GGCATGTCCTTTCCTGGTTTTGG + Intergenic
1017904914 6:158751341-158751363 GACATGTCCTGTCCTGTTCTAGG - Intronic
1018009713 6:159658974-159658996 GATATGTCCTTTCCTGGTTTTGG - Intergenic
1018725626 6:166611415-166611437 GACATGACCTATCCTGCTCCTGG + Intronic
1019518386 7:1449675-1449697 GGCATGTCCTGTGCTGTGCCAGG - Intronic
1019875956 7:3811029-3811051 GTCATCTACTGTCCTCTTCTAGG - Intronic
1022108161 7:27211419-27211441 TACATATGCTGCCCTGTTCTTGG - Intergenic
1023701576 7:42896762-42896784 GTTATGTCCTTTCCTGTTTTTGG - Intergenic
1026865738 7:73823002-73823024 GACAAGACCTGTCCTGGCCTGGG + Intronic
1028635817 7:92988165-92988187 GATATGTCCTGTCTTGTTCCTGG + Intergenic
1031139178 7:117922534-117922556 GTCATGTCCTTTCCTGGTTTTGG - Intergenic
1032389007 7:131543770-131543792 CACATGTCCTGTAGTGTCCTGGG - Intronic
1032452705 7:132046999-132047021 TACTTCTGCTGTCCTGTTCTAGG + Intergenic
1033884633 7:145930310-145930332 CACTTGTCCTGTGCTGCTCTGGG - Intergenic
1033978435 7:147131841-147131863 GAGATGCTCTGTCCTATTCTGGG - Intronic
1034346311 7:150387450-150387472 GACCTGTCCTGTCATGTTCCAGG + Intronic
1034409097 7:150929110-150929132 TACCTTTCCTGTCCTGATCTTGG - Intergenic
1035335109 7:158122949-158122971 GTCATGGCGGGTCCTGTTCTTGG - Intronic
1040830155 8:51667029-51667051 GACATGTCCTGCAGTGTGCTAGG - Intronic
1042029131 8:64455433-64455455 CACACGTCCTGTCTTGTTCATGG + Intergenic
1043333194 8:79142368-79142390 CACTTGTCCTCTGCTGTTCTTGG + Intergenic
1045056252 8:98370680-98370702 GACATTACCTCTCTTGTTCTTGG + Intergenic
1049073346 8:140374172-140374194 GACATGGCCTGTCCCTTTCCAGG + Intronic
1049095711 8:140546997-140547019 CACATATCCTGTCCTGGCCTGGG + Intronic
1049221671 8:141431427-141431449 CCCTTGTCCTGACCTGTTCTCGG + Exonic
1050150744 9:2617211-2617233 GAAATGAGCTGTCCTCTTCTGGG - Intergenic
1050395921 9:5195610-5195632 GAGCTGGTCTGTCCTGTTCTGGG + Intergenic
1050399057 9:5231497-5231519 GACCTGAACTCTCCTGTTCTGGG - Exonic
1052568093 9:30184615-30184637 GGAATGTCCTGGCCTGATCTGGG + Intergenic
1052787215 9:32840026-32840048 GAGTTGTCCTGTCCTCTTCCTGG - Intergenic
1053098951 9:35353204-35353226 GACAAGTCCTCTTGTGTTCTGGG + Intronic
1054933430 9:70660956-70660978 GACATGTCCTTTGCTGGTCTTGG - Intronic
1056499994 9:87199273-87199295 GAGATGTACAGTCCTGTTTTGGG - Intergenic
1056883932 9:90421639-90421661 GAAAATTACTGTCCTGTTCTTGG - Intergenic
1057741847 9:97718917-97718939 GACATGTCCTTTCCCAGTCTGGG + Intergenic
1058794600 9:108485785-108485807 GCCATGTCTTGTCTTTTTCTTGG - Intergenic
1058933461 9:109745566-109745588 GTCTTGTCGTGTCCTGTTTTAGG + Intronic
1059857917 9:118421622-118421644 GACATGCCATTTCCTGTACTTGG - Intergenic
1062362529 9:136194423-136194445 GACAGGTCCTTTCCTCCTCTGGG + Intergenic
1188662882 X:32781210-32781232 GACTTGTTCAGTCCTGTTATTGG - Intronic
1190247382 X:48699628-48699650 GACAAGTCCTTGCCTGTTCTAGG - Intronic
1192944761 X:75953888-75953910 GTCATGTCCTTTCCTGGTTTTGG + Intergenic
1193419250 X:81263927-81263949 GGCATGTGCTGTATTGTTCTCGG + Intronic
1193517602 X:82488538-82488560 GATATGTCCTTTCCTGGTTTTGG - Intergenic
1195115148 X:101689977-101689999 GCCATTTCCTGTCCTGTTAGAGG - Intergenic
1195715281 X:107812360-107812382 AACATGCCCTGTCCTGGGCTGGG - Intergenic
1196023486 X:111014710-111014732 GAAATGTCCACTACTGTTCTTGG + Intronic
1197399704 X:125974864-125974886 GACATTTCTGGTCCTGTCCTGGG + Intergenic
1201268122 Y:12228432-12228454 GACTTGTCCTCTTCTGCTCTGGG + Intergenic
1201790442 Y:17834248-17834270 GAATTGTCATGTCATGTTCTAGG - Intergenic
1201811112 Y:18071741-18071763 GAATTGTCATGTCATGTTCTAGG + Intergenic
1202352090 Y:24003992-24004014 GAATTGTCATGTCGTGTTCTAGG - Intergenic
1202518689 Y:25666127-25666149 GAATTGTCATGTCGTGTTCTAGG + Intergenic