ID: 1017905930

View in Genome Browser
Species Human (GRCh38)
Location 6:158757539-158757561
Sequence TTGTGGGTGGGGTGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1612
Summary {0: 1, 1: 1, 2: 20, 3: 182, 4: 1408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017905919_1017905930 13 Left 1017905919 6:158757503-158757525 CCGGCCTGGCGCTGTGACTTTGA 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG 0: 1
1: 1
2: 20
3: 182
4: 1408
1017905920_1017905930 9 Left 1017905920 6:158757507-158757529 CCTGGCGCTGTGACTTTGAAATA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG 0: 1
1: 1
2: 20
3: 182
4: 1408
1017905917_1017905930 30 Left 1017905917 6:158757486-158757508 CCAAGACTGTGTGTTCGCCGGCC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG 0: 1
1: 1
2: 20
3: 182
4: 1408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017905930 Original CRISPR TTGTGGGTGGGGTGGGCGGA GGG Intronic
900195780 1:1374895-1374917 TTGTGGGTTGGGGTGGCGGAGGG - Exonic
900210421 1:1452998-1453020 TGCTGGGCGGGGTGGGGGGACGG - Intronic
900216370 1:1483992-1484014 TGCTGGGCGGGGTGGGGGGACGG + Intronic
900476075 1:2876975-2876997 TCGTGTGTGGGTTGTGCGGATGG + Intergenic
900550045 1:3250120-3250142 CTGGGAGTGGGGTGGGGGGAGGG - Intronic
900737692 1:4309391-4309413 TTGTGGGGTGGGTGGGGGCAGGG + Intergenic
902191187 1:14764376-14764398 TTGTGGGGGGGGTGTGGGGGAGG - Intronic
902252520 1:15163826-15163848 TTGGGGGGGGGGAGGGGGGAGGG + Intronic
902403581 1:16171449-16171471 TGGTGGGTGGGGTGGAGTGAAGG + Intergenic
902513977 1:16980270-16980292 TGGCGGGTGGGGTGGGGGGGGGG - Intronic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
902953852 1:19910820-19910842 TCGGGGGTGGGGTGGGAGGAGGG + Exonic
902972374 1:20063089-20063111 TGGAGGGTGAGGTGGGAGGATGG + Intronic
903139866 1:21332840-21332862 ATGGGGGTGGGGTGGGCGGATGG + Intronic
903181765 1:21608459-21608481 TGGGGAGTGGGGAGGGCGGAGGG + Intronic
903384276 1:22916500-22916522 TAGCGGGTGGGGTGGGTGGGTGG - Intergenic
903466880 1:23558183-23558205 TTGGGGGTGGGGTGGGAGCAGGG + Exonic
903606462 1:24578460-24578482 TTGGGAGTGGGGTGGGAGGGAGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903907626 1:26697268-26697290 TTGAGGGTGGGGGTGGCGGTGGG - Exonic
904191245 1:28745718-28745740 TTTTGGGGGGGGGGGGCGGGGGG - Intronic
904287825 1:29463502-29463524 CTGTGGCTGGAGTGGGAGGAGGG - Intergenic
904394872 1:30213331-30213353 ATGGGGGTGGGGTGGGTGGGTGG - Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904722039 1:32517469-32517491 TTGGGGGGGTGGTGGGGGGACGG - Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
904941227 1:34165902-34165924 TTGTGTGTGGGGTGGGGAGGGGG + Intergenic
905199086 1:36304279-36304301 TGGTGTGTGGGGTGGGGGCAGGG + Exonic
905435570 1:37953034-37953056 TTGTTGGTGGGGGGGACGGATGG - Intergenic
905450482 1:38052903-38052925 GTTTGGGTGGGGTGGGAGGAAGG + Intergenic
905524062 1:38623474-38623496 TGGTGGGTGGGGGGGGGGGTAGG - Intergenic
905581150 1:39083181-39083203 ATGAGGATGGGGTGGGGGGATGG - Intronic
905971618 1:42146076-42146098 GTGTGGGTGGGCTGGGAGGGAGG - Intergenic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906143532 1:43547175-43547197 GGGTGAGTGGGGTGGGTGGAGGG - Intronic
906156908 1:43619229-43619251 GGGTGGGTGGGGTGGGAGGTGGG + Intronic
906210571 1:44010449-44010471 TTGTGGGCGGGGGGGGGGGGGGG + Intronic
906230315 1:44156993-44157015 TTGTGGGTGGAGTCAGTGGAGGG + Intergenic
906243831 1:44259297-44259319 TTGGAGGTGGGGTGGGGGAAGGG + Intronic
906323257 1:44829360-44829382 TTGGAGGTGGGGTGGGGGCAAGG + Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906350161 1:45052125-45052147 TTGGGGGTGGGGTGCGAGGGGGG - Intronic
907328778 1:53658036-53658058 TGGTGGGTGCGGTGGCTGGAGGG - Intronic
907512568 1:54972742-54972764 TTCTGGGTTGGGTGGGTGGAGGG + Intergenic
908029510 1:59984875-59984897 TTGTGTGTGTTGTGGGAGGAGGG + Intergenic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908548996 1:65190448-65190470 TTGGGGGGGGGGCGGGAGGAGGG + Intronic
908947859 1:69522133-69522155 TTGTGGGCTGGGTGTGCTGATGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910174333 1:84412954-84412976 TTGTTGGAGGGGTGGGGGGGGGG - Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910544175 1:88395521-88395543 TGGTGTGTGGGGAAGGCGGAAGG + Intergenic
910875883 1:91877326-91877348 TTGTGTGTGTGGTGGGGGTAGGG + Intronic
911064274 1:93773736-93773758 TGGTGGCTGGGGTGGGGGAATGG - Intronic
911234898 1:95401911-95401933 TTGTTGGTGGGTTGGGAGGGAGG - Intergenic
911295860 1:96114123-96114145 TTTTGTGTGGCGTGGGGGGAGGG + Intergenic
911961578 1:104310477-104310499 TTGTGTGTGGGGCGGGCGGGGGG + Intergenic
912770283 1:112457226-112457248 TCTTGGGTGGGATGGGTGGAGGG - Exonic
912771126 1:112465086-112465108 ATTTGGGTTGGGTGGGCTGAGGG - Intergenic
912896603 1:113598212-113598234 TTGGAGGGGGGGTGGGGGGATGG - Intronic
913275798 1:117136707-117136729 TGGGGGGTGGGGTGGGGGGTAGG + Intergenic
913429627 1:118776557-118776579 TTGGCGGTGGGGTGGGGGGGGGG - Intergenic
913592358 1:120341516-120341538 TTGGGGGTGGGGGGAGGGGAAGG + Intergenic
913609997 1:120501761-120501783 GTGTCAGTGGGGTGGGGGGAGGG - Intergenic
913651001 1:120913629-120913651 TTGGGGGTGGGGGGAGGGGAAGG - Intergenic
913688698 1:121257952-121257974 TTGTGTGTGGGGTGGGGGGGTGG + Intronic
914148902 1:145022324-145022346 TTGTGTGTGGGGTTGGGGGGTGG - Intronic
914170113 1:145215438-145215460 TTGGGGGTGGGGGGAGGGGAAGG + Intergenic
914203811 1:145509378-145509400 GTGTCAGTGGGGTGGGGGGAGGG + Intergenic
914329912 1:146658171-146658193 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
914330914 1:146670417-146670439 TTGTGTGTTGGGCGGGGGGAGGG + Intergenic
914474509 1:148012273-148012295 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
914482934 1:148082532-148082554 GTGTCAGTGGGGTGGGGGGAGGG + Intergenic
914492080 1:148158587-148158609 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
914525230 1:148459401-148459423 TTGGGGGTGGGGGGAGGGGAAGG + Intergenic
914581191 1:149020481-149020503 GTGTCAGTGGGGTGGGGGGAGGG + Intronic
914598446 1:149176429-149176451 TTGGGGGTGGGGGGAGGGGAAGG - Intergenic
914641172 1:149607733-149607755 TTGGGGGTGGGGGGAGGGGAAGG - Intergenic
915026865 1:152839047-152839069 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
915491171 1:156250830-156250852 TCATGGGTGAGGTGGGGGGATGG - Intronic
915500851 1:156316107-156316129 GGGGGGGTGGGGTGGGGGGATGG + Intronic
915852701 1:159343049-159343071 GTGGGGGGGGGGCGGGCGGAGGG + Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915953667 1:160206189-160206211 GTGGGGGTGTGGTGGGCGGCCGG - Intronic
916226396 1:162493952-162493974 TTGGGGATGGGATGGGAGGAGGG + Intergenic
916425329 1:164674848-164674870 TGGTGGGTGGGGGGGGGGGGGGG - Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
917002603 1:170375948-170375970 GTGTGGGGGGGGTGGGGGGATGG + Intergenic
917232422 1:172852535-172852557 CTGTCGGTGGGGTGGGAGGTTGG - Intergenic
917517689 1:175721840-175721862 TGGTCAGTGGGGTGGGGGGAGGG - Intronic
917752485 1:178066354-178066376 TCGTTGGTGGGGTGGAGGGATGG + Intergenic
917854566 1:179090099-179090121 TTGTGGGCGGGGTGGGGGGGGGG + Intronic
917911232 1:179648444-179648466 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
918329029 1:183438503-183438525 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
918531835 1:185531408-185531430 TTGGGGGTGGGGTGAGGGGCTGG + Intergenic
918809157 1:189093250-189093272 TGTGGGGTGGGGTGGGAGGAGGG + Intergenic
919194050 1:194260559-194260581 TTGTGGGGGGGGCGGGAGGGGGG + Intergenic
919373534 1:196763108-196763130 TGTGGGGTGGGGTGGGGGGAGGG + Intergenic
919379974 1:196847785-196847807 TGTGGGGTGGGGTGGGGGGATGG + Intronic
919451256 1:197775331-197775353 TGGTGGGTGGGGTGGGAGGCGGG - Intronic
919605867 1:199683182-199683204 TTGTGGGGGCGGTGGGTGGGTGG + Intergenic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919705428 1:200670434-200670456 TTGGTGTTGGGGTGGGGGGAGGG - Intergenic
919723651 1:200866996-200867018 GTGTGAGTGGGGTGGGGGGCGGG - Intergenic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
920123673 1:203676808-203676830 GTGGGGGTGGGGTGAGGGGAGGG + Intronic
920182959 1:204143793-204143815 TGGTGGGTGGGTTGGTGGGAGGG - Intronic
920200656 1:204257915-204257937 GTGGGGCTGGGGTGGGTGGAGGG - Intronic
920225897 1:204438906-204438928 TTGTGGGTGGGGAGTGCGTCTGG - Intronic
920359163 1:205400840-205400862 TTGTGGGGTGGGGGGGGGGAGGG - Intronic
920476022 1:206276453-206276475 TTGTGTGTGGGGTGGGGGGTGGG + Intronic
920550351 1:206855442-206855464 TCAAGGGTGGGGAGGGCGGATGG + Intergenic
920562340 1:206947749-206947771 TGTTGGGGGGGGTGGGGGGAGGG - Intergenic
920694816 1:208174276-208174298 TTGTGTGTGGGGTTGGGGGCTGG + Intronic
920846224 1:209595237-209595259 TGGTGGGTGGAGTGGGTGGCAGG + Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921158437 1:212455791-212455813 TTTGGGGTGAGGTGGGAGGAAGG + Intergenic
921563497 1:216687273-216687295 TGGTGGGAGGCGTTGGCGGAAGG + Intronic
922216889 1:223527034-223527056 TTGTGCCTGGGGTGGGCAGATGG + Intergenic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923132870 1:231092444-231092466 ATGGGGGTGGGGGGGGCGGTGGG + Intergenic
923721144 1:236468113-236468135 TGGGGGCTGGGGTGGGTGGAGGG - Intronic
923724634 1:236495539-236495561 GTGGAGGTGGGGTGGGTGGAGGG - Intergenic
924178683 1:241419141-241419163 TTGTGGGCGGGGGTGGCGGAGGG + Intergenic
924382881 1:243480407-243480429 GGGTGGGTGGGATGGGTGGATGG + Intronic
924385206 1:243493217-243493239 TGGTGGTGGGGGTGGGGGGAGGG + Intronic
924709982 1:246523615-246523637 CTGTGGGTGGGGTGGAGGGGAGG - Intergenic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1062796536 10:348683-348705 CTGTGGGTGCGGGGGACGGACGG + Exonic
1063039240 10:2319980-2320002 GTGTGTGTGTGGTGGGGGGAGGG - Intergenic
1063369479 10:5511926-5511948 TGGGGGGTGGGGTGGGGGGCAGG - Intergenic
1063431989 10:5999247-5999269 TTCTGGGTAGAGTGGGCAGACGG + Intergenic
1063570866 10:7213461-7213483 TTGTGGGGGTGGTGGTGGGAGGG + Intronic
1063624290 10:7675023-7675045 TTGTGTGTGGGGGGGGGGGCGGG - Intergenic
1063751656 10:8955485-8955507 TTGGGGGTTGGGTGCGGGGAGGG + Intergenic
1063821409 10:9840570-9840592 TTGTGGGTTGGGGGGAGGGAGGG + Intergenic
1063830817 10:9950605-9950627 TGGTGGGTAGGGTTGGGGGAGGG - Intergenic
1063966718 10:11351790-11351812 TTGGGGGTGGGGGGGGCAAAGGG + Intergenic
1064503990 10:16009627-16009649 TTGAGGGTGGGGAGGGTGGGAGG + Intergenic
1064548278 10:16473230-16473252 TTAGAGGTGGGGTGGGCAGAAGG - Intronic
1065382335 10:25102785-25102807 TTCTGGGTGGGGTGGGGGAAGGG + Intergenic
1065747998 10:28859310-28859332 TTTTGGGGGGGGTGGGGGGCGGG + Intronic
1065905798 10:30249967-30249989 TAGGGGGTGGTGTGGGCGGTGGG + Intergenic
1066227127 10:33394187-33394209 TTGTAGGTAGGGTTGGAGGAGGG + Intergenic
1066365906 10:34776832-34776854 TTGTGGGGGGGGGGGGCGGGTGG + Intronic
1066547697 10:36518792-36518814 AGGTGGGTGGGGAGGTCGGAGGG - Intergenic
1066696620 10:38084702-38084724 ATGAGGGTGGGGTGGGAGGAGGG + Intergenic
1067007127 10:42674614-42674636 TTTTGGGGGGGGGGGGCGGTGGG + Intergenic
1067448421 10:46367037-46367059 ATGTGGAGGGGGTGGGGGGAAGG + Intergenic
1067471531 10:46541598-46541620 GGAGGGGTGGGGTGGGCGGAGGG + Intergenic
1067564326 10:47325912-47325934 CTTTGGGTGGGGTGTGGGGAGGG - Exonic
1067588954 10:47493729-47493751 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067636080 10:48001820-48001842 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1068137631 10:52965900-52965922 TTGTGGCTGGCGTGGGAGCATGG + Intergenic
1068723148 10:60269638-60269660 TTGGGGGGGGGGAGGGGGGATGG - Intronic
1068749670 10:60577426-60577448 TTGTGGGAGGGATGGGTGGGAGG + Intronic
1069178640 10:65327265-65327287 TTGGGGGTGGGGGGCGCGGGGGG - Intergenic
1069555696 10:69396505-69396527 TGGTTGCTGGGGTGGGGGGAGGG - Intronic
1070127897 10:73636558-73636580 TGGAGGGTGAGGTGGGAGGATGG - Intronic
1070132639 10:73665827-73665849 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1070134524 10:73680589-73680611 TTTTGGGGGGGGTGGGTGGGTGG + Intronic
1070240346 10:74674028-74674050 TTGTGGGTGGGGTGGGCCATGGG + Intronic
1070692367 10:78536687-78536709 TAGTGCCTGGGGTGGGTGGAAGG - Intergenic
1070712944 10:78696693-78696715 AAGGGGGTGGGGTGGGGGGAGGG + Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070786461 10:79165061-79165083 TTGTGGGTTGGGTAGGGGGGTGG + Intronic
1071129213 10:82371947-82371969 TTGTGGGGGTGTTGGGAGGAGGG - Intronic
1071704918 10:87987679-87987701 AGGTGGGTGGGGTGGGGGAAAGG + Intergenic
1071813703 10:89209605-89209627 TTGTGGGGGGTGGGGGCGCATGG - Intergenic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072190060 10:93071463-93071485 TTGCTGGTGGGGTGGGGTGAGGG - Intergenic
1072643637 10:97233941-97233963 TGGGGGGTGGAGTGGGGGGAAGG + Intronic
1072881841 10:99235906-99235928 TTGGGGGGGTGGTGGGAGGAAGG - Intergenic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1073095743 10:100978706-100978728 TTGGGGGTGGGGTGGTCAGCTGG - Intronic
1073341300 10:102746606-102746628 TTTTGGGGGGGGTGGGGGAAGGG + Intronic
1073345780 10:102781866-102781888 TTTTGGGGGGGGTGGGGGGAGGG + Intronic
1073578285 10:104642371-104642393 GTGGGGGTGGGGTGGGGGTAGGG - Intronic
1073711252 10:106045318-106045340 TAGTGGGTGGGGTGGGGGGTGGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073866682 10:107812674-107812696 ATGTGGGTGTGGTGAGGGGAAGG + Intergenic
1074100799 10:110353721-110353743 TTGGGGGTGAGGTTGGGGGAGGG - Intergenic
1074707506 10:116148120-116148142 ATGTGTGTGGGGTGGGGGGTAGG + Intronic
1074755332 10:116620485-116620507 TTGGGGGTGGGGTAGGTGGAGGG - Intergenic
1074983028 10:118634827-118634849 TTGTTGGTGGGATGGGTGGGGGG - Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075502569 10:122989189-122989211 GGGTGGGCGGGGTGGGCAGAAGG + Intronic
1075618060 10:123905780-123905802 GTGAGGGTGGGGTGGGAGGCAGG - Intronic
1075645623 10:124094106-124094128 CTTTGGGTTGGGGGGGCGGACGG - Intergenic
1075670347 10:124260186-124260208 TTGTGAGTGGGGTGGTGTGAGGG - Intergenic
1075678762 10:124317329-124317351 TTTTGAGTGGGCTGGGAGGAGGG + Intergenic
1075784822 10:125041968-125041990 TTGGGGGTGGGGGTGGGGGAGGG + Intronic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1075974517 10:126683856-126683878 TAGTGGCGGGGGTGGGGGGATGG + Intergenic
1076164023 10:128267899-128267921 TTGGGGGTGGGGTCGGTGGTGGG + Intergenic
1076200936 10:128557376-128557398 GCGGGGGTGGGGTGGGAGGAAGG - Intergenic
1076204336 10:128583835-128583857 TTGTTGGTTGGGTGGTTGGACGG - Intergenic
1076996875 11:301666-301688 GGGTGGGGGGGGTGGGGGGAGGG + Intergenic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1077798647 11:5516729-5516751 TGGTGGGTGGGGTAGGAGGAGGG - Intronic
1077877412 11:6319996-6320018 ATGTGGGTGTGGTAGGTGGATGG + Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078115869 11:8449629-8449651 TTGTGGGGTGGGTGGGGGGAGGG + Intronic
1078417616 11:11178719-11178741 TAGGGGGTGGGGTGGGGGGGGGG + Intergenic
1078469416 11:11575202-11575224 CTGTGGGTGGGGTGTGGGGCTGG + Intronic
1078515832 11:12021668-12021690 TTTTGGGGGGGGGGGGGGGATGG - Intergenic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079460990 11:20677719-20677741 TTGGGGGTGGGGTTGGGGGAAGG + Intronic
1079508292 11:21180064-21180086 TTGGGGGCAGGGTGGGCGGGGGG + Intronic
1079562440 11:21839134-21839156 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
1079888278 11:26016768-26016790 TTTTTTGTGGGGTGGGGGGAGGG - Intergenic
1080234037 11:30048191-30048213 TTGTTGGCGGGGTGGTTGGAGGG - Intergenic
1080252042 11:30244300-30244322 TGGTGGGTGGAGAGGGTGGAGGG + Intergenic
1080504424 11:32898379-32898401 TGGAGGCTGGGGTGGGAGGATGG + Intronic
1080729778 11:34937457-34937479 TTGGTGGCGGGGTGGGTGGAAGG + Intronic
1081071548 11:38616364-38616386 TTGGGGCTGGGGTGGGGGGTGGG + Intergenic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1081649247 11:44812651-44812673 TTGGGGGTGGGGTCAGTGGATGG - Intronic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1081945072 11:46985084-46985106 TTTTGGGTGGGGTTGGGGGTGGG + Intronic
1081991414 11:47339560-47339582 ATGTGGGTGGGGTGTGCAGCAGG + Intronic
1082020396 11:47528097-47528119 TTTTGGGAGGGGTGGGGGGATGG - Intronic
1082076571 11:47980336-47980358 ATGTGGGAGGGCTGGGCGGAGGG + Intergenic
1082825118 11:57571852-57571874 TTGTGGTTGAGGTGGAGGGATGG + Intergenic
1082864712 11:57888056-57888078 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1083325657 11:61871841-61871863 TTGGGGGTGGGGTGGGGTGGGGG - Intergenic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083741714 11:64714734-64714756 TTGGGTGGGGGGTGGGCAGAGGG - Intronic
1083750516 11:64758398-64758420 GTGAGGGTGGAGTGGGCCGATGG - Intronic
1083764831 11:64836711-64836733 GGGGGGGGGGGGTGGGCGGAAGG + Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084303033 11:68263769-68263791 TTGTGGGTGAGCTGGGAGCAAGG + Exonic
1084403084 11:68956138-68956160 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403101 11:68956168-68956190 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084473463 11:69376147-69376169 TAGTGGGTGGGGTGGGGAGTTGG - Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084933740 11:72576089-72576111 TTGTGCTTGGGGTGGGTGGAGGG - Intergenic
1085064145 11:73476455-73476477 GTGGGGGTGGGGTGGGTGGGTGG + Intronic
1085093667 11:73741139-73741161 CTGTTGGGGGGGTGGGGGGAAGG - Intronic
1085201502 11:74704924-74704946 TTGGGGTTGGGGTGGGCAGAGGG + Intronic
1085536986 11:77227732-77227754 TTGGGGGTGGGGTTGGGGGAGGG - Intronic
1085948749 11:81304251-81304273 TGGAGGGTGGGGTGGGGGGATGG - Intergenic
1085950334 11:81322870-81322892 TTGAAAGTGGGGTGGGGGGACGG + Intergenic
1086244252 11:84732784-84732806 TTGTGGGGTGGGTGGGGGGAGGG - Intronic
1086373390 11:86176701-86176723 TGGAGGGTGGGGTGCGTGGAGGG + Intergenic
1086522957 11:87691585-87691607 TTTGGGGTGGGGTGTGGGGAGGG + Intergenic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1087087248 11:94232280-94232302 TTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1087155279 11:94895807-94895829 TTGAGGGTGGGATGCGTGGATGG + Intergenic
1087258392 11:95982389-95982411 TTGTCGATGGGGTGGGCGGGAGG + Intronic
1087367053 11:97233373-97233395 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
1087884392 11:103460476-103460498 CAGTGGGTGGGGTGGGGGGTGGG + Intronic
1087957507 11:104306839-104306861 TTGTGTGTGGGGTGGGGGGTTGG + Intergenic
1088391740 11:109321831-109321853 TTATGGGCGGGGTGGGGGGTTGG + Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088530515 11:110803489-110803511 TGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1088657356 11:112013320-112013342 GTGGGGGTGGGGTGGGGGGGGGG + Intronic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1088884955 11:113999057-113999079 TTGTACGTGGGGTGGGTGGAGGG + Intergenic
1089180435 11:116579814-116579836 TTGTGTGTGGTGTGAGGGGATGG + Intergenic
1089272891 11:117314462-117314484 GTGTGTTTGGGGTGGGCGGAGGG - Intronic
1089418484 11:118313681-118313703 TGGGGGGTGGGGTGGGGAGAGGG - Intronic
1089500746 11:118929917-118929939 ATGGGGGTGGGGTGGGGGAAGGG - Intronic
1089718414 11:120387235-120387257 TTGTGTGTGGTGGGGGGGGAGGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090004149 11:122984989-122985011 TGGTGGGTGGGGTGGGGGTTAGG - Intergenic
1090112176 11:123924695-123924717 TTGTGGGTGGTGTGAGATGAGGG + Intergenic
1090225731 11:125071130-125071152 GTGTGTGTGGGGTGGGGGGGCGG + Intronic
1090257205 11:125293134-125293156 CTGGGGGTGGGGTGGACGAATGG + Intronic
1090425018 11:126601718-126601740 ATGTAGGCGGGGTGGGCGAATGG - Intronic
1090608709 11:128451367-128451389 CGGTGGGTGGGGTGGATGGAAGG + Intergenic
1091231571 11:133991230-133991252 TGGTGGGTGGGGTGGGGTCAGGG - Intergenic
1091284186 11:134398967-134398989 TTCTGGGTGCGGTGGGTGGTGGG + Intronic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091339848 11:134801715-134801737 ATGCGGGTGGGGTGGGGGAAGGG + Intergenic
1091658041 12:2360164-2360186 GTGTGTGTGGGGTGGGGGGGTGG - Intronic
1091908269 12:4206825-4206847 GTGGGTGGGGGGTGGGCGGAGGG + Intergenic
1091994455 12:4982294-4982316 TTGGGGTTTGGGTGGGTGGATGG + Intergenic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092493750 12:8971556-8971578 TTGTGGGCGGGGTGGTGGGGGGG - Intronic
1092499347 12:9030224-9030246 TAGTGGATGGGGTGGGCAGGTGG + Intergenic
1092762001 12:11818903-11818925 ATGTGGGTAGGGTAGGCTGAGGG - Intronic
1092798094 12:12133844-12133866 TTGGGGGGGGGGGGGGGGGAGGG + Intronic
1092846623 12:12590226-12590248 TGGTGGGTTGTGTGGGAGGAAGG + Intergenic
1092920573 12:13228088-13228110 TTGGGGGTGGGGTGGGTGTAGGG - Intergenic
1092999599 12:13982022-13982044 TTGGGGGTGGGGTGGGGTGGGGG - Intergenic
1093185865 12:16019539-16019561 TTGGAGGTGAGGTGGGAGGAGGG - Intronic
1093398648 12:18715167-18715189 GTGGGGGGGGGGGGGGCGGAGGG + Intronic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1094174181 12:27524511-27524533 TTGGGGGTGGTGGGGGTGGAGGG + Intronic
1094218909 12:27972923-27972945 GTGTGTGTGGGCTGGGGGGACGG - Intergenic
1094467789 12:30771959-30771981 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
1094625005 12:32115023-32115045 TGGTGGGGGGTGTGGGCGGCGGG + Intronic
1094795246 12:33964672-33964694 TTGTGGTGGGGGTGGGTGGGAGG - Intergenic
1095244427 12:39902190-39902212 TGTGGGGTGGGGTGGGGGGAGGG + Intronic
1095387315 12:41666447-41666469 TTGTGGGGTGGGTGGGGGGGAGG - Intergenic
1095703276 12:45212825-45212847 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1096549082 12:52360461-52360483 TTGTGGGTGGCCTGGCTGGATGG + Exonic
1096633310 12:52943547-52943569 TTGTGGGTGAGGTGGCCTAAGGG - Intronic
1096777435 12:53972892-53972914 GTTGGGGTGGGGTGGGCGGTGGG - Intergenic
1096787657 12:54026937-54026959 TTTTGGGTGGGTTGGGGGGGGGG - Intronic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1096985338 12:55752373-55752395 TGGTGGGTGGGGGGGGGGCAGGG + Exonic
1097232246 12:57520000-57520022 TTGGGGGTGGGGTAGGGAGAAGG + Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097444376 12:59649943-59649965 TTTTTGGTGGGGAGGGGGGATGG - Intronic
1097921025 12:65073871-65073893 GTGTGTGTGGGGTGGGGTGAGGG + Intronic
1097940302 12:65297217-65297239 TGGAGGGTGGGGTGAGGGGAGGG + Intronic
1097967290 12:65594897-65594919 TGGGGAGTGGGGTGGGGGGAGGG + Intergenic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098205208 12:68101919-68101941 TTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1098596129 12:72274004-72274026 TTGTGGGTGGGGGTGGAGAACGG - Intronic
1098733885 12:74071997-74072019 CCGGGGGTGGGGTGGGGGGAGGG + Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099084005 12:78222267-78222289 TTGTGTGTGTGGTTGGTGGAAGG + Intergenic
1099140986 12:78975101-78975123 TTGGGGGTGGGGTGGGATCAGGG - Intronic
1099494992 12:83335755-83335777 ATGGGGGTGGGGTGGGCTGTAGG + Intergenic
1099561925 12:84189800-84189822 TTGGTGGTGGGGTGGGGGGCAGG - Intergenic
1099927046 12:89031133-89031155 TTGTTGTTGGGGTGGTCTGATGG + Intergenic
1100209686 12:92388251-92388273 TCTTGGGTGGGGTGGGCAGTGGG + Intergenic
1100266231 12:92978891-92978913 GTGGGGGTGGGGTGGGGGCAGGG - Intergenic
1101045536 12:100801746-100801768 TGGGGGGTGGGGTGGAGGGAAGG + Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101075334 12:101123464-101123486 TTGGGGGTGGGGGTGGGGGAAGG - Intronic
1101302825 12:103498869-103498891 TGGGGGGTGGGGTTGGGGGAGGG + Intergenic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1101673624 12:106898485-106898507 TGGGGGGTGGGGTGGGGGAAGGG + Intergenic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102033563 12:109758578-109758600 TTATGGGAGGGGTGTGGGGAGGG - Intronic
1102207832 12:111102489-111102511 TTGAAGGTGGGGTGGGCTCAGGG - Intronic
1102566026 12:113798071-113798093 TTGTGTGTGTGGTGGGGGCAGGG + Intergenic
1102676760 12:114664726-114664748 CTGGGGGCGGGGTGGGCGGGGGG + Intergenic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1103533516 12:121619111-121619133 TTTTTGGCGGGGTGGGTGGAGGG + Intergenic
1103868975 12:124077392-124077414 TTGTGTGTGGGGTAGGTTGACGG + Intronic
1103954451 12:124568418-124568440 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104251071 12:127094744-127094766 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1104360558 12:128129147-128129169 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104399140 12:128461307-128461329 TTGTGGGTGGGGGAGGCCTATGG + Intronic
1104414098 12:128583745-128583767 TTGTGGTTGGGGTGGGGCGGGGG - Intronic
1104620989 12:130312837-130312859 ATGTGGGGGGGGGGGGCGGGGGG - Intergenic
1104854169 12:131894500-131894522 CTGTCGGGGGGGTGGGCGGCTGG - Intergenic
1104964560 12:132503103-132503125 TGGGGGGTGGGGTGGGAGGCGGG - Intronic
1104971930 12:132534679-132534701 TGGTGGCTGGGCTGGGTGGAGGG + Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105969639 13:25416418-25416440 ATGGGGGTGGGGTGGGAGCAGGG - Intronic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106157540 13:27171921-27171943 CGCTGGGCGGGGTGGGCGGAGGG - Intergenic
1106201493 13:27541347-27541369 TTATGGGAGGGGTTGGGGGAAGG - Intergenic
1106207856 13:27616167-27616189 TCGGGGGTGGGGTGGGGGGTTGG + Intronic
1106300580 13:28460651-28460673 GGGGGGGTGGGGTGGGGGGAGGG - Intronic
1106516257 13:30456753-30456775 TTGTGGGCGGGGGGGGGGGGTGG + Exonic
1106813237 13:33380468-33380490 GTGTGGGGGGGGTGGGGGGTGGG - Intergenic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1106841567 13:33690195-33690217 TTGGGGGTGGGATGGGAGAAAGG + Intergenic
1107343304 13:39432713-39432735 TTGGGAGTGGAGTGGGAGGAGGG - Intronic
1107484459 13:40813121-40813143 GTGTGGGTGGGGGGGGGGGGGGG - Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107927765 13:45279908-45279930 TTTTGGGGGGGGCGGGGGGACGG - Intronic
1107994998 13:45851002-45851024 ACGTCGGTGGGGTGGGGGGAGGG - Intronic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108866039 13:54923743-54923765 TTGTTGGGGGGGTGGGGGGCTGG + Intergenic
1108992695 13:56682064-56682086 TTGGGGGGGGGGTGGGGGGGGGG - Intergenic
1109045222 13:57402166-57402188 GTGTGTGTGGGGTGGGGGGGAGG - Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1110032670 13:70636931-70636953 TTTTTGGTGGGGGGGGGGGACGG + Intergenic
1110236094 13:73219633-73219655 TTGTGTGTGAGGTGGGGTGAGGG + Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1110416583 13:75260100-75260122 GGGTGGGTGGGGTGGAGGGAGGG - Intergenic
1110437021 13:75486574-75486596 TTTTTGGTGGGGTGGGGGGTGGG - Intergenic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110671814 13:78189488-78189510 TTGTGTGTGGGGTGGGGTGGGGG + Intergenic
1110806366 13:79758774-79758796 TAGTGGGTGGGGTATGTGGATGG - Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111715236 13:91871350-91871372 TTGAGAGAGGGGTGGGAGGAGGG + Intronic
1111927388 13:94478151-94478173 CTGGGGGTGGGGGGGGCGGGCGG - Intronic
1111950395 13:94704875-94704897 CGGTGGGGGGGGTGGGGGGATGG + Intergenic
1111991269 13:95119941-95119963 TTGAGGCTGGGGTGGGCATAGGG - Intronic
1112036391 13:95500491-95500513 GTGAGGGTGGAGTGGGAGGATGG + Intronic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1112164081 13:96899086-96899108 TTCAGTGTGGGGTGGGGGGAGGG - Intergenic
1112235508 13:97632562-97632584 TTGGGGGTGGGTTGGGGAGAGGG - Intergenic
1112298533 13:98210105-98210127 TAGTTGGTGGGGTGGGTGGCTGG + Intronic
1112306245 13:98276869-98276891 GCATGGGTGGGGTGGGAGGAAGG + Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112430514 13:99346609-99346631 ATGTGGGAGGGGTGGGGTGAAGG - Intronic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113693830 13:112330356-112330378 TGGAGGGTGGGGTGGGGGGATGG - Intergenic
1113865275 13:113517855-113517877 TTGTGGGGAGTGTGGGTGGAGGG + Intronic
1113993274 14:16045555-16045577 GGGTGGGTGGGGTGGGGTGAGGG + Intergenic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114388352 14:22279177-22279199 ATACGGGTGGGGTGGGCAGACGG - Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114549654 14:23525531-23525553 GTGGGGGTGGGGTAGGGGGAGGG + Exonic
1114876932 14:26731857-26731879 TTGTGTGTGGTGTGAGCCGATGG + Intergenic
1115063430 14:29223546-29223568 TGGTGGGTGGGGTAGGCAGAAGG - Intergenic
1115235908 14:31208130-31208152 GTGCGGGTGGCCTGGGCGGAAGG - Intergenic
1115545170 14:34459261-34459283 TTGGGGGTGGGGTGGGGGTGGGG - Intronic
1115671538 14:35617625-35617647 GTGTGTGTGGGGTGGGGGGGGGG + Intronic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1116489564 14:45490057-45490079 TTGGGGCTGGGGTGGGAGGAGGG + Intergenic
1116660883 14:47709128-47709150 GTGTTGGTGGGGTGGGGGGTGGG - Intergenic
1116844600 14:49853482-49853504 ATGGGGGTGGGGTGGGAGGGGGG + Intergenic
1117016617 14:51525003-51525025 TTGTGTGTTGGGTGGGTGGGTGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117179526 14:53177831-53177853 TGGGGGGTGGGGTGGGGGCAGGG + Intergenic
1117275298 14:54187827-54187849 GTGGGGGTGGGGTGGGAGCAGGG - Intergenic
1117650671 14:57901522-57901544 GTGTGGGTGGGGTAGGGGAAGGG + Intronic
1117952039 14:61092410-61092432 TTGGGTGGGGGGTGGGGGGAGGG - Intergenic
1118009092 14:61591508-61591530 TGGGGGATGGGGTGGGGGGAGGG + Intronic
1118034426 14:61851053-61851075 TGGAGGGTGGGGTGGGAGGAGGG - Intergenic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1118479886 14:66153712-66153734 TTGAGGGTGGGGTGGGGTGGGGG + Intergenic
1118749372 14:68795308-68795330 TTTTGGGGGGGGTGGGGGGTGGG - Intronic
1119092979 14:71801602-71801624 TGGTGGGTGGGGGGAGCAGAGGG + Intergenic
1119103089 14:71898295-71898317 TGGTGGTTGGGGTGAGGGGAGGG - Intergenic
1119115982 14:72021922-72021944 TTGAGGGTGGGGGTGGCAGAAGG - Intronic
1119646809 14:76354221-76354243 GTGTGGGTGGGGGGGGGGGCGGG - Intronic
1119743639 14:77029053-77029075 TTGGGGGTGGGGTGGGGAGCAGG - Intergenic
1120099086 14:80423945-80423967 TTGTGGGGGCGGTGAGGGGACGG + Intergenic
1120216276 14:81683539-81683561 GGGTGGGTGGGGTGGGGGTAGGG + Intergenic
1120240387 14:81943140-81943162 TTGTGTGTGTGGTGGGGGAAGGG + Intergenic
1120442249 14:84556557-84556579 TTGTGGTTGGAGTGGGTGGCCGG - Intergenic
1120542881 14:85772376-85772398 TTGTGGGGTGGGGGGGCGGGGGG - Intergenic
1120647050 14:87086736-87086758 TGGTGGTTGGGGTGGGGAGAAGG + Intergenic
1120803762 14:88722609-88722631 TTGGGGGTGGGGTGAGGGGAGGG + Intronic
1120854786 14:89203082-89203104 ATGTGGGGGGGGTGGGGGGAGGG + Intronic
1120881720 14:89418921-89418943 TTGGGGGTGGGGTTGGGGGCTGG - Intronic
1121473680 14:94174967-94174989 CTTTGGGGGGGGGGGGCGGAAGG - Intronic
1121546638 14:94768175-94768197 TGGTGGGTGGGTGGGGCGGGGGG + Intergenic
1121585536 14:95060654-95060676 TTGAGGGTGGGATGGGCTGGGGG - Intergenic
1122176906 14:99927797-99927819 TGGTGGGGGGGGTGGGGGGGTGG + Intronic
1122437905 14:101711967-101711989 TGGTGGGTGGGGTGAGATGACGG - Intergenic
1122741731 14:103875470-103875492 GTGGGGGTGGGGTGGGTGGATGG + Intergenic
1122815642 14:104310795-104310817 TGGTGGGTGGGGTGGTTGAAGGG + Intergenic
1122825749 14:104369660-104369682 CTGGGGGTGGGGTGAGGGGAGGG - Intergenic
1122913589 14:104845515-104845537 CTGTGGGTGGGGTGGGGGAGGGG - Intergenic
1122958329 14:105083137-105083159 ATGATGGAGGGGTGGGCGGAGGG - Intergenic
1122972738 14:105158969-105158991 ACGTGCGTGGGGTGGGCGGCGGG - Intronic
1123073372 14:105652876-105652898 GTGTGGCTGGTGTGGGCGGGAGG + Intergenic
1123121393 14:105918580-105918602 GGGTGGGTGGGGTGTGCGGGGGG + Intronic
1123131935 14:105994259-105994281 TGGTGGTTGGGGTGGGGGGAGGG + Intergenic
1123206572 14:106719386-106719408 TTGGTGGTGGGGTCGGCGGGGGG - Intergenic
1123582168 15:21725389-21725411 TGGTGGTTGGGGTGGGGGGAGGG + Intergenic
1123618818 15:22167985-22168007 TGGTGGTTGGGGTGGGGGGAGGG + Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124376991 15:29134671-29134693 TTGTGGGTGTGATTGTCGGAAGG + Intronic
1124426782 15:29570036-29570058 TGGGGGGTGGGGTGGGGGGGCGG - Intronic
1124653074 15:31487060-31487082 GTATGGCTGGGGTGGGCGGCCGG + Intronic
1124830987 15:33148962-33148984 TTGTGTGTGGGGTCGGGGGTGGG - Intronic
1124959087 15:34381902-34381924 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1124975713 15:34528123-34528145 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1125013356 15:34905093-34905115 TTTTGGGGGGGGTGGGGGGAAGG + Intronic
1125186229 15:36933598-36933620 GTGTGGTGGGGGTGGGCGGGGGG + Intronic
1126209662 15:46086237-46086259 CGGAGGGTGGGGTGGGGGGAAGG + Intergenic
1126881841 15:53107175-53107197 TTGTGGGAGGAGTGAGTGGAGGG + Intergenic
1127254816 15:57280715-57280737 TTGGGGGTGGGGTGGGGACATGG + Intronic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1127338846 15:58019974-58019996 TGTTGGAGGGGGTGGGCGGAGGG - Intronic
1127371748 15:58347935-58347957 TGTGGGGTGGGGTGGGGGGAGGG + Intronic
1127586596 15:60383634-60383656 TTGTGGTTGTGGTTGGCTGATGG + Intronic
1127707590 15:61562453-61562475 TTGAGGGTTGGGTGGGAGGGAGG + Intergenic
1127751354 15:62048246-62048268 TGTTGGGGGGGGTGGGGGGAGGG - Intronic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1127951743 15:63814439-63814461 TTGTGGGTGGGGGAGGGGGTTGG + Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128222999 15:65982069-65982091 TTGTGGGTGGGCTGGGTGGTGGG - Intronic
1128350205 15:66883434-66883456 TTGTGGGGGAGATGGGAGGAGGG - Intergenic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128729291 15:70009826-70009848 ATGTGGGTGGGGTGGCCCCAAGG - Intergenic
1129153882 15:73705520-73705542 TTGGGGAAGGGGTGGGCAGAAGG - Intronic
1129333502 15:74839523-74839545 CTGGGGCTGGGGTGGGCTGAGGG - Intronic
1129583621 15:76838840-76838862 TTGTGGGTGTGGCTGCCGGAAGG - Intronic
1129693964 15:77730073-77730095 TTGTGGGGGGAGTAGGGGGAAGG + Intronic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1130694654 15:86118757-86118779 TTTTGGGTGGGGTGGGGTGGTGG + Intergenic
1130973327 15:88752844-88752866 TTTTGGGGGGTGGGGGCGGAGGG - Intergenic
1131074108 15:89484072-89484094 TTGTTGATGGGGTGGGTGGGGGG + Intronic
1131353953 15:91726961-91726983 TTGTGGGTGGGTGGTGGGGAGGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1131723445 15:95196734-95196756 TTGGAGGTGGGGTGGGGGTAGGG - Intergenic
1132175941 15:99714801-99714823 TTGGGGGGGGGGTGGGGGGGGGG - Exonic
1132360072 15:101204898-101204920 TTGTGTGTGTGGCGGGGGGATGG - Intronic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132501424 16:286214-286236 TTCTGTGTGGGGGGGGCGGTGGG - Intronic
1132514811 16:361317-361339 TCGAGGGTGGGGTGGGCCGAGGG + Intergenic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132912564 16:2322524-2322546 TTGTGGGGTGGGGGGGCGGGGGG - Intronic
1133259380 16:4538445-4538467 TGGGCGGTGGGGTGGGCGGTGGG - Intronic
1133405532 16:5521351-5521373 TTGGGGGTGGGGTGGGGTGGGGG + Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1133894450 16:9912504-9912526 AAGTGGGTGGGGTGGGGGGAGGG + Intronic
1134023626 16:10938698-10938720 TTGAGGGTGGGGAGGAGGGAAGG + Intronic
1134104755 16:11477544-11477566 TTCTGGGTGGGGTGGATGGAAGG + Intronic
1134224803 16:12381653-12381675 TGATGGGTGGGGTGGGTGGGTGG - Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134299031 16:12973118-12973140 TTTTGTGTGGGGGGAGCGGAGGG - Intronic
1134439305 16:14288249-14288271 TTTTTGGGGGGGTGGGCGGTGGG + Intergenic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134608986 16:15592892-15592914 TTGGGGGGGGGGGGGGCGGGGGG - Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134773533 16:16831938-16831960 GGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1134812944 16:17182689-17182711 TGGGGGGTGGGGTGGGGGGAGGG + Intronic
1134925280 16:18153726-18153748 CTGTTGGTGGGGTGGGGGGCTGG + Intergenic
1134932857 16:18221896-18221918 TTGGGAGTGGGGTGGGCTGGTGG - Intergenic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1135047953 16:19169316-19169338 TTTTGGGGGGAGGGGGCGGAGGG + Intronic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1135332783 16:21574616-21574638 GTGTTGGTGGGGTGGGGGAAGGG - Intergenic
1135620340 16:23950184-23950206 ATGTGGGTGGGGTGGAGGGTGGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136074574 16:27808087-27808109 TTGTCTCTGGGGTGGGCGGAGGG - Intronic
1136254416 16:29028778-29028800 CTCTGGCTGGGCTGGGCGGAAGG + Intergenic
1136293788 16:29290631-29290653 TTGTGGCTGGGCTGGGAGGCCGG - Intergenic
1136401952 16:30024100-30024122 TGGTGGGTGGGGTTGGAGAAAGG - Intronic
1136405680 16:30045293-30045315 GTGTGTGTGGGGTGGGTGTATGG + Intronic
1136940457 16:34520202-34520224 TGGTGGGGTGGGTGGGGGGAGGG + Intergenic
1136959362 16:34828368-34828390 TGGTGGGGTGGGTGGGGGGAGGG - Intergenic
1137485482 16:48887168-48887190 TTGGGGGTGGGGGTGGCGGTGGG - Intergenic
1137531125 16:49279719-49279741 TGGGGGGTGGGGGGGGCGAATGG + Intronic
1137601592 16:49760026-49760048 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601617 16:49760139-49760161 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601637 16:49760228-49760250 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137658761 16:50184734-50184756 TTGTTTGTGGGGGGAGCGGAGGG + Intronic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1137777075 16:51065021-51065043 TGGTGAGTGGGGTGAGGGGACGG - Intergenic
1138334010 16:56238105-56238127 ATGTGTGTGGGGCGGGCGGGGGG - Intronic
1138488917 16:57364783-57364805 TTGGGGGGGGGGTGGGGAGAGGG - Exonic
1138736758 16:59259873-59259895 TTGTGGGTGGGGTGGGATGGGGG + Intergenic
1138751644 16:59429948-59429970 TGCTGGGTGGGGTGGGAGGTGGG + Intergenic
1138940903 16:61787938-61787960 TGGTGGGGGGGGCGGGGGGAGGG + Intronic
1139044694 16:63042345-63042367 TAGTGGGTGGGGTTGGGGGAAGG - Intergenic
1139445749 16:66997404-66997426 TGGTGGTTGGGGTGGGCAGCGGG + Intronic
1139534476 16:67562900-67562922 GTGGGGGTGGGGGGGGCGGCCGG - Intronic
1140003643 16:71052743-71052765 TGGTGGCTGAGGTGGGAGGATGG + Intronic
1140256885 16:73345384-73345406 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1140450980 16:75070650-75070672 TGGTGGGCGGGGTTGGGGGAGGG - Intronic
1140666591 16:77233793-77233815 ATGTGGGTGGGGGGGGCTGGGGG - Intergenic
1140784416 16:78326571-78326593 TTGCGGGGGGGGGGGGCGGGGGG - Intronic
1140866597 16:79067618-79067640 GTGTGGGTGGGGTGGGGGGCGGG + Intronic
1141102192 16:81206040-81206062 TTGGGGGGGGGGGGGGCGGGTGG - Intergenic
1141174511 16:81710077-81710099 TTGGGGGTGGGCTGGGGGGTGGG + Exonic
1141188395 16:81805623-81805645 TTGTGAGTGGGGTGGGGGAAGGG - Intronic
1141492068 16:84380495-84380517 TTGGGGTTGGGGGAGGCGGAGGG + Intronic
1141516406 16:84548072-84548094 ATGTGTGTGGGTTGGGCGGGTGG - Intronic
1141581499 16:85002715-85002737 GCGTGGGTGGAGTGGGGGGATGG + Intronic
1141651131 16:85393807-85393829 TGGTGGCTGGGCTGGGCTGAGGG + Intergenic
1141754512 16:85982461-85982483 TTGTGGTTGGGGGGAGCGGCTGG + Intergenic
1141809256 16:86363837-86363859 TGGTGGGTGGGGTGGGGTGGGGG - Intergenic
1141834591 16:86530381-86530403 CTGAGGGTGGGGTGGGCGTCAGG + Exonic
1141882337 16:86868269-86868291 GTGAGGGTGAGGTGGGCGGAGGG + Intergenic
1141926465 16:87173571-87173593 TGGAGGGTGGGCTGGGAGGATGG - Intronic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142244756 16:88964968-88964990 TGGTGGGTGGGGTAGGTGGATGG - Intronic
1142255564 16:89012184-89012206 TGATGGGTGGGGTGGATGGATGG - Intergenic
1142290528 16:89192014-89192036 TGGTGGGGGGGGTGGCGGGAGGG - Intronic
1142518367 17:448020-448042 TTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1143106190 17:4531675-4531697 TTCTTAGTGGGGTGGGGGGATGG + Intronic
1143188507 17:5024425-5024447 CTATGGGTGGGGTGGGGGGCTGG + Exonic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143495120 17:7308145-7308167 TGATGGGGGGGGTTGGCGGACGG + Intronic
1143544939 17:7590249-7590271 TCTTGGGTGGGGGGGGCGGGGGG - Intronic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144382869 17:14720043-14720065 GTGCTGGTGAGGTGGGCGGAGGG + Intergenic
1144432466 17:15206769-15206791 CAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1144578894 17:16446927-16446949 TTGTGGGTGGGGGTGGGGGGCGG + Intronic
1144680754 17:17192424-17192446 TTTTGGGGGGGGGGGGGGGAGGG + Exonic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG + Intronic
1145127544 17:20314682-20314704 TTTTGGGGGGGGAGGGGGGAAGG - Exonic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145759557 17:27418499-27418521 TTGTGGGTGAGGTGGAGGGGAGG + Intergenic
1145799485 17:27673838-27673860 CTGTGGGTGGGGTGGAGGGGAGG - Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145896496 17:28461167-28461189 TTGAGGGTGGGGTGGGGGCATGG - Intronic
1146078735 17:29757782-29757804 TGGGGGGTGGGGTGGGGGGCCGG + Intronic
1146093673 17:29907349-29907371 TTGGGGGTGGAGTGGGGGGAGGG + Intronic
1146159533 17:30552477-30552499 CTGTGGGTGGGGTGGAGGGGAGG + Intergenic
1146440890 17:32893725-32893747 TTGGGGGTGGGGTGGGGGCATGG + Intergenic
1146478242 17:33180496-33180518 TTGCTGGTGAGGTGGGTGGAGGG + Intronic
1146541655 17:33701224-33701246 TGTTGTGTGTGGTGGGCGGAGGG + Intronic
1146654545 17:34627120-34627142 TTGTGGGTGGGTTGGGGGGTGGG + Intronic
1146674003 17:34760549-34760571 TGTTGGGTGGGGGGGGCGGTAGG - Intergenic
1147167683 17:38602138-38602160 TTCTGGGGGAGGTGGGCAGAGGG - Intronic
1147259060 17:39197906-39197928 TTGGGGGAGGGGTGGGGGGGCGG + Intergenic
1147382819 17:40065664-40065686 TTGAGGTTGGGGTGGGGGGCGGG + Intronic
1147454941 17:40531292-40531314 TTGGGGGTGGGGTGGGTGGCAGG - Intergenic
1147811952 17:43177551-43177573 TTTTGGGTGGGGTGTGGGGTAGG - Intronic
1147844343 17:43394373-43394395 TAGGGGGTGGGGTGGGGGAATGG - Intergenic
1147985812 17:44307593-44307615 TTCGGGGCGGGGTGGGGGGAGGG - Intergenic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148329452 17:46804913-46804935 TTGGGGGTGGGGGGGGTGGGCGG - Intronic
1148357339 17:46984315-46984337 TTGGGGGTGGGGTTGGGGGTGGG + Intronic
1148440849 17:47710963-47710985 TTGGGCCTGGGGTGGGGGGAAGG + Exonic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1148829603 17:50422756-50422778 TTGGGGGTGTGGTGGGGGAATGG - Intergenic
1148985878 17:51620629-51620651 GGGAGGGTGGGGTGGGAGGATGG + Intergenic
1149109865 17:53015574-53015596 AAGGGGGTGGGGTGGGGGGAAGG + Intergenic
1149521075 17:57318641-57318663 TTGTGGGGGGTGGGGGCGGAGGG + Intronic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149996783 17:61409843-61409865 GGGTGGGTGGGCTGGGAGGATGG + Intergenic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1150273704 17:63882525-63882547 GTGTGGGAGGGGTGGGGGGGGGG + Intergenic
1150909344 17:69371706-69371728 TGTGGGGTGGGGTGGGGGGAGGG + Intergenic
1150997199 17:70332326-70332348 TTGTTGGTGGGGTGGGCGGTGGG + Intergenic
1151013839 17:70531264-70531286 TGGAGGGTGGGGGGGGTGGAAGG + Intergenic
1151167044 17:72213075-72213097 TAGTGGGTGGGGTGGGGAGTAGG - Intergenic
1151186849 17:72371126-72371148 TTGTGGGTGGGAGGAGCGGATGG - Intergenic
1151356426 17:73561254-73561276 GGGTGGGTGGTGTGGGTGGAAGG - Intronic
1152077611 17:78168919-78168941 CTGGGGGTGGGGTGGGTGGCGGG - Intronic
1152118060 17:78400886-78400908 CTGTGGGTGGGGTGGAGTGAGGG + Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152141582 17:78540338-78540360 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152141692 17:78540749-78540771 GGGTGGGTGGGGTGAGTGGATGG + Intronic
1152141702 17:78540770-78540792 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152189946 17:78882324-78882346 TTGTGGGTGGCTGGGGCAGAGGG - Intronic
1152241293 17:79162736-79162758 TTGTGGGTGGTGTGGGCGGGCGG + Intronic
1152252126 17:79217762-79217784 ATGGGGGTGGGGTGGGAGGCAGG + Intronic
1152263652 17:79280838-79280860 TTGTGGGGGGGGGGAGGGGAGGG + Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1152596933 17:81242375-81242397 CTGTGGGTGGGATGGGAGGCTGG - Intergenic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152701928 17:81823651-81823673 GTGAGGCTGGGGTGGGCAGAGGG - Intronic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153498520 18:5723863-5723885 TTTTGGGCGGGGTGGGGGGGGGG + Intergenic
1153530667 18:6042461-6042483 TTGAGGGTGGGGTAGGTGGGAGG - Intronic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154070718 18:11149311-11149333 TTGTGGGTCCGGTGCGCGGGCGG + Intergenic
1154236246 18:12608967-12608989 ATGGGGGTGGGGTGTGGGGATGG + Intronic
1154268077 18:12896506-12896528 TTCTGGGCGGGGTGGGGGGGGGG + Intronic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1155057121 18:22194703-22194725 TGTTGGGAGGGGGGGGCGGAGGG - Intronic
1155069376 18:22300488-22300510 GATTGGGTGGGGTGGGGGGAGGG - Intergenic
1155079158 18:22390378-22390400 TAGGGGGTGGGGTGGAGGGAGGG + Intergenic
1155169847 18:23259319-23259341 TGGGGAGTGGGGTGGGGGGAGGG + Exonic
1155385841 18:25276223-25276245 TTCTGTCTGGGGTGGGTGGAGGG - Intronic
1155426545 18:25713264-25713286 TTTGGGGTTGGGTGGGGGGAGGG + Intergenic
1156268227 18:35507745-35507767 TTGGGGGCGGGGTGGGTTGAAGG - Intergenic
1156383100 18:36581755-36581777 TTGGGGGTGGGGTGGCTGGCGGG - Intronic
1156840843 18:41607969-41607991 GTGGGGGTGGGGTGGGGGTATGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157751995 18:50187512-50187534 TTTTTGGGGGGGTGGGCGGTGGG + Intronic
1158180228 18:54707225-54707247 TTGTGGGGTGGGTGAGGGGAGGG - Intergenic
1158215567 18:55097367-55097389 TTGGGGGTGGGGTAGGCAGGGGG - Intergenic
1159018666 18:63124597-63124619 TTGTTGGAGGGGTGGGAGGGAGG - Exonic
1159456397 18:68664416-68664438 GTGTCGGTGCGGTGGGGGGATGG + Intergenic
1159582170 18:70245677-70245699 TTGAGTGTGGGGTGGGAGGCGGG - Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1159672660 18:71241222-71241244 TTTTGGGTGGTGTGGGTGGGAGG - Intergenic
1160531180 18:79565651-79565673 TTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1160714610 19:570631-570653 GGGTGGGTGGGAGGGGCGGAGGG + Intergenic
1160714640 19:570684-570706 GGGTGGGTGGGGGGGGCGGAGGG + Intergenic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1161131281 19:2590521-2590543 TGGTTGGTTGGGTGGGTGGATGG - Intronic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161202313 19:3022347-3022369 TTGTAGATGGGGTGGGGGGGTGG - Intronic
1161289957 19:3488354-3488376 CTGTTGGTGGGGTGTGCGGAAGG + Intergenic
1161422808 19:4184997-4185019 TTGGTGGTTGGGTGGGTGGATGG + Intronic
1161593359 19:5138824-5138846 TGGGTGCTGGGGTGGGCGGAGGG - Intronic
1161641076 19:5423751-5423773 GTGTGGGTGGAGTGGGTGGAGGG - Intergenic
1161799060 19:6405423-6405445 TTGTGGGGGAGCTGGGCGGAGGG - Intergenic
1161853301 19:6750119-6750141 TGCTGGGTGGGGTGGGGGGTCGG + Intronic
1161981208 19:7631383-7631405 TGGTGGGAGAGGTGGGCGGGGGG + Intronic
1161981694 19:7633375-7633397 CTGGGGGTGGGGTGGGGGCAGGG + Intronic
1162030556 19:7915466-7915488 AAGTGGGTGTGGTGTGCGGATGG + Intergenic
1162345921 19:10117945-10117967 AGGAGGGTGGGGTGGGAGGATGG + Intronic
1162584718 19:11551831-11551853 GTGAGGCTGGGGTGGGCGGGCGG + Intronic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162872533 19:13597512-13597534 GGGTGGGTGGGTTGGGTGGATGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162966042 19:14156563-14156585 GTGTGGGGGGGGTGGGGGGCGGG + Intronic
1163075517 19:14887479-14887501 TGGGGGGTGGGGTGGGGGGGAGG - Intergenic
1163266687 19:16226326-16226348 TTGAGAGTGGGGTGGCCAGAGGG + Intronic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1163278530 19:16300832-16300854 TTTTTGGTGGGGTGGGCAGAGGG + Intergenic
1163381972 19:16975171-16975193 TTTTTGGTGGGCTGGGCTGACGG - Exonic
1163567281 19:18059137-18059159 GTGAGGGTGGGGTGGGGGGTGGG + Exonic
1163601612 19:18252390-18252412 CTGTGGGTGCTGTGGGCGAAGGG + Intronic
1163611929 19:18306134-18306156 TTGTGTGTGGGGTGGGGGACAGG - Intergenic
1163655458 19:18542983-18543005 TGGTGGTTGGGGTGGGGGGTGGG - Intronic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164644207 19:29845855-29845877 TTGTGGGTCGGGTGGGGTGGAGG - Intergenic
1164827313 19:31293133-31293155 TTGATGGGTGGGTGGGCGGATGG - Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165613211 19:37175097-37175119 TTGGGGGTGGGGTGGCGGGAGGG + Intronic
1165915029 19:39253238-39253260 GTGAGGCTGGGGTGGGAGGATGG - Intergenic
1166197306 19:41215600-41215622 TTTTGGGGGGGGAGGGGGGATGG + Intergenic
1166729400 19:45050195-45050217 TTGGGAGTGGGGTGGGGGGTGGG + Intronic
1167087639 19:47321048-47321070 GTGTGGGGGGGGTGGGGGGTGGG - Exonic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167162840 19:47778940-47778962 ATGTGGGTGGGGTGGGCGTACGG + Intronic
1167320863 19:48796538-48796560 TTGTGGGTGGGAGGGAAGGAGGG - Intronic
1167463601 19:49638913-49638935 TTGGGGGTGGGGTGGGAGAGTGG + Intronic
1167799989 19:51734225-51734247 TGGTGAGTGGGGTGGAGGGAGGG + Intergenic
1167838174 19:52092140-52092162 TTGGGGGTGGGGTGGGGGAGGGG + Intronic
1168400544 19:56083777-56083799 TGGGGGGTGGGGTGGGGGGGGGG + Intergenic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
1168691308 19:58379234-58379256 TTGTGGGAGGTGGGGGCTGAGGG + Intronic
925042751 2:746269-746291 TTGGTGGTGGGGCGGGGGGAGGG - Intergenic
925068734 2:950513-950535 TCGTGGCGGCGGTGGGCGGAGGG - Intergenic
925228209 2:2205110-2205132 TGTGGGGTGGGGTGGGGGGAGGG + Intronic
925234539 2:2266485-2266507 ATGGGGGTGGGGTGGGGTGAGGG + Intronic
925348747 2:3187540-3187562 TGGTGGGTGGGGAGTGGGGAGGG - Intergenic
925440027 2:3877774-3877796 GTTTGGTTGGGGTGGGGGGAGGG - Intergenic
925740202 2:6998889-6998911 TTGTGGGGGGTGGGGGCGGGGGG + Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925860717 2:8172858-8172880 TTCTGGGTGGGGCCGGCGCACGG - Intergenic
925863537 2:8203203-8203225 TTTTTGGTGGGATGTGCGGAGGG + Intergenic
926323078 2:11762427-11762449 TTGGGGGTGGGGTGGTGGGTGGG + Intronic
926737052 2:16081846-16081868 GGGTGGGTGGGGTGGGTGGGTGG - Intergenic
927143513 2:20145507-20145529 TGGTGTGGGGGGTGGGAGGACGG + Intergenic
927265938 2:21151235-21151257 TGGGGGGTGGGGTGGGGGAAGGG - Intergenic
927424937 2:22971098-22971120 CTGTGGGGGGGGTGGGGGGGGGG + Intergenic
927888004 2:26730360-26730382 TTGCAGGTGTGGTGGGCAGAGGG - Exonic
928164991 2:28964631-28964653 TGGGGGGTTGGGTGGGGGGAGGG - Intronic
928285163 2:29983993-29984015 TGGTGTGGGGGGTGGGGGGAGGG - Intergenic
928410696 2:31051916-31051938 ATGAGAGTTGGGTGGGCGGAGGG - Intronic
928515185 2:32038406-32038428 TTGAGGGGGGGGGGGGCGGGGGG + Intronic
928618773 2:33068157-33068179 TTTTTTGTGGGGTGGGGGGAGGG + Intronic
928715073 2:34050887-34050909 TTGGGGGGGAGGTGGGGGGACGG + Intergenic
928860982 2:35856756-35856778 TCGGGGGTGGGGTTGGGGGAGGG - Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929609161 2:43257095-43257117 TGGTGGGTGGAGAGGGGGGATGG + Intronic
929736422 2:44554976-44554998 TTCTGGTTGGGGTGGGAGTAGGG + Intronic
929745262 2:44650429-44650451 TTGTGGGTTAGGTGGAGGGAAGG + Intronic
930043304 2:47146336-47146358 TTGTGGTTGGGTGGGGCGGGGGG - Intronic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930367527 2:50459455-50459477 TTGAGGGTGGAGTGGGAAGAGGG - Intronic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931726535 2:65117053-65117075 TGGTGGGTGGGGGTGGGGGAAGG - Intronic
931797034 2:65721219-65721241 TTGGGGGTGGGGTGGGGGCGTGG + Intergenic
931893923 2:66707450-66707472 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
931893927 2:66707454-66707476 TTGTGTGTGGGGGGGGGGGGCGG - Intergenic
932030768 2:68182077-68182099 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
932101332 2:68902041-68902063 TTTTGGGGGGGGTGGGCAGGTGG - Intergenic
932289322 2:70562245-70562267 TGGTAGGTGGGGTGGGGGGCTGG - Intergenic
932369317 2:71174470-71174492 CTGGGAGTGGGGTGGGTGGATGG - Intergenic
932405619 2:71511120-71511142 GTTGGGGTGGGGTGGGCGCATGG + Intronic
932433086 2:71686952-71686974 TTGGGGGTGGGGTGGGCTTGGGG + Intergenic
932476443 2:72009307-72009329 TAGTGGCTGGGGTGGGAGGAGGG - Intergenic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
933070533 2:77852336-77852358 ATGTGGGTGGGGGGTGCGGGGGG + Intergenic
933132665 2:78691875-78691897 GTGTGTGTGGGGTGGGGGGGAGG - Intergenic
933655226 2:84881192-84881214 GCGGGGGTGGGGTGGGGGGAGGG - Exonic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933911348 2:86943274-86943296 TTCTGGGCGGGGTGGGGGGGGGG - Intronic
933914214 2:86972061-86972083 TTGTGTGTGGGTTGGGCTGGGGG + Intronic
934008779 2:87797838-87797860 TTGTGTGTGGGTTGGGCTGGGGG - Intronic
934712746 2:96526625-96526647 GAGTGGGTGGGGTGGGCCCAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
935339642 2:102048339-102048361 TTGGTGGCGGGGTGGGGGGAAGG + Intergenic
935591644 2:104850988-104851010 GTGAAGGTGGGGTGGGAGGAGGG - Intergenic
935772425 2:106438841-106438863 TTGTGTGTGGGTTGGGCTGGGGG - Intronic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
935907647 2:107857074-107857096 TTGTGTGTGGGTTGGGCTGGGGG + Intronic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
935994046 2:108749234-108749256 TTGTGTGTGGGTTGGGCTGGGGG + Intronic
936086591 2:109473715-109473737 GAGTGGGTGGGGTGGGTGGGTGG - Intronic
936129439 2:109822219-109822241 TTGTGTGTGGGTTGGGCTGGGGG + Intronic
936215258 2:110549266-110549288 TTGTGTGTGGGTTGGGCTGGGGG - Intronic
936424395 2:112403839-112403861 TTGTGTGTGGGTTGGGCTGGGGG - Intronic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937196625 2:120163252-120163274 TTGGGGGGGGGGGGGGCAGAGGG - Intronic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937665922 2:124486296-124486318 TTGTGGGGAGGGTGGCTGGAGGG + Intronic
938036064 2:128035946-128035968 TTTTGGGGGGGGTGGTTGGAGGG - Intergenic
938087105 2:128408833-128408855 CTGTGGTTAGGGTGGGCGGCGGG + Intergenic
938188609 2:129255009-129255031 TGGAGGGTTGAGTGGGCGGATGG - Intergenic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938665181 2:133527481-133527503 TTGGGGGGTGGGTGGGTGGAGGG - Intronic
938736530 2:134191448-134191470 TGGTGGGGGGGGTAGGGGGAGGG - Intronic
939693237 2:145292155-145292177 ATGGGGGTGGGGGCGGCGGAGGG - Intergenic
939939320 2:148330037-148330059 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
940214934 2:151295200-151295222 GTGTGGGGGGGGGGGGCGGCGGG - Intergenic
940279233 2:151972420-151972442 TTGCAGGTGGGGTGGGGGAATGG - Intronic
941162297 2:162049474-162049496 TTGGGGGTGGGGTTGGGGGTGGG + Intronic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
941583699 2:167331360-167331382 CAGTGGGCTGGGTGGGCGGATGG + Intergenic
942042642 2:172081162-172081184 GTGTGGGGTGGGTGGGGGGAGGG - Exonic
942432845 2:175933122-175933144 TTGAGGTTGGGGTGGGGTGATGG - Intronic
942460817 2:176167254-176167276 TTGTGGTTTGGGTGGGAGGTAGG + Intronic
942543038 2:177034670-177034692 TTGTGGGATGGGGGGGGGGAGGG - Intergenic
942922152 2:181388179-181388201 ATTAGGGTGGGGTGGGTGGATGG - Intergenic
943013903 2:182487646-182487668 CTGTGGTTGGGGTGTGGGGATGG + Intronic
943331863 2:186569484-186569506 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943745435 2:191457014-191457036 TGGTGGGTGGGGGTGGGGGAGGG - Intergenic
944026941 2:195181880-195181902 GTGGGGGTGGGGTGGGGGGAGGG - Intergenic
944586252 2:201176275-201176297 TTGCGGGGGGGGGGGGCGGGCGG + Exonic
944666975 2:201966988-201967010 TTGGGGGTGGGGAGGGAGGTTGG - Intergenic
945158107 2:206860365-206860387 TTATTGGGGGGGTGGGGGGAGGG - Intergenic
945166345 2:206950923-206950945 TTGTGGGTGGGGTGGGGGCCTGG + Intronic
945266311 2:207894558-207894580 TGGTGGTTGGGGTGGGGGGGTGG + Intronic
945606132 2:211934556-211934578 TTGTGGATGAGGTGGAAGGAAGG - Intronic
945691413 2:213041336-213041358 TTTTGGGGGGGGTGGGAGGATGG + Intronic
945912813 2:215669022-215669044 GTGTGGGGGGTGGGGGCGGAGGG - Intergenic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946502758 2:220267213-220267235 TGGTGGGTGGGTTGGGAGGGTGG + Intergenic
947262482 2:228239021-228239043 ATTTGTGTGGGGTGGGGGGAGGG + Intergenic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947411718 2:229848320-229848342 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
947486566 2:230555305-230555327 TTGGGGGTGGGGTGAGGGGAAGG + Intergenic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
947531892 2:230914642-230914664 TTGTGGGTGGGGGAGGGGAACGG + Intronic
947605134 2:231481159-231481181 TTATGGGTGGGGGGAGGGGACGG + Intronic
947740616 2:232483230-232483252 TGGTGGGTAGGGTGGGGGGCGGG - Intronic
947744858 2:232502253-232502275 ATGGGGGAGGGGTGGGAGGAGGG + Intergenic
947753212 2:232543474-232543496 TTGAGGATGGGGGGGGTGGATGG - Intronic
948004922 2:234600196-234600218 CTGTGTGTGTGGTGGGCGTAGGG - Intergenic
948397766 2:237660299-237660321 TGGGGCGTGGGGTGGGCAGATGG - Intronic
948563816 2:238871047-238871069 TTGTGTGTGGGGTGTGTGGTGGG - Intronic
948563935 2:238871624-238871646 TTGTGTGTGGGGTGTGTGGTGGG - Intronic
948695678 2:239732070-239732092 TTGGGGGTGGAGTGGGAGGGTGG - Intergenic
949058291 2:241941823-241941845 TTAGGGGTGGGGTGGTGGGATGG + Intergenic
1168818505 20:757269-757291 TTGGGAGTGGGGCGGGGGGAGGG + Intergenic
1169157019 20:3340434-3340456 GTGGGGGTGGGGTGGGTGGGGGG - Intronic
1169300231 20:4435876-4435898 TAGGGAGAGGGGTGGGCGGATGG + Intergenic
1169356696 20:4912827-4912849 TTGTGGGAGGGGATGGCGGTGGG + Intronic
1169404675 20:5313882-5313904 TGGTGGGTGGGGTGAGTGGTGGG - Intronic
1169814220 20:9640204-9640226 TGTGGGGTGGGGTGGGGGGAGGG - Intronic
1169928924 20:10811250-10811272 TTGGGGGAGAGGTGGGGGGAAGG - Intergenic
1170036608 20:11996358-11996380 TTGTTGGGGTGGTGGGTGGAGGG - Intergenic
1170304555 20:14923788-14923810 TTGGGGGAGGGGGGGGCGGCGGG + Intronic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170769120 20:19316985-19317007 TTGTCAGAGGGGTGGGAGGAGGG - Intronic
1170888987 20:20363789-20363811 GTGTGAGTGGGGTGGGAGGAAGG + Intergenic
1170989324 20:21287534-21287556 TTGGTGGTGGTGTGGGCGGGGGG + Intergenic
1171035693 20:21710689-21710711 GTGGGGGTGGGGTGGGGGGCAGG + Intronic
1171143943 20:22765685-22765707 ATGTGCCTGGGGTGGGAGGAGGG + Intergenic
1171780461 20:29411823-29411845 TTGTGGGGTGGGTGGGTGTAGGG + Intergenic
1171913661 20:30991304-30991326 TTTTGGGGGGGGAGGGGGGAGGG + Intergenic
1171999089 20:31758093-31758115 TTGAGGGAGGGGTGGCAGGAGGG - Intronic
1172037405 20:32019472-32019494 TGGTGGGTGGGGCGGGGGCAAGG - Intronic
1172090754 20:32430544-32430566 ATGGGGGTGGGGTGGGGTGAGGG - Intronic
1172139444 20:32711828-32711850 TGGAGGGTGGGGTGGGGGGAGGG + Intronic
1172216077 20:33236745-33236767 TTGTGTGTTGGGTGAGGGGAGGG + Intronic
1172232530 20:33346737-33346759 TTGTGGGGGGGGGGGGGGGGGGG + Intergenic
1172434574 20:34920043-34920065 TTAGGGGTGGAGTGGGCAGAAGG - Intronic
1172613678 20:36269210-36269232 TGGTGGGGGGGGGGGGCGGGGGG + Intronic
1172766793 20:37355393-37355415 GTATGGGTGGAGTGGGCGGAGGG - Intronic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1172843112 20:37913877-37913899 TTCTGAGTGGGGAGGGCGCACGG + Intronic
1172910508 20:38405890-38405912 GTGTGGCTGAGGTGGGAGGATGG + Intergenic
1173172948 20:40742067-40742089 TGGTGGGCGGGGTGGGGGGGCGG + Intergenic
1173177767 20:40777448-40777470 GTGGGGGTGGGGTGGGAGGGTGG - Intergenic
1173831191 20:46089738-46089760 TTGTGGGGGGCCTGGCCGGACGG - Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174284953 20:49465920-49465942 TTGTGGGTGGATTGGTGGGAAGG - Intronic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1174494478 20:50930444-50930466 TTTTGGGGGTGGGGGGCGGACGG + Intronic
1174541588 20:51293727-51293749 TTGGAGGTGGGGTGGGTGGGTGG - Intergenic
1174593879 20:51668086-51668108 TGGGGGGGGGGGGGGGCGGAAGG + Intronic
1174760436 20:53201743-53201765 TTGCTGGTGGGGTGGTGGGATGG + Intronic
1174980694 20:55391371-55391393 TGGTGGGTGGGGTTGGGGGAGGG - Intergenic
1175158403 20:56989956-56989978 TTGTGTGTGGGGGGGGCGGGGGG + Intergenic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175260487 20:57670901-57670923 TTGGGGGTTGGGGGGGCGGTGGG - Intronic
1175300193 20:57937646-57937668 TGGTGAGCGGGGTGGGCAGAGGG + Intergenic
1175314930 20:58040533-58040555 GTGTGTGTGGGGTGGGGGGTGGG - Intergenic
1175429254 20:58890956-58890978 GAGGGGCTGGGGTGGGCGGAAGG - Intronic
1175521401 20:59604597-59604619 TGGGGGGTGGGGTGGGGGGAGGG + Exonic
1175772497 20:61632593-61632615 GAGTGGGTGGAGTGGGTGGAGGG - Intronic
1175973065 20:62696851-62696873 TGGGGGGTGGGGTGGGGGGTGGG + Intergenic
1175973079 20:62696879-62696901 GTGTGGGTGGGGTGTGGGGTGGG + Intergenic
1176163642 20:63661557-63661579 CTGAGGGTGGGGTGGGCCCATGG + Intronic
1176210804 20:63920361-63920383 TGGTGGGTGTGGTGGGGGAAGGG + Intronic
1176233565 20:64043512-64043534 TGGTGGGTGGGCTGGATGGAGGG + Intronic
1176273398 20:64248261-64248283 GGGTGGCTGGGGTGGGCGGGGGG - Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176359417 21:5982601-5982623 TGGTGGGTTGGGTGGGTGGGTGG + Intergenic
1177473604 21:21590696-21590718 TTGGTTGTGGGGTGGGGGGAGGG - Intergenic
1177563988 21:22795074-22795096 TTTTGGGGGGGGTGGGCAGCTGG - Intergenic
1177649250 21:23939447-23939469 GAGTTGGTGGGGTGGGAGGAAGG - Intergenic
1177845812 21:26286286-26286308 TTGTGGGTGGAGGGGTGGGAGGG - Intergenic
1177914202 21:27067987-27068009 TTGAGGGGAGGGTGGGGGGAGGG + Intergenic
1178834853 21:36088148-36088170 TGGTGGCTGGGGTGGGCTGGAGG - Intergenic
1178898992 21:36583978-36584000 GGGTGGGTGGGGTGGGCGTGGGG - Intergenic
1178899004 21:36584000-36584022 GGGTGGGTGGGGTGGGCGTGGGG - Intergenic
1179058364 21:37956470-37956492 TTAGGGGTGGGGTGTGGGGAGGG + Intronic
1179644068 21:42764968-42764990 TTGTGGGGTGGGTGGGTGGATGG + Intronic
1179719411 21:43306784-43306806 TTCTGGGTGGGGCTGGTGGAGGG - Intergenic
1179764101 21:43555949-43555971 TGGTGGGTTGGGTGGGTGGGTGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179879165 21:44286323-44286345 TTGGGGGTGAGGTGTGGGGACGG - Intronic
1179928113 21:44549803-44549825 TGCTGGGCTGGGTGGGCGGAGGG - Intronic
1179938060 21:44617405-44617427 TGCTGGGCTGGGTGGGCGGAGGG + Intronic
1180005484 21:45018749-45018771 GTGGGGGCGGGGTGGGGGGAGGG + Intergenic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1180070874 21:45435300-45435322 GTGGGGTGGGGGTGGGCGGAGGG + Intronic
1180313994 22:11261958-11261980 GGGTGGGTGGGGTGGGGTGAGGG - Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180671556 22:17557665-17557687 GGGTGGGTGGGGTGGGAGCAGGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181797388 22:25320090-25320112 CTGTGGGTGGGGTGGGGGCTGGG - Intergenic
1181806175 22:25375739-25375761 TGGTGGGTGGGGTGGGAGGTGGG - Intronic
1181847115 22:25719687-25719709 TTCTTGGTGGGGTGGGGGGGGGG + Intronic
1182038743 22:27219850-27219872 GCCTGGGTGGGGTGGGGGGAGGG - Intergenic
1182044030 22:27260372-27260394 GTGGGGGGGGGGTGGGGGGAGGG - Intergenic
1182045888 22:27273915-27273937 TTGGCGGTGGGGTGGGGGGGAGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182105391 22:27685557-27685579 TTGAAGGTGGGGTTGCCGGAAGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182360600 22:29744366-29744388 TTGTGGGAGGCGGGGGCGGGCGG + Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182923271 22:34099440-34099462 GTGTGGGTGGGGTGGGGGAAAGG + Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183109365 22:35637714-35637736 CTTAGGGTGGGGTGGGAGGATGG - Intronic
1183244379 22:36682485-36682507 TCGGGAGTGGGGTGGGGGGAGGG - Intronic
1183393563 22:37559702-37559724 AGGTGGGCGGGGTGGGGGGAGGG + Intergenic
1184410424 22:44323053-44323075 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184410547 22:44323571-44323593 GGGTGGGTGAGGTGGGTGGATGG - Intergenic
1184906516 22:47490426-47490448 TTTTTGGTGGGGGGGGTGGATGG - Intergenic
1184938031 22:47739395-47739417 TAGTGAGTGGGGTGGGAGGTGGG + Intergenic
1185063917 22:48621208-48621230 GTGTGGGTGGATTGGGTGGATGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185215507 22:49597889-49597911 TAGAGGGTGGGGTTGGAGGATGG - Intronic
1185225468 22:49649352-49649374 TCGTGGATGGGGTGGCCGGGAGG - Intronic
1185334569 22:50265873-50265895 GTGGGGGTGGGCTGGGTGGAGGG - Intronic
1185362632 22:50417766-50417788 ATGTGGGTGTTGTGGGCTGATGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949708154 3:6842619-6842641 TTGGGGGTGGGGTGGGCCACGGG - Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
949920870 3:8999531-8999553 TAGGGGGTGGGGTAGGCAGAGGG - Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950106747 3:10393357-10393379 TTTTGGGTGGAGGGGGAGGAAGG + Intronic
950212697 3:11135761-11135783 TTGTGGGTGGGGTGGAGACAGGG - Intergenic
950263401 3:11558451-11558473 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
950420011 3:12892912-12892934 TTGTGGGTGGGGTGAAGGGGTGG - Intergenic
950560351 3:13717809-13717831 CTGTGGGTGGGGTGGGGGAGTGG + Intergenic
950596238 3:13985286-13985308 ATGTTGGTGGGGTGGGGGGCAGG - Intronic
950664777 3:14488505-14488527 TCTTGGGTGGGGTGGGCTGCGGG - Exonic
950674448 3:14546129-14546151 CTGTGGGTGGGGTAGAGGGAGGG + Intergenic
950726904 3:14922580-14922602 ATGGGGGTGGGGTGGGGGAAGGG + Intronic
950845481 3:16011555-16011577 TTGTGTGTGGGGGGGTCGGGGGG + Intergenic
950887075 3:16371956-16371978 TTGGGGCTGGGGTGGGCAGGAGG + Intronic
951175127 3:19590399-19590421 TGTGGGGTGGGGTGGGGGGAGGG - Intergenic
951436550 3:22671351-22671373 TTGTTGGTGGGGGGTGGGGAGGG + Intergenic
951791010 3:26484704-26484726 TTTTGGGTGGGGTGGGGTGGGGG + Intergenic
951831174 3:26928907-26928929 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
951935391 3:28017217-28017239 TTGTCGGTGGAGGGGGCAGAGGG - Intergenic
952426050 3:33175162-33175184 TTGAGGGTACGGTGGGCGGCAGG - Intronic
952784245 3:37136953-37136975 TTTTGGGGGGGGTGGGGGGGTGG + Intronic
953138840 3:40208799-40208821 TTGTGGCTGGGATGTGGGGAAGG - Intronic
953476482 3:43209803-43209825 TTGTGGGTGGAGTGTGAGGCAGG - Intergenic
953677977 3:45018042-45018064 TTGCGGGTGGGGTAGGGGGCTGG + Intronic
954317195 3:49807529-49807551 TTGGGGGTGGGGATGGCTGACGG + Intronic
954414094 3:50384551-50384573 TGATGGGTGGGGTGGGCAGGGGG - Intronic
954424297 3:50435195-50435217 TTGGGGCTGGGGTGGGGTGAGGG + Intronic
954444807 3:50540900-50540922 GGGAGGGTGGGGTGGGCGGATGG - Intergenic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954835014 3:53458818-53458840 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
954856338 3:53647110-53647132 TCGTGGGCGGGGTAGGGGGAGGG + Intronic
955320971 3:57974052-57974074 TTGGGAGTGGAGTGGGGGGAGGG - Intergenic
955350402 3:58189270-58189292 CTGGGGGTGGGGTGGGTGAAGGG - Intergenic
955421066 3:58738334-58738356 TTGGGGGTGGGGTGAGGGGAGGG - Intronic
955809145 3:62768358-62768380 TTGGGAGTGGGGTGGGATGATGG + Intronic
956167720 3:66408952-66408974 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
956588867 3:70892623-70892645 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
956642682 3:71429476-71429498 TTGGGGGTGGGGGGGCGGGAGGG + Intronic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957017975 3:75092122-75092144 TGGGGTGTGGGGTGGGGGGAGGG - Intergenic
957084618 3:75668688-75668710 TTGTGGGGTGGGTGGGTGTAGGG - Intergenic
957121585 3:76101695-76101717 GGGTTGGTGGGGTGGGGGGAGGG - Intronic
957315445 3:78570240-78570262 GTGAGGGTGGGGTGGGTGGGGGG + Intergenic
957325955 3:78695112-78695134 TTTAGGCTGGGGTGGGGGGAGGG + Intronic
958735385 3:98003427-98003449 TTTTTGGTGGGGTGGGGGCAGGG + Intronic
959223604 3:103553376-103553398 TTGTGTGGGGGGTGGGCTGGGGG + Intergenic
959258240 3:104042051-104042073 TGTGGGGTGGGGTGGGGGGAGGG + Intergenic
959291016 3:104474737-104474759 TGGTGGGTGGAGTGGGCGCAGGG - Intergenic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960273152 3:115696572-115696594 TTGTGGGGGGGGGGGGCGGTGGG - Intronic
960465863 3:117996535-117996557 CGGTGAGTGGGGTGGGGGGAGGG - Intergenic
960997918 3:123351786-123351808 TCTTGGGTGGGGTGGGAGCAGGG - Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961924262 3:130460714-130460736 TTGTGGTTGAGGTGGGTGGTAGG + Intronic
962170234 3:133094211-133094233 TGGGGGGTGGGGTGGGAGGTGGG - Intronic
962170240 3:133094223-133094245 GTGTGGGGGGGGTGGGGGGTGGG - Intronic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962305947 3:134286236-134286258 CAGTGGGGGGGGTGGGGGGAGGG + Intergenic
962714710 3:138116000-138116022 TGGTGGGTGGGGGCTGCGGAGGG - Intergenic
962755175 3:138460862-138460884 GTGTGTGTGGTGTGGGCGGGGGG - Intronic
963052154 3:141151558-141151580 TTGTGGGAGGGTTGGACGTAGGG - Intergenic
963263711 3:143218137-143218159 TTAGGGGTGGGGAGGGAGGAGGG + Intergenic
963579561 3:147108475-147108497 TTGTGGGTGGGGGAGGGGGGAGG - Intergenic
963600136 3:147371718-147371740 TGGTGGGAGGGGTGGGGGGTGGG + Intergenic
963992727 3:151671953-151671975 TTTTTGGTTGGGTGGGGGGATGG + Intergenic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964416184 3:156450853-156450875 TTTGGGGGGGGGTGGGTGGATGG - Intronic
964858146 3:161170053-161170075 TTGTTGGTGGGGTGAGGGGAGGG - Intronic
964896567 3:161603623-161603645 TTGGGTGGGGGGTGGGGGGATGG - Intergenic
964944663 3:162205810-162205832 TTGGGGGTGGGGTGGGTCAAAGG - Intergenic
965210354 3:165779006-165779028 TTGTGGGTGGGGAGGGTGACTGG - Intronic
965384222 3:168026615-168026637 ATGTGCATGGGGTGGGAGGAAGG - Intronic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965567193 3:170132570-170132592 TTGAGTGTGTGGTGGGTGGAGGG - Intronic
966024381 3:175258307-175258329 TTTTTGGTGGTGGGGGCGGAGGG - Intronic
966188369 3:177248299-177248321 TTGTGGGGGGGGTGGGGGGGGGG - Intergenic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
966629524 3:182057069-182057091 GGGTGTGTGGGGTGGGGGGAAGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
966935905 3:184709338-184709360 TCGGGGGCAGGGTGGGCGGATGG - Intergenic
967207405 3:187136644-187136666 TTTTGGGTGGGGTGGGTGGTGGG + Intronic
967273108 3:187746893-187746915 TGGGGGGTGGGGTGGGGGGGGGG + Intergenic
967337071 3:188356450-188356472 TTGAGTGTGGGGTGGGCAGTGGG + Intronic
967404338 3:189099397-189099419 TTGTGGGTGGGAAGGGGGGCAGG + Intronic
967877245 3:194275741-194275763 GTGGGGGTGGGGTGGGGGTAGGG + Intergenic
967906771 3:194507917-194507939 TTGCTGGTGGGGTGGGGGGCGGG - Intergenic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968483060 4:845320-845342 CTGTGGGTGGGGTCGGCGCGCGG + Intergenic
968571454 4:1344047-1344069 TTTTGGGTGGAGGGGGAGGAGGG + Intergenic
968613856 4:1568710-1568732 GTGCGGGTGGGGTGGGTGGGAGG - Intergenic
968650287 4:1757714-1757736 GTGGGGGTTGGGTGGGGGGATGG - Intergenic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
968950042 4:3685942-3685964 GTGTGGGGGGGGTGGGTGGTAGG - Intergenic
969302423 4:6304937-6304959 TCCTGGGTGGGGTGGTCGGCGGG - Intergenic
969345394 4:6566769-6566791 TTGTGGCTAGGGTTGGGGGAGGG - Intergenic
969367226 4:6703505-6703527 TTGTGGGTAGGTTTGGGGGAAGG - Intergenic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969557186 4:7919789-7919811 TTGGGGGTGGGGCGAGGGGAGGG - Intronic
969703816 4:8781550-8781572 TTGTGGATGGGGCTGGCGGAAGG - Intergenic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969720910 4:8892690-8892712 CTGCGGGCGGGGTGGGCCGAGGG - Intergenic
969758753 4:9167567-9167589 TTGAGCGTGGGGTGGGTGGGAGG - Intergenic
969803293 4:9586586-9586608 ATGTGGGTTGGGTGGGCTGGAGG + Intergenic
969846218 4:9922316-9922338 TGGGGGGTGGGGTGGGGGGAGGG + Intronic
969929135 4:10613244-10613266 TGCTGGGTGGGGTGGGCAGGTGG + Intronic
970314596 4:14817140-14817162 GGGGGGGTGGGGTGGGGGGAGGG + Intergenic
970842275 4:20488474-20488496 ATGGGGGTGGGGTGGGAGAATGG - Intronic
971056901 4:22923282-22923304 TTTTGTGTGGGGTTGGAGGAGGG - Intergenic
971078522 4:23178987-23179009 TCGAGGGTGGGGTTGGGGGAGGG + Intergenic
971240807 4:24887274-24887296 GTGGGGGTGGGGTGGGGGGCGGG + Intronic
971327904 4:25658905-25658927 GTGGGGGTGGGGTGGGTGGGTGG - Intronic
971354478 4:25882668-25882690 TTGGGGGTGGGGTGGGACGAGGG + Intronic
972433638 4:39010413-39010435 TTGTGTGTGTGGTGGGTGGGTGG - Intronic
972816177 4:42648359-42648381 CGGCGGGTGGGGTGGGGGGAAGG + Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973118098 4:46486460-46486482 GGGTCGGTGGGGTGGGGGGATGG - Intergenic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973706000 4:53581079-53581101 TTGGGGGTGGGGTGGGGACACGG - Intronic
973791206 4:54379759-54379781 TTTTAGGTGGGGTGGGAGGCAGG - Intergenic
973797245 4:54440076-54440098 GTGTGGGGGGGGGGGGGGGAGGG + Intergenic
973882217 4:55284977-55284999 TGGTTGGTGGGGTGGGGGGTGGG + Intergenic
973967764 4:56181473-56181495 TTGTGTGTGTGCTGGGTGGAGGG - Intronic
974091249 4:57313682-57313704 TTGTGATTGGGGTGGGGGCAGGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974483128 4:62471615-62471637 TTGTGGGTGGGGTGAGGGGAGGG - Intergenic
974901854 4:68009055-68009077 TTGTCGGATGGGTGGGGGGAGGG - Intergenic
975713796 4:77186810-77186832 ATGAGTGTGGGGTGGGAGGAGGG - Intronic
975820377 4:78265163-78265185 TGGTGGCTGGAGTGGGTGGAGGG - Intronic
975889117 4:79003604-79003626 TTGGGGGTGGAGTGAGGGGAGGG + Intergenic
975958564 4:79873014-79873036 TCTTGGGTGGGGTGGGGGCAGGG - Intergenic
976025686 4:80685616-80685638 TTGTGTGTGGGGTGGGGGGTGGG + Intronic
976047528 4:80968866-80968888 AAGTGGTTGGGGTGGGGGGAAGG - Intergenic
976100788 4:81561050-81561072 TTGGGGGTGGGGTTGGGGGAGGG - Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976309765 4:83599556-83599578 TTGTGAGTGGGGTGGGCATTGGG + Intronic
976556180 4:86453568-86453590 GTGGGGGTGGGGTGGGGGGGTGG - Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
978067683 4:104425629-104425651 TTGTGTGTGTGGTGGGGGGGAGG + Intergenic
978585144 4:110269082-110269104 TGGTGGGTGGGGTGGGGTGTGGG + Intergenic
978680173 4:111370367-111370389 TTGGGGTGGGGGTGGGGGGAGGG + Intergenic
979116678 4:116832893-116832915 TTTTGGGGGGGGTGGGGGGTGGG + Intergenic
979193394 4:117890857-117890879 CCGGGGGTGGGGTGGGCGGCAGG + Intergenic
979298021 4:119054671-119054693 GTGTGGGTGGGGTGGGCCGCAGG + Intronic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980021465 4:127714894-127714916 TGGTGGGTTGGGTGGGCAGTGGG + Intronic
980053504 4:128060238-128060260 TTGGGCGTGGGGTGGGGGGTGGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980544899 4:134246617-134246639 TTGTGGGGAGGGGGGGGGGAGGG - Intergenic
981851297 4:149233356-149233378 TTGTTTGTGGGGTGGGGGGCTGG + Intergenic
981875775 4:149543575-149543597 ATATGTGTGGGGTGGGGGGAGGG + Intergenic
982467404 4:155747965-155747987 TTGTGGGCGGGGGGGGGGGGGGG - Intergenic
982705116 4:158700545-158700567 GTGTGTGTGTGGTGGGGGGAGGG - Intronic
982840036 4:160172912-160172934 TGGTGGGTGGGGTAGGGGAAGGG + Intergenic
982859294 4:160428878-160428900 TCAGGGGTGGGGTGGGAGGAAGG - Intergenic
983019424 4:162656460-162656482 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983622708 4:169776683-169776705 GTGTGGGCGGGGTGGGGGGGTGG - Intergenic
984364945 4:178786299-178786321 TAGGGGGTGTGGTGGGGGGAGGG + Intergenic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984461387 4:180041188-180041210 ATGGGGGTGGGGTGGGGGGTGGG + Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
985264784 4:188147481-188147503 TTGGGGGTGGGGTGGGGTTACGG - Exonic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985446354 4:190022885-190022907 TTGTGGGGTGGGTGGGTGCAGGG + Intergenic
985579990 5:691428-691450 GGGTGGCCGGGGTGGGCGGAGGG + Intronic
985594837 5:783487-783509 GGGTGGCCGGGGTGGGCGGAGGG + Intergenic
985679374 5:1247928-1247950 TGGAGGGTGGGGTGGAGGGAGGG + Intergenic
985777477 5:1852350-1852372 GTGTGTGTGTGGTGGGCGGGGGG - Intergenic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
986913182 5:12583335-12583357 TAGTGTGTGGGGTGGTGGGAAGG - Intergenic
986953654 5:13123295-13123317 TTGTGGGATGGGTTGGAGGAAGG + Intergenic
987290480 5:16504049-16504071 TTGGGGATGGGTTGGGGGGAGGG - Intronic
987876226 5:23685023-23685045 TTGGGGGTGCTGTGGGTGGAGGG - Intergenic
988235257 5:28535840-28535862 GTGGGGTTGGGGTGGGGGGAGGG - Intergenic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
990311563 5:54544027-54544049 TAGGGGGTGGGGGGGGCGGTGGG + Intronic
990331378 5:54729633-54729655 GTGGGGGTGGGGTGGGGGGGGGG - Intergenic
990511525 5:56493470-56493492 GGGTGGGTGGGGTAAGCGGAGGG - Intergenic
990549737 5:56862470-56862492 TTGGGGGTGGGGTGTGGGGAAGG - Intronic
990605926 5:57410078-57410100 TTGTGAGTGGGGTGGGGGTAGGG + Intergenic
990656502 5:57962599-57962621 TTGGGGTCGGGGTGGGGGGAAGG + Intergenic
991166951 5:63574720-63574742 ATGGGGGTGGGGTGGGGGGAAGG - Intergenic
991168156 5:63587771-63587793 TGGGGTGTGGGGTGGGGGGAGGG + Intergenic
991529383 5:67598477-67598499 GTGGGGTTGGGGTGGGGGGAGGG - Intergenic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
992342531 5:75840127-75840149 TTGTGGGTTGGGGAGGGGGAGGG - Intergenic
992950416 5:81852305-81852327 TGGGCGGGGGGGTGGGCGGATGG + Intergenic
993017517 5:82551727-82551749 GTGGGGGTGGGGTGGGGGAATGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993357349 5:86930759-86930781 TTGTGTATGTGTTGGGCGGAGGG + Intergenic
993625087 5:90214205-90214227 TTGTGGGGTGGGTGGGGGGGGGG + Intergenic
993890552 5:93466903-93466925 TTGGGGGGGGGGGGGGTGGACGG + Intergenic
993923518 5:93837124-93837146 TTGAGGGTGGAGTGGGAGGAGGG - Intronic
993978107 5:94507445-94507467 TTTTGGGGGGGGCGGGGGGACGG - Intronic
993989707 5:94641179-94641201 TTGTGGGGGGGTGGGGCGGGCGG - Intronic
994051989 5:95372735-95372757 TGGTGGGAGGGGTGGGCCAAAGG - Intergenic
994100674 5:95888662-95888684 TTGGGGGTGGGGTGGTGGGGAGG + Exonic
994129539 5:96209645-96209667 GATTGGGTGGGGTGGGCGGGGGG - Intergenic
994297698 5:98110872-98110894 TGTTGGGCGGGGTGGGGGGAGGG + Intergenic
994509010 5:100679525-100679547 TGGGGGGTGGGGTGGGTGGGAGG + Intergenic
994538853 5:101068835-101068857 TTCTTTGTGGGGTGGGGGGAGGG - Intergenic
994857103 5:105136348-105136370 TTTTGGGGGGGGGGGGCGGCGGG - Intergenic
995081840 5:108060715-108060737 TTGTGTGTGGGAGGGGGGGATGG - Intronic
995594741 5:113735690-113735712 TTGGGGGTGAGGTGTGCAGAGGG - Intergenic
995785433 5:115822713-115822735 CTGTGGGTGGGTTGGGGGCAAGG - Intergenic
996408035 5:123125998-123126020 GTGTGGGTGGGTTGGGGGGAGGG + Intronic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
996728371 5:126692853-126692875 TTGGGGCTGAGGTGGGAGGATGG - Intergenic
997165016 5:131651586-131651608 TTGAGGGTGGGGTGCTCTGATGG - Intronic
997291505 5:132739232-132739254 TTGGGAGTGGGGTGGGAGGAGGG - Intergenic
997602250 5:135148623-135148645 TCATGGGTGGGGTGGGTTGAGGG + Intronic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
997737955 5:136228283-136228305 GAGTGGGTGGGGTGGGGGGTAGG + Intronic
998114299 5:139524548-139524570 TTGGGGGTGGGGTGGACGAAAGG - Intergenic
998369071 5:141649706-141649728 CTGTGGGTGGGGTGGAGGGCAGG - Intronic
998383471 5:141742332-141742354 GGCTGGGTGGGGTGGGGGGAAGG + Intergenic
998690652 5:144584038-144584060 TTATGGGGTGGGTGGGGGGATGG - Intergenic
999190406 5:149742886-149742908 GTGTGGCTGGGGTGGGTGGTGGG + Intronic
999279453 5:150355472-150355494 ATGTGGGGGGGGGGGGCGGGTGG - Intergenic
999386408 5:151157195-151157217 TTGTGTGTGGTGTCGGGGGAGGG - Intronic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1000642984 5:163726744-163726766 GTGTGGGTGGGGTAGGGGAAAGG + Intergenic
1001184372 5:169554077-169554099 TTGAGGGTGGGGTAAGGGGAAGG + Intergenic
1001286862 5:170430189-170430211 TGGATGGTGTGGTGGGCGGAAGG + Intronic
1001289963 5:170450109-170450131 GTGAGGGTGGGGTGGGGGGTCGG - Intronic
1001377479 5:171275808-171275830 TTGTGTGAGGGGTGGGGGTAGGG - Intronic
1001566312 5:172701635-172701657 TTCTGGGGAGGGTGGGCAGAAGG + Intergenic
1001602843 5:172940106-172940128 CTGTGGGTGGGCTGGAGGGAGGG + Intronic
1001731589 5:173964454-173964476 GTGAGGGTGGGGTGGGGTGAGGG + Intergenic
1001731626 5:173964537-173964559 GTGAGGGTGGGGTGGGGTGAGGG + Intergenic
1001731634 5:173964553-173964575 GTGAGGGTGGGGTGGGGTGAGGG + Intergenic
1001731663 5:173964613-173964635 GTGAGGGTGGGGTGGGGTGAGGG + Intergenic
1001748896 5:174112825-174112847 GGGTGGGTGGGGTTGGGGGAGGG - Intronic
1001865510 5:175100884-175100906 ATGTGTGTGGGGTGGGGGGCGGG - Intergenic
1002043719 5:176530897-176530919 ATGTGGGTGGGCTGGGGGGGTGG + Exonic
1002082002 5:176743046-176743068 TTGGGGGCGGGGTGGGGGGACGG - Intergenic
1002256004 5:177958965-177958987 CTGTGGGAGGACTGGGCGGAAGG - Intergenic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002723958 5:181282555-181282577 TTGTGGTTCGGGTGGGGGGCGGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003085194 6:3054781-3054803 TTGGGGGTTGGGAGGGCGGTGGG + Intergenic
1003407918 6:5838680-5838702 TTTGGGGTGGGGTGGGGGCACGG + Intergenic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004210643 6:13638852-13638874 TTGGGGGTGGGGGGAGAGGAGGG + Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004817693 6:19330552-19330574 ATGGGGGTGGGGTGGGAGGTAGG + Intergenic
1004858334 6:19774495-19774517 TGTGGGGTGGGGTGGGGGGAGGG + Intergenic
1005161557 6:22870293-22870315 TTGGGTGTGGGGAGGGGGGAGGG + Intergenic
1005736526 6:28752919-28752941 TCTTGGGTGGGGTGGGAGAAGGG + Intergenic
1005825280 6:29628295-29628317 AGGAGGGCGGGGTGGGCGGAGGG + Intronic
1005898229 6:30196126-30196148 TTGTGGTTGGGGGTGGCTGAGGG - Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006124909 6:31831298-31831320 TTGGGGGGGTGGTGGGTGGAGGG + Intergenic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006435609 6:34024584-34024606 TTGAGGATGGGGTGAGCAGAGGG + Intronic
1006672544 6:35738285-35738307 GTGGGGGGGGGGTGTGCGGAGGG + Intronic
1007208617 6:40172985-40173007 GTGGGTGTGGGGTGGGGGGATGG - Intergenic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007550734 6:42727861-42727883 TGGGGGGTGGGGTGGGGGCAAGG - Intergenic
1007581591 6:42963248-42963270 GTGGGGGTGGGGTGGAGGGAGGG + Intronic
1007731821 6:43951987-43952009 TTGTGTGTGGGGTGGGGGTATGG + Intergenic
1007889843 6:45278124-45278146 CAGTGGGTGGGGTCGGGGGAGGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008883880 6:56410931-56410953 GTGTGTGTGGGGTGGGGGGGGGG - Intergenic
1008906658 6:56684989-56685011 TTCTGTGTGGGGTGGGGGGGTGG - Intronic
1009016951 6:57916324-57916346 GGGTGGGTGGGGTGGGGGGCAGG + Intergenic
1009047285 6:58247064-58247086 TTGGGGGTGGGGGGAGAGGAGGG + Intergenic
1009223093 6:61001363-61001385 TTGGGGGTGGGGGGAGGGGAGGG + Intergenic
1009869770 6:69439685-69439707 TTGTGGGGTGGGTGGGAGGGGGG - Intergenic
1009900168 6:69800098-69800120 TTGTGGGTGAGGTGGAGGGGTGG - Intergenic
1010196013 6:73241077-73241099 TTGTGGGTGGGGGTGGGGGTGGG - Intronic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010339169 6:74727286-74727308 GTGTGGGTGGGGTGGTGGAAGGG + Intergenic
1010414918 6:75601986-75602008 GCCTGGGCGGGGTGGGCGGACGG + Intronic
1010782521 6:79960077-79960099 TTGTGGGGTGGGTGGGGGGAGGG + Intergenic
1010806422 6:80242457-80242479 TTTTTGGTGGGGTGGGAGCAGGG + Intronic
1010849166 6:80750218-80750240 GTGGGGTTGGGGTGGGGGGAGGG + Intergenic
1011163872 6:84423770-84423792 TTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1011664739 6:89623015-89623037 TGGGGGGTGGGGGGGGCGGGAGG + Intronic
1012202990 6:96429084-96429106 TGGGGGGTGGGGTGGGTGGGAGG - Intergenic
1012272876 6:97236492-97236514 TTGTGGGTGGTGTGGGAGATAGG + Intronic
1012380325 6:98613252-98613274 TTGTGGGGTGGGGGGGCGGAGGG - Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1012967941 6:105695774-105695796 GGGTGGGTGGGGTGGGCTGCTGG - Intergenic
1012968138 6:105697592-105697614 TAGGGGGAGGGGTGGGCAGAGGG + Intergenic
1013308031 6:108868219-108868241 TTGGGGGTGGGGGGGCGGGATGG + Intronic
1013385713 6:109628311-109628333 TTGTGAGTAGGGTGGGAGCAAGG - Intronic
1013509987 6:110835859-110835881 TGGGGGGTGGGGTGGGGGGATGG - Intronic
1013664312 6:112331037-112331059 TTGGTGGTGGTGTGGGGGGAGGG + Intergenic
1014093047 6:117427166-117427188 TGGTGGGTGGGGTGGGGGATGGG - Intronic
1014180413 6:118378085-118378107 TCGTGGGTGTGGTGCGCGGGAGG + Intergenic
1014935478 6:127380469-127380491 GGGTGGGAGGGGTGGGCGGATGG - Intergenic
1014964375 6:127728725-127728747 TTGGGGGTGAGGTGGCCGGGAGG + Intronic
1015062418 6:128982754-128982776 TGTGGGGTGGGGTGGGGGGAGGG - Intronic
1015594086 6:134849624-134849646 TTGTTGGGGGGGAGGGGGGAGGG + Intergenic
1015691214 6:135926082-135926104 TTTTGGGGGGGGGGGGGGGAGGG + Intronic
1015994174 6:138980673-138980695 TTGTGGGTGGGGCGGGGGGGGGG + Intronic
1016034464 6:139372505-139372527 ATGGGGGTGGGGGGGGCGGCGGG + Exonic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016311188 6:142735270-142735292 TTTTGGGTCGGGGGGGCGGGGGG + Intergenic
1016681371 6:146833194-146833216 TTGTGTGTTGGGTGGGTGGCAGG - Intergenic
1017006245 6:150029621-150029643 TTGGGGGTGAGGTGGGCCTATGG - Intergenic
1017071207 6:150576793-150576815 TTGGGGCTGGGCTGGGAGGAGGG + Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017318593 6:153062090-153062112 TGAAGGGTGGGGTGGGCGGGAGG - Intronic
1017384935 6:153872429-153872451 TTGGGGGGGGGGCGGGGGGATGG - Intergenic
1017451141 6:154555483-154555505 TGGTGGGTGGGGTGGGGGTGGGG + Intergenic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1017980648 6:159398342-159398364 TTTGGGGTGGGGTGGGCAGTGGG + Intergenic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1018383855 6:163285177-163285199 TTGCAGGTGGGGTGGGGAGAGGG - Intronic
1018580794 6:165307200-165307222 GGGTGGGGGGGGTGGGGGGATGG - Intronic
1018740593 6:166725650-166725672 TGGGGGGTGGGGTGGGCCCACGG + Intronic
1018930964 6:168239989-168240011 TTGTGGCTGGGGGCTGCGGAGGG + Intergenic
1019168081 6:170112305-170112327 TTTTGGGAGGGGTAGGAGGAAGG - Intergenic
1019186132 6:170221347-170221369 TGGGGGGTGGGGTTGTCGGAGGG + Intergenic
1019323720 7:427153-427175 TTGACGGAGGGGTGGGGGGACGG - Intergenic
1019328365 7:450789-450811 CTGTGGGTGGGTTGGGGGGTGGG - Intergenic
1019348324 7:541354-541376 CTGTGGGTGGGGTGGGGGTGGGG - Intergenic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019475514 7:1242339-1242361 TTGTGGGGGGTGCGGGCGGCCGG + Intergenic
1019477150 7:1249562-1249584 TGGTGGGGGGGGTGGGGGGGTGG - Intergenic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019604500 7:1901750-1901772 CTGTGGGTGGGCTGGGCTCAAGG - Intronic
1019606598 7:1913291-1913313 TTCTGGGCGGGGTGGGTGCAGGG + Intronic
1019704588 7:2491446-2491468 TTGGGGGATGGGTGGGTGGATGG - Intergenic
1019927036 7:4200088-4200110 TTTTTTGTGGGGTGGGGGGATGG - Intronic
1020080918 7:5285255-5285277 TTGGGGGTGGGGTGGGGTGGCGG - Intronic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020468410 7:8507183-8507205 TTGGGGGTGGCGTGGGGAGAAGG + Intronic
1020560950 7:9728178-9728200 TTTTTGGTGGGCTGGGCTGACGG + Intergenic
1020726327 7:11820028-11820050 TGGTGTGTGGGGTGGGGGCAGGG - Intronic
1021673950 7:23061694-23061716 TTGGGGGGGGGGTGGGAGGAGGG + Intergenic
1022091978 7:27113860-27113882 GGGTGGGTGGGGTGGGTGGGAGG - Intronic
1022103188 7:27181078-27181100 TTTTTGGGGGGGTGGGGGGAGGG + Intergenic
1022326150 7:29333755-29333777 TTATGGGTGGGTTGGGGTGAGGG - Intronic
1022422078 7:30232777-30232799 TTGGGGGTGGTGAGGGCAGAAGG + Intergenic
1022505875 7:30908417-30908439 TTGGGGGTGGGGAGGGAGGGAGG - Intergenic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1022543342 7:31160311-31160333 ATGTGGGAGGGGTGGGAGGTGGG - Intergenic
1022624031 7:32015521-32015543 TGGTGGGTGGGGTGGGGGGCAGG - Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023000170 7:35800734-35800756 TAGTGGGTGGGGTGCGAGGGTGG - Intergenic
1023216968 7:37872873-37872895 TTGTGTGTGGGGTGGGGGTGTGG - Intronic
1023255219 7:38306133-38306155 GTGGGGGTGGGGTGGGGGGTGGG + Intergenic
1023257545 7:38326990-38327012 TTGTGCGTGGGGTGGGAGTTAGG - Intergenic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023579447 7:41665725-41665747 TGGGGGGTGGGGGGGGGGGAAGG + Intergenic
1023866375 7:44240323-44240345 TTGTGCGGGAGGTGGGCAGAAGG - Intronic
1024128558 7:46326155-46326177 TTTTGGGGGGGGTGGGGGGACGG - Intergenic
1024282349 7:47730034-47730056 TGTGGGGTGGGGTGGGAGGAGGG - Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1024529051 7:50375703-50375725 TGGTGGGTGGGGGGGGGGGGTGG - Intronic
1025020556 7:55476425-55476447 GTGTCGGGGGGGTGGGCGGGGGG + Intronic
1025197994 7:56946911-56946933 TTGGGGGTGGGGTGGGGGGGGGG + Intergenic
1025581304 7:62721828-62721850 CTGTTGGGGGGGTGGGGGGAGGG + Intergenic
1025581774 7:62728743-62728765 CTGTTGGGGGGGTGGGGGGAGGG - Intergenic
1025777017 7:64569033-64569055 GTGTGGGTGGGCTGGGGGAAGGG - Intergenic
1025839845 7:65136184-65136206 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1025883221 7:65559781-65559803 CTTGGGGTGGGGTGGGGGGAGGG + Intergenic
1025890225 7:65642825-65642847 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1026182029 7:68050071-68050093 TTTTTGGGGGGGTGGGCGGGGGG - Intergenic
1026255833 7:68710278-68710300 TTGAGGGTAGGGTTGGGGGAGGG + Intergenic
1026264319 7:68783173-68783195 GTGGGGGTGGGGTGGGGGGATGG - Intergenic
1026293440 7:69029426-69029448 TGGGGGGTGGGGTGGGGGTAGGG + Intergenic
1026468635 7:70675783-70675805 TTGTGGGAGGAGTTGCCGGAGGG + Intronic
1026739094 7:72967243-72967265 TTTTGGGGGGGGTGGGGGGCTGG + Intronic
1026942427 7:74294907-74294929 TGGTGGGTGGGGTAGTCTGAAGG + Intronic
1027104637 7:75397830-75397852 TTTTGGGGGGGGTGGGGGGCTGG - Intronic
1027345826 7:77258343-77258365 TTGAGGGATGGGTGGGCAGACGG + Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027741731 7:82016604-82016626 TTTTGGGGGGGGGGGGCGGGCGG - Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1028410498 7:90525525-90525547 TGTGGGGTGGGGTGGGGGGAAGG - Intronic
1028504664 7:91557857-91557879 TTGGGGGTGGGTGGGGAGGAGGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028714920 7:93954639-93954661 TTGGGGATGGGGTGGTCGTAGGG + Intergenic
1029069457 7:97883411-97883433 ATGTGGGTTGGGTGGGCTGGAGG - Intergenic
1029098488 7:98107475-98107497 TTGGGGCTGGGGAGGGCGGCGGG + Intronic
1029126026 7:98295750-98295772 GTGTGCTTGGGGTGGGTGGAGGG - Intronic
1029162221 7:98560469-98560491 TTTTGGGTGGGCTGGGAGGTGGG + Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029200992 7:98839113-98839135 TTGGGGGCGGGGTGGGGGGGCGG - Intergenic
1029259401 7:99291621-99291643 TTGGGGGTGGGGGGGGTGGGGGG - Intergenic
1030120087 7:106101449-106101471 TTGTGGGGGGGGGGGGGGGGGGG - Intronic
1030709761 7:112736455-112736477 TTGGGTGTGGGGAGGGGGGAAGG - Intergenic
1031101577 7:117486867-117486889 AGGTGGGTGGGGTGGGGGGGAGG + Intronic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031533404 7:122904154-122904176 TTGTGTGTGGTGTGAGAGGATGG - Intergenic
1031898272 7:127379842-127379864 GTGTGGGGGGGGTGGGGGGGTGG - Intronic
1031973505 7:128079849-128079871 TTGTTGGTGGGGGGTGGGGAGGG - Intronic
1031979787 7:128117049-128117071 TTGTGGCTGGCGAGGCCGGACGG - Intergenic
1032410304 7:131689518-131689540 TTGTCGGTGGGGGGGGGGGTGGG + Intergenic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1032505665 7:132432591-132432613 TTGTTGATGGGGTGTGGGGAAGG + Intronic
1032743220 7:134760297-134760319 TTGAGGGTGGGGTTTGGGGATGG + Intronic
1032962114 7:137047650-137047672 TGTGGGGTGGGGGGGGCGGAGGG + Intergenic
1033157345 7:138968186-138968208 CGGTAGGTGGGGTGGGAGGAGGG + Intronic
1033343483 7:140509800-140509822 TCGAGGGTGAGGTGGGAGGATGG - Intergenic
1033436618 7:141338732-141338754 TGGTGGGTGGGGTATGCAGAGGG + Intronic
1033573046 7:142652604-142652626 TGGGGGGTGGAGTGGGGGGAGGG + Intergenic
1033600286 7:142884217-142884239 TTGGGGGAGAGGTGGGCGGCTGG + Intronic
1034129979 7:148706670-148706692 TTGGGGGTGGGGGCGGCGGGGGG + Intronic
1034269744 7:149797762-149797784 GTGTGGGTGGGGTAGGGGGTAGG + Intergenic
1034387273 7:150750433-150750455 GGGAGGGTGGGGTGGGGGGAGGG - Intergenic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034811654 7:154137638-154137660 TGGTGGGGGGGGTGGGGGGGTGG + Intronic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035330170 7:158091667-158091689 TGGTTGGTTGGGTGGGTGGATGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035842669 8:2829154-2829176 TTCTGGGGAGGGTGGGTGGATGG + Intergenic
1036238296 8:7061422-7061444 TTTTGGGGGGGGTGGGGGTATGG - Intergenic
1036251699 8:7168077-7168099 ATGTGGGTTGGGTGGGCTGGAGG - Intergenic
1036365792 8:8119384-8119406 ATGTGGGTTGGGTGGGCTGGAGG + Intergenic
1036388139 8:8299490-8299512 TCGTGTGTGGGGTTGGGGGAAGG - Intergenic
1036524483 8:9522004-9522026 TTTTGGGGGGGGTTGGAGGAGGG + Intergenic
1036688797 8:10928415-10928437 AGATGGGTGGGGTGGGAGGAAGG + Intronic
1036900857 8:12668045-12668067 TGGTGGGTGGGGTGGGTAGGAGG - Intergenic
1037016752 8:13917252-13917274 TTAATGGTGGGGTGGGAGGAAGG - Intergenic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037121582 8:15294126-15294148 TTGGGGGTGGGGGTGGGGGAGGG + Intergenic
1037481988 8:19313859-19313881 GTGTGCGTGGGGTGGGAGTAGGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037520988 8:19680561-19680583 TTGTGGGGGGGGGGGGGGGTGGG - Intronic
1037525642 8:19721308-19721330 TGGTGGGTGGAGTAGGCAGAGGG - Intronic
1037579752 8:20237343-20237365 ATGTGGGTGGGAGGGGCTGAAGG - Intergenic
1037818684 8:22125233-22125255 GTGTGGGTGGGGTCAGGGGAGGG + Intronic
1038103014 8:24400780-24400802 TTGTGGGTGGGGGGAGGGGGAGG - Intronic
1038492804 8:27982376-27982398 GTGGGGGTGGGGTGGGGGGCGGG + Intronic
1038579482 8:28735199-28735221 TAGTGGTGGGGGTGGGCGGTAGG + Intronic
1039793761 8:40895616-40895638 GTGTGGGGGGAGGGGGCGGAGGG - Intronic
1039844864 8:41318849-41318871 TTATGCCTGGGGTGGGCGGCGGG - Intergenic
1039884354 8:41646866-41646888 TGGTGGGGGCGGGGGGCGGAGGG - Intronic
1039967174 8:42291825-42291847 TGGAGGCTGGGGTGGGAGGATGG + Intronic
1040292387 8:46132153-46132175 CTCAGGGTGGGGTGGGCGGGCGG - Intergenic
1040438464 8:47416769-47416791 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040446399 8:47499786-47499808 TTGTGGGTGGGGTGGGGGCAGGG - Intronic
1040471089 8:47736768-47736790 GTGTGGGGGGGGCGGGGGGATGG - Intergenic
1040471090 8:47736772-47736794 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1041007325 8:53508046-53508068 TGGTGGGTGGGGTGAGGGGTGGG - Intergenic
1041041249 8:53848535-53848557 TTGGGGGTGGGGTTGGGGGAGGG - Intergenic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041345813 8:56896766-56896788 CTGTTGGCGGGGTGGGGGGAGGG + Intergenic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1041595623 8:59647484-59647506 TTTTGGGGGGGGTGGGGGGTTGG + Intergenic
1041889181 8:62849598-62849620 TTGTGGGGTGGGTGGGGGGGAGG - Intronic
1042914787 8:73864747-73864769 TTTTGGGGGGGGGGGGCGGGGGG + Intronic
1043546378 8:81320377-81320399 TTGTGGTGGGGGTGGGTGTAGGG + Intergenic
1043769873 8:84184647-84184669 CCGTGGGAGGGGTGGGGGGAGGG - Intronic
1043842776 8:85128417-85128439 TGGTGGGGGGGGTGGGGGGGTGG - Intronic
1043871472 8:85438489-85438511 TTGGGGATGGGGTGGGGGCAGGG - Intronic
1043972947 8:86552964-86552986 TTGTGGGCGGGGGGGGGGGGGGG - Intronic
1044249695 8:89991186-89991208 GGGTGGGTGGGGTGGGGGGACGG + Intronic
1044281317 8:90360478-90360500 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1044444093 8:92253548-92253570 TTGTGGGGTGGGCGGGGGGAGGG + Intergenic
1044898990 8:96924155-96924177 TTTTGGTTGGGGTGGGGGTAGGG + Intronic
1045068786 8:98478322-98478344 TTGGGGGTGGGGTGGAAGAAGGG + Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045430318 8:102107927-102107949 GTGTGGGTGGGGTGAGGGGAAGG - Intronic
1045739143 8:105334150-105334172 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1045885918 8:107097736-107097758 TGGGGGGTGGGGTGGGGGTAGGG + Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046687362 8:117242508-117242530 TTGTGGGATGGGTGGGTGGGAGG - Intergenic
1046766911 8:118079657-118079679 TAGTGGGTGGGGTGGGGGTGGGG - Intronic
1046996210 8:120526735-120526757 TGGTGGGTGGGGTTGGAAGAGGG + Intronic
1047175466 8:122536519-122536541 CTCTGGGTGGGGTGGGAGAATGG + Intergenic
1047749304 8:127867717-127867739 TGGCGGGTGGGGTGGGGAGAAGG + Intergenic
1047759053 8:127940590-127940612 TTGTGGGGGGGGGCGGTGGAGGG + Intergenic
1047761927 8:127960936-127960958 TTGGGGGTGGGGGGGGCGGGCGG + Intergenic
1048018365 8:130517338-130517360 TTGTGAGTGGGGTGTGTGGAGGG + Intergenic
1048019897 8:130528386-130528408 ATATGGGTGGGGTGGGCTGCGGG - Intergenic
1048048952 8:130799127-130799149 TGGGGGGTGGGGTGGGAAGAGGG + Intronic
1048443672 8:134477991-134478013 TGCTGGGTGGGGTGGGGGTAGGG - Exonic
1048859458 8:138713232-138713254 TCGTGGATGGGGTGGGGGGGCGG + Intronic
1048881678 8:138877109-138877131 TTGTGGCTGGGGGTGGGGGAGGG - Intronic
1049222424 8:141434138-141434160 TGGGGGGTGGGGTGGGTGGTGGG + Intergenic
1049258098 8:141624578-141624600 TGGTGGGTGCTGTGGGCAGACGG + Intergenic
1049358117 8:142198706-142198728 GTGTGGCTGGGGTGAGCAGAGGG + Intergenic
1049375062 8:142285442-142285464 GGGTGGGTGGGGTAGGTGGATGG + Intronic
1049693565 8:143973158-143973180 GGGTGGGTGGGGTGGGCCGCGGG - Intronic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1051041782 9:12820496-12820518 TTTTGGGGGGGGGGGGGGGACGG - Intronic
1051690748 9:19709750-19709772 TGGTGTGGGGGGTGGGGGGAGGG + Intronic
1051778229 9:20659219-20659241 TTTTGTGTGGGGCGGGGGGAGGG - Intronic
1052328873 9:27246948-27246970 GTGTGTGTGGGGTGGGGGGGGGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052713561 9:32087832-32087854 CAGTGGGTGGGGTGGGGGAAGGG + Intergenic
1055056638 9:72030069-72030091 TTGTTGGTTGGGTGGGTGGATGG - Intergenic
1055071084 9:72166411-72166433 GTGTGGGTGGGGTGGGGGTGGGG + Intronic
1055447118 9:76394432-76394454 GTGTGAGCGGGGTGGGGGGAGGG + Exonic
1055522676 9:77097572-77097594 GTGGGGGTGGGGTGGGGGGGCGG - Intergenic
1055923723 9:81488888-81488910 GTGGGGGTGGGGTGGGGGTATGG - Intergenic
1055963103 9:81839456-81839478 TTGGGGGGGGGGGGGGTGGATGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056393780 9:86162946-86162968 TTGTGGGTTCGGCGGGGGGAGGG + Intergenic
1056490247 9:87099110-87099132 TTGGAGGTTGGGTGGGAGGAGGG + Intergenic
1056781071 9:89551535-89551557 GTGTGCGTGGGGTGGGGGGTGGG - Intergenic
1056844512 9:90025574-90025596 TTCTGGGAGGAGTGGGAGGAAGG + Intergenic
1057173628 9:92978411-92978433 ATGGGGGTGGGGTGGGGGGGTGG - Intronic
1057213937 9:93218025-93218047 GGGGGGGTGGGGTGGGGGGAAGG + Intronic
1057214569 9:93220744-93220766 TTGTGGGTGTGGTGGGCCCGGGG + Intronic
1057271075 9:93651817-93651839 TTGAGGGTGTGGTGGGAGGCAGG + Intronic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1058108510 9:101003415-101003437 TGAGGGGTGGGGTGGGGGGAGGG + Intergenic
1058121509 9:101144263-101144285 TTGGGGGTGGGGAGCGGGGAGGG + Intronic
1058654507 9:107207603-107207625 TCCTGGGTGGGGTGGGGGAATGG + Intergenic
1058781517 9:108341239-108341261 TTGTGGTTGTGGTGGGTGGTTGG + Intergenic
1058847215 9:108972846-108972868 GTGTGGGTGGGGGGGTGGGAGGG + Intronic
1058976938 9:110133658-110133680 TGGGGGCCGGGGTGGGCGGAGGG - Intronic
1059018115 9:110543960-110543982 TGCTGGGTGGGGTGGGAGCAGGG + Intronic
1059260682 9:112972974-112972996 TTGAGTGTGGGGTTGGCGGGGGG + Intergenic
1059369304 9:113812831-113812853 TTGTGTGTGTGGTGAGGGGAGGG - Intergenic
1059404595 9:114092111-114092133 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059758465 9:117316343-117316365 TTGGAGGTGGGGTGAGCGGTGGG + Intronic
1060206400 9:121685134-121685156 GTGAGGGTGGAGGGGGCGGAGGG - Intronic
1060223935 9:121780256-121780278 CTGGGGGTGGGGTGGCAGGAGGG - Intronic
1060329695 9:122655686-122655708 TGGGGGTTGGGGTGGGGGGAGGG + Intergenic
1060512296 9:124242910-124242932 GTGTGGGAGGGGTGGGAGGCAGG - Intergenic
1060529857 9:124341732-124341754 GTGTGGGTGGGCTCGGGGGAGGG + Intronic
1060640718 9:125236152-125236174 TCGTGTGTGGGGTGAGGGGAGGG - Exonic
1060912798 9:127364085-127364107 TTGGGGGTGGGGTGGTTGGAGGG - Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061230276 9:129311934-129311956 TGGTGGGTGGGGCGGGGGGTCGG + Intergenic
1061406424 9:130395116-130395138 GTGGGGGTGGGGTGGGGGCAGGG + Intronic
1061562627 9:131415948-131415970 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1061780914 9:132995563-132995585 GTGTTGGTGGGGTGGGTGGCTGG + Intergenic
1062103758 9:134741607-134741629 AGGAGGGTGGGGTGGGAGGAGGG + Intronic
1062105518 9:134752831-134752853 TTGTTGGTGGGGGGTGGGGATGG + Intronic
1062153642 9:135034068-135034090 TGGTGGGTGGGGTCAGTGGAGGG - Intergenic
1062153670 9:135034142-135034164 TGGTGGGTGGGGTCAGCAGAGGG - Intergenic
1062266868 9:135690576-135690598 ATGAGGGTGGGGTGGGAGGTGGG - Intergenic
1062373487 9:136252071-136252093 TGGTGGACGGGGTGGGCGGCCGG - Intergenic
1062373594 9:136252357-136252379 TGGTGGACGGGGTGGGCGGCCGG - Intergenic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062534607 9:137015941-137015963 AAGTGGGTGGGCTGGGCGGGGGG - Exonic
1062534746 9:137016533-137016555 TGGTGGCTGGGGTGGGCGCTGGG - Intronic
1062542637 9:137048428-137048450 CTGAGGGTGGGGTGGAAGGATGG + Exonic
1062542671 9:137048529-137048551 TTGGGAGAGGGGTGGGTGGAGGG + Exonic
1062542692 9:137048582-137048604 TTGTGGGAGGGGTGGGAGTACGG + Exonic
1062559137 9:137131694-137131716 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185709724 X:2293809-2293831 GTGTGTGTGTGGTGGGGGGAGGG + Intronic
1186036804 X:5431896-5431918 TTGTGGGAGGGGTGGGGGAGTGG - Intergenic
1186202651 X:7169886-7169908 TTGTTGGTGGGGGGGGCTGGGGG + Intergenic
1186344308 X:8675851-8675873 CGGGGGGTGGGGTGGGGGGAGGG - Intronic
1186529220 X:10278513-10278535 TTGTGGGTGGCGGGGGAGAAAGG + Intergenic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1187108450 X:16269843-16269865 CGGTGGGTGGGGTGGGGGGAGGG - Intergenic
1187252980 X:17615777-17615799 TTGTCGGTGGGGTGGGGGGGTGG - Intronic
1187362311 X:18640432-18640454 TTGGGGGTGGGGGGGGGGGGTGG - Exonic
1187391658 X:18890265-18890287 TTGGGGGTGGGGTGGGTGGGAGG + Intergenic
1187618308 X:21021914-21021936 TGGGGGGTGGGGTGTGAGGAGGG + Intergenic
1187760778 X:22581539-22581561 CTGTGGGTGGGTTGGGGGCAAGG + Intergenic
1187948741 X:24451618-24451640 TTGAGGGTAGGGTGGGGGAAAGG - Intergenic
1188002387 X:24994755-24994777 TTGGGGGTGGGGGGGGCGCGGGG + Intronic
1188350325 X:29122456-29122478 GTGTGGGTGGGGTGGGGGTGGGG - Intronic
1188500261 X:30818091-30818113 TTGTGGGTGGGTTGGGGGTGGGG + Intergenic
1188874451 X:35412809-35412831 TTGGGGGTGGGGTGGGGGTAGGG + Intergenic
1188886439 X:35556195-35556217 TTCGGGGTGCGGTGGGGGGAAGG + Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189258977 X:39663927-39663949 TCGTGGGAGGGGTGGGTGGGGGG - Intergenic
1189637873 X:43031425-43031447 ATGGGGTTGGGGTGGGGGGAGGG + Intergenic
1190108964 X:47577712-47577734 TTGTTGGTGGGGTGGAGTGAGGG - Intronic
1190478143 X:50848356-50848378 GTGGGGTTGGGGTGGGGGGAGGG + Intergenic
1190666942 X:52704829-52704851 GTGTGTGTGGGGTGGGGGTAGGG + Intronic
1190672476 X:52753579-52753601 GTGTGTGTGGGGTGGGGGTAGGG - Intronic
1190732136 X:53233391-53233413 TTGTAGGTGGGGTAGGTGTAAGG + Exonic
1190948071 X:55115276-55115298 TTTTGGGGGGGGTAGGGGGATGG - Intronic
1191138767 X:57093991-57094013 TTTTGATTGGGGTGGGGGGAGGG + Intergenic
1191672816 X:63764806-63764828 TTGTTGGTGGGGCTGGGGGAGGG + Intronic
1192424161 X:71060774-71060796 TTGGGGTTGGGGTGGGTGGGTGG - Exonic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192597578 X:72427594-72427616 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
1192779921 X:74283512-74283534 AACTGGGTGGGGTGGGGGGAAGG - Intergenic
1193041706 X:77010802-77010824 TTGAGGGTGGAGTGGGGGCAGGG - Intergenic
1193125297 X:77864259-77864281 TGGTGGGCGGGGTGGGGGGGAGG + Intronic
1193252750 X:79310981-79311003 TTGTGGGTGGTGGGGGGGTAGGG - Intergenic
1193607281 X:83583913-83583935 TGGTGGGTTGGCGGGGCGGAGGG - Intergenic
1193671777 X:84396540-84396562 TTGTGGCTGTGGTGGCCAGATGG + Intronic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194414269 X:93591169-93591191 TTTTTGGTGGGGTGGGTAGAGGG - Intergenic
1194476379 X:94364532-94364554 GTGTGGTGGGGGTGGGGGGAGGG + Intergenic
1194806816 X:98339328-98339350 GTGTGTGTGGGGTGGGAGAAGGG - Intergenic
1195415459 X:104615371-104615393 TGGGGGGTGGGGTTGGGGGAGGG - Intronic
1195510019 X:105704772-105704794 TGGTGGGTGGGGTGGTGGGAGGG - Intronic
1195631417 X:107059334-107059356 TGTGGGGTGGGGTGGGCGGAAGG + Intergenic
1195869689 X:109473048-109473070 ATGTGGGTGGGGTGGGGGCAGGG - Intronic
1196841579 X:119864295-119864317 TTGGGGGGGGGGTTGGTGGAGGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1197357467 X:125453262-125453284 GTGGGGGTGGGGCGGGGGGAAGG + Intergenic
1197668280 X:129246839-129246861 TGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1197705647 X:129632699-129632721 TTGTGGGTTGGGTTGGGGGTGGG - Intergenic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1197977358 X:132180059-132180081 CAGAGGGTGGGGTGGGGGGAGGG + Intergenic
1198019046 X:132640379-132640401 ATGGTGGTGGGGTGGGTGGACGG + Intronic
1198117333 X:133556765-133556787 TTTTTGGGGGGGTGGGGGGAGGG + Intronic
1198156994 X:133970719-133970741 TGGGGGGTGGGGTGGTGGGAAGG + Intronic
1198170366 X:134099428-134099450 TGGTGGGGGGTGGGGGCGGAAGG - Intergenic
1198394611 X:136208928-136208950 TGGGGGGAGGGGTGGGAGGAGGG + Intronic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1198673653 X:139108831-139108853 TGGGGGGTGGGGTTGGGGGAGGG - Intronic
1198802803 X:140464690-140464712 GTGTGTGTGGGGTGGGGGGTGGG - Intergenic
1199219927 X:145306131-145306153 TTGGGGGTGGGGTGGGCCATGGG + Intergenic
1199350174 X:146790817-146790839 TTGTGGGCTGGGTGGGTGGAAGG - Intergenic
1199525826 X:148790685-148790707 TTGGGGGTGGGGTTGGGGGAGGG + Intronic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199738100 X:150704357-150704379 TTGTTGGTGGGGTGGGTGTGGGG - Intronic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1199890213 X:152071528-152071550 GTGGGGGTGGGGTGTGGGGAAGG + Intergenic
1199949660 X:152698292-152698314 TGGTGTGTGGGGTGGGGGGGCGG - Intergenic
1199960014 X:152770169-152770191 TGGTGTGTGGGGTGGGGGGGCGG + Intergenic
1200834876 Y:7723701-7723723 TTGGGGCTGGGGTGGGCAGGAGG + Intergenic
1201438543 Y:13985333-13985355 TGGTGTGTGGGGTGGGAGGGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201446030 Y:14057375-14057397 TGGTGTGTGGGGTGGGAGGGAGG + Intergenic
1201699494 Y:16864752-16864774 TTGTGGGTGGGGGAGGGGGGAGG + Intergenic