ID: 1017906408

View in Genome Browser
Species Human (GRCh38)
Location 6:158760028-158760050
Sequence CATCCTTCTCCCAGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017906408_1017906416 7 Left 1017906408 6:158760028-158760050 CCCACCCCACTGGGAGAAGGATG 0: 1
1: 0
2: 4
3: 30
4: 170
Right 1017906416 6:158760058-158760080 TTTCAGGCTCATCTCTTTCCCGG 0: 1
1: 0
2: 1
3: 36
4: 271
1017906408_1017906420 30 Left 1017906408 6:158760028-158760050 CCCACCCCACTGGGAGAAGGATG 0: 1
1: 0
2: 4
3: 30
4: 170
Right 1017906420 6:158760081-158760103 CCCTCTCTTCACTCACTTTCTGG 0: 1
1: 0
2: 3
3: 24
4: 282
1017906408_1017906415 -9 Left 1017906408 6:158760028-158760050 CCCACCCCACTGGGAGAAGGATG 0: 1
1: 0
2: 4
3: 30
4: 170
Right 1017906415 6:158760042-158760064 AGAAGGATGGTGTGGATTTCAGG 0: 1
1: 0
2: 1
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017906408 Original CRISPR CATCCTTCTCCCAGTGGGGT GGG (reversed) Intronic
901456826 1:9367904-9367926 CAGCCTTCTCCCAGAGGTGTGGG - Exonic
903336285 1:22626849-22626871 CAGCCTTCTCCCAGAGTGCTGGG - Intergenic
903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG + Intronic
904807697 1:33143359-33143381 CAGCCTTCTCCCTCTGGGGTCGG - Intergenic
905254042 1:36668619-36668641 CATCCTTCAACCAATGGGGTTGG - Intergenic
905307937 1:37032317-37032339 GATCCTTCTTCCACAGGGGTGGG - Intronic
907527380 1:55061786-55061808 CATTCTACTCCAAGTGGAGTGGG - Intronic
912760112 1:112359250-112359272 TTTCCTTCCCACAGTGGGGTAGG - Intergenic
914455625 1:147833708-147833730 CCTCCTTCTCCCTGTGGAGAAGG + Intergenic
915940341 1:160114801-160114823 TTTCCTTCTTCCAGTGGGGAAGG - Intergenic
917287865 1:173440382-173440404 TAGCCTTTTCCCAATGGGGTGGG + Intergenic
919755393 1:201062970-201062992 CATCCTCCTGCCAGTGGGGCGGG + Intronic
922338410 1:224636189-224636211 CATCCTTCTGGTAATGGGGTTGG + Intronic
923119445 1:230977653-230977675 CAACCATCTCCCAGTGGGTTCGG + Intronic
924517764 1:244780578-244780600 CAGCCTTCTCCCCGCGGCGTGGG + Intergenic
1063624507 10:7676579-7676601 CAACCTTCTCTCAGTGGTGGGGG - Intergenic
1064954636 10:20894217-20894239 CATCGTTCTCCCAGAGTGCTGGG - Intronic
1065126706 10:22580811-22580833 CGTCCTTTTGCCAGTGGGGAAGG - Intronic
1067935928 10:50612010-50612032 CAGCCCCCTGCCAGTGGGGTGGG + Intronic
1069042606 10:63710926-63710948 CCCCCTTCTCCCAGTGGGGTGGG - Intergenic
1070809665 10:79291221-79291243 CTTCCTCCTTCCAGTGGGGAGGG + Intronic
1072082031 10:92042338-92042360 CTTCATTCTCCCTGTTGGGTAGG + Intergenic
1072561295 10:96577784-96577806 CATCCTTCCCCCAGTAGGACAGG - Intronic
1074234423 10:111570786-111570808 CATTCTGCTCCCAAAGGGGTAGG - Intergenic
1074675915 10:115850916-115850938 TGTCCTTCACACAGTGGGGTTGG - Intronic
1074756709 10:116629154-116629176 CATCCTTCACCCAGTGCCTTGGG - Intronic
1075084796 10:119407381-119407403 TTTCCTTCTCCCACTGGGGATGG + Intronic
1075326003 10:121532699-121532721 CCTCCTTCTTCCACTGGGGATGG + Intronic
1075463287 10:122632663-122632685 CATCCTTTTCCCAGTGTGCTGGG + Intronic
1075554164 10:123417764-123417786 CATCTTTCTCCCAGTCTTGTGGG + Intergenic
1075577442 10:123588345-123588367 CTTCCTTCTATCAGTGGGGGAGG + Intergenic
1075949184 10:126462543-126462565 CATCCATCACCAGGTGGGGTTGG + Intronic
1077814728 11:5675610-5675632 CATCCTTCAACCAATGGGGTTGG - Intronic
1078105874 11:8357675-8357697 CAGCCTTCTCCTAGTGGGGAGGG - Intergenic
1080431179 11:32201406-32201428 CCACCTTCACCCAGTGGGGCTGG + Intergenic
1080743113 11:35083773-35083795 CCTCTTTCTCCCAGTGGGCAGGG + Intergenic
1083573248 11:63771083-63771105 TCCCCTTCCCCCAGTGGGGTTGG - Intergenic
1084543096 11:69799380-69799402 CATCACTCCCACAGTGGGGTCGG + Intergenic
1084773006 11:71356660-71356682 CAGGCCTCACCCAGTGGGGTAGG + Intergenic
1085198124 11:74684299-74684321 CAGCGTTCTCCCACTGAGGTTGG + Intergenic
1088522383 11:110712900-110712922 CACCCTATCCCCAGTGGGGTGGG - Intronic
1089130094 11:116205492-116205514 CATCCTTCTGACAGTGGTGGTGG - Intergenic
1089401118 11:118165199-118165221 CATCATTTTCCCAGTGGGAGGGG - Exonic
1090766020 11:129877039-129877061 CATCCTTTTCCCACTGTGGTTGG - Intronic
1091047847 11:132340999-132341021 CAGGCTTCTCACAGAGGGGTTGG - Intergenic
1092526108 12:9311236-9311258 CACCCTTCTCCCAGTGGGCATGG - Intergenic
1092541172 12:9420547-9420569 CACCCTTCTCCCAGTGGGCATGG + Intergenic
1093616667 12:21233648-21233670 CTTTCTTCTCCCAGTTGGTTTGG - Intronic
1094511871 12:31101928-31101950 CACCCTTCTCCCAGTGGGCATGG - Exonic
1095931835 12:47635443-47635465 CATCCTTCTCCCAGATGGGGTGG + Intergenic
1096363011 12:51004489-51004511 CATCCTCCTCCCCTTGGGCTGGG + Intronic
1096882175 12:54682178-54682200 CTTCCTTGTCCCAGAGGGATGGG + Intergenic
1096982199 12:55734773-55734795 CAGCTTTCTCCCAGTTGAGTAGG + Intergenic
1099325963 12:81214718-81214740 CCCCCTTCTCCCAGTGCGATAGG + Intronic
1101205304 12:102481272-102481294 TACCCTTCTCCCAGAGTGGTGGG - Intergenic
1102236902 12:111299187-111299209 CATCTTCCTGCCTGTGGGGTGGG + Intronic
1105922982 13:24982638-24982660 CAGCCTTCTCCAGGTGGGCTGGG - Intergenic
1106115124 13:26811284-26811306 CATCCTTCCCCCAGTCTGGTGGG + Intergenic
1107469879 13:40681950-40681972 CAGCCAGTTCCCAGTGGGGTAGG - Intergenic
1111189282 13:84788030-84788052 TTTCCTTCTCCCAGTTGGTTCGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1111808347 13:93066374-93066396 AATCCATCTCCCAGAGGGGCTGG + Intergenic
1112106717 13:96248322-96248344 CATCCTTTTCCCAGAGGGTTTGG + Intronic
1113067566 13:106387680-106387702 CACCCCTCTGCTAGTGGGGTGGG + Intergenic
1113750778 13:112775215-112775237 GTTTCTTCTTCCAGTGGGGTTGG + Intronic
1118137351 14:63045020-63045042 CATCCCTCTCCCAAGGGGGGAGG - Intronic
1118788748 14:69069228-69069250 CAGCCTACTGCCAGTGGGGGTGG + Intronic
1120186200 14:81396059-81396081 CATCCTGCTCCGAGTGGGAATGG + Exonic
1121407294 14:93727083-93727105 CCTCCATCGCCCAGGGGGGTGGG + Intronic
1121584636 14:95054819-95054841 CATCCTTCTCCCTGAGGGCAGGG - Intergenic
1121865121 14:97355737-97355759 TAACCCTCTACCAGTGGGGTAGG + Intergenic
1123024421 14:105418015-105418037 GCTCCTTCTCCCAGTGGGAGTGG - Intronic
1123695410 15:22875678-22875700 CTTCCTTCTGTCAGTGTGGTGGG - Intronic
1124510050 15:30316253-30316275 CATCCTTGTGCCAGTTGTGTGGG + Intergenic
1124732840 15:32214300-32214322 CATCCTTGTGCCAGTTGTGTGGG - Intergenic
1124952530 15:34337327-34337349 CACCCTTCTCTCAGTAGTGTGGG - Exonic
1127251641 15:57244712-57244734 CATCCTTCTCCCAAAGTGCTGGG + Intronic
1127510991 15:59641101-59641123 CCTCCTTCTCCCAGAGTGCTGGG - Intronic
1127799179 15:62462914-62462936 CATCCTCCTCCCTATGGGGGTGG - Intronic
1128308142 15:66613573-66613595 CATCCTTTTCCAAGTGGGGTTGG + Intronic
1129504666 15:76071459-76071481 CCTACTTCTCCCAGTGTGGGTGG + Intronic
1132524136 16:406002-406024 CCCCCTTCTCCCTGTGGGGCTGG - Intronic
1132755348 16:1481851-1481873 GTTGCTGCTCCCAGTGGGGTTGG + Intergenic
1133325979 16:4942691-4942713 CCTGCTTCACCCAGTGGGGGTGG - Intronic
1134249073 16:12561821-12561843 CATCCTTCTCCCTGCAGGGGAGG + Intronic
1136448119 16:30336224-30336246 CATGCCTTTCCCAATGGGGTGGG - Intergenic
1138374091 16:56550720-56550742 CTTCCTGCTTCCTGTGGGGTTGG + Intergenic
1139442877 16:66977553-66977575 CATCCTTCACCCAGGGAGGGAGG + Intergenic
1140110262 16:71998067-71998089 CTTCCAACTCCCAGTGGGGATGG + Intronic
1141730995 16:85822787-85822809 CTTCTCTCTCCCAGTGGTGTTGG - Intergenic
1143292440 17:5842006-5842028 CACCCACCTCGCAGTGGGGTGGG + Intronic
1143651593 17:8266959-8266981 CATCCCTCTCCCACTGTGGAGGG + Intronic
1143674066 17:8417864-8417886 CCTCCTTCTCCTGCTGGGGTGGG + Intronic
1146850666 17:36219036-36219058 CCTACTTATCCCAGTGGGGAGGG + Intronic
1150122426 17:62615419-62615441 TAGCCTTTTCCCAATGGGGTGGG + Intronic
1151423945 17:74017436-74017458 AATGCTTCTGCCAGTGGGGTAGG + Intergenic
1156899642 18:42286079-42286101 CCTCCTTCTCACTGTGGAGTTGG + Intergenic
1159980566 18:74774336-74774358 CAACCTTCTCCCAATGGCATAGG - Intronic
1160837494 19:1131722-1131744 CCTCCTTCTGCCCCTGGGGTAGG - Intronic
1160898577 19:1415204-1415226 GTTCCTTCTGCCAGTGAGGTGGG + Intronic
1163155831 19:15439508-15439530 CATCCTCCTCCCAGTGGGGATGG + Intronic
1163821048 19:19496747-19496769 CATCCTACTTCCAGTGGGTGGGG - Intronic
1164812843 19:31171715-31171737 CCTCATACTCCCTGTGGGGTAGG + Intergenic
1166333941 19:42094259-42094281 CACCCTTTTACCAGTGGGGTTGG + Intronic
1168280271 19:55302010-55302032 CATCCTGCCCCCGGTGGGGTGGG + Intronic
925495626 2:4445958-4445980 CATCCCTCTTCCATTTGGGTTGG + Intergenic
925776672 2:7342778-7342800 CCTCCTTCTCCCAGAGTGCTGGG - Intergenic
926958930 2:18332653-18332675 CTTCCATCTCCGAGTGGGGCTGG - Intronic
927194443 2:20538079-20538101 CTGGCTTCTCCCCGTGGGGTGGG + Intergenic
928134754 2:28679881-28679903 CATGCCTCTCCCTGTGGGGAAGG - Intergenic
931937765 2:67217103-67217125 CATGCTTCTCCCATTGAGGGAGG - Intergenic
932476440 2:72009282-72009304 CCTCCTTCTCCAAGTGGCCTTGG - Intergenic
934332134 2:92078515-92078537 CTTCATGCTCCCAGTGAGGTAGG - Intergenic
937515494 2:122650426-122650448 CCTTTTTCTTCCAGTGGGGTAGG + Intergenic
937863754 2:126732858-126732880 CACCCTCTTCCCAGTGAGGTCGG + Intergenic
944245619 2:197527699-197527721 CATCCTTGTCTCATTTGGGTTGG + Intronic
945163615 2:206919238-206919260 CATCCTTGTCCTTTTGGGGTGGG - Intergenic
947837372 2:233185278-233185300 CCTCCTTCTCCAACTGAGGTGGG + Intronic
948193549 2:236078537-236078559 GCTGCTTCTCCCAGAGGGGTGGG + Intronic
948336709 2:237214009-237214031 CATTCATTTCCCAGTGGGGAGGG + Intergenic
948654049 2:239465822-239465844 CAGCCTTCAGCCAGTGGGCTTGG + Intergenic
1169903344 20:10575110-10575132 CCTCCTACTCCTAGTGGGGCAGG - Intronic
1170998635 20:21391601-21391623 CAACTTTCTCCCAGCGGGGTCGG + Intergenic
1172066965 20:32228187-32228209 CATCCTTTTTCCCGTGGGGGTGG + Intronic
1172604243 20:36203922-36203944 ACTCCTCCTCCCTGTGGGGTGGG + Intronic
1172992793 20:39048582-39048604 CATCTTTCATCCAGTGGGGATGG + Intergenic
1173846673 20:46192917-46192939 CCTCCTGCTCCCACTGGGGGGGG - Intronic
1175335107 20:58190642-58190664 GATCCTTTTCTCAGTGGGCTGGG - Intergenic
1175969551 20:62677554-62677576 CATCCTCTGCTCAGTGGGGTTGG - Intronic
1178430721 21:32516591-32516613 CAGCCCTCCCCAAGTGGGGTAGG - Intergenic
1179293913 21:40043786-40043808 TCTATTTCTCCCAGTGGGGTAGG + Intronic
1179427123 21:41290454-41290476 CCTCCTTCTCACAGTGGGAATGG - Intergenic
1179708512 21:43195958-43195980 CCTCCTTTTCACAGAGGGGTTGG + Intergenic
1180784080 22:18537205-18537227 CATTCTCCTCTCTGTGGGGTGGG + Intergenic
1180965725 22:19787131-19787153 CATGTTCCTCACAGTGGGGTTGG + Exonic
1181127648 22:20711253-20711275 CATTCTCCTCTCTGTGGGGTGGG + Intronic
1181240981 22:21476557-21476579 CATTCTCCTCTCTGTGGGGTGGG + Intergenic
1182146216 22:27998453-27998475 CTTTATTCTGCCAGTGGGGTTGG - Intronic
1184497085 22:44848249-44848271 CCACCATGTCCCAGTGGGGTTGG - Intronic
1184877176 22:47283227-47283249 AATCCCTATCCCTGTGGGGTCGG + Intergenic
949337464 3:2991546-2991568 CATTTATCTCCCAGTGTGGTTGG + Intronic
950485314 3:13269823-13269845 CCTCCTTCTCCCAGGGAGGGTGG + Intergenic
950553656 3:13682468-13682490 CACCCTTCTCCCTGTGGGGCAGG - Intergenic
950733812 3:14988367-14988389 ATTCCTTCTCCCAGTGGTTTGGG - Intronic
958968655 3:100586934-100586956 TTTCCTTCTCCCAGTTGGTTTGG - Intergenic
960293230 3:115912397-115912419 CCTCCTCCTCCCAGTGGGGTTGG - Intronic
964453798 3:156838557-156838579 CTTCCTTCTCCCAGTTGGTTTGG - Intronic
965653711 3:170961181-170961203 CACCCTACCCCCATTGGGGTAGG - Intergenic
969939643 4:10717624-10717646 CCTCCCTTTACCAGTGGGGTGGG - Intergenic
972627432 4:40814281-40814303 CATCTTTCTCCCACTCGTGTAGG + Intronic
974708337 4:65553106-65553128 AATACTTCTCTGAGTGGGGTAGG + Intronic
977526926 4:98157279-98157301 CTTCCTCCTCCCAGTTGGTTTGG + Intergenic
978601907 4:110437506-110437528 CGTCCTGCTCCCAGTGGGAAAGG + Intronic
983760006 4:171394259-171394281 TATCCTTCTCTCAGTTGGTTAGG + Intergenic
983939967 4:173528272-173528294 CCTCCTTCTGGGAGTGGGGTAGG + Intronic
985345720 4:189002172-189002194 CTTACTCCTCCCTGTGGGGTAGG - Intergenic
985420472 4:189780469-189780491 CATCCTTGTCTCAGTGGGCTGGG - Intergenic
985612169 5:896061-896083 CATCCTTCTCCCACAGTGCTGGG - Intronic
985635569 5:1034160-1034182 GATCCTTCCCCCTGTGGAGTTGG + Intronic
989815328 5:45729644-45729666 CTGTCCTCTCCCAGTGGGGTGGG + Intergenic
990959868 5:61383299-61383321 GATCTTTAACCCAGTGGGGTGGG - Intronic
996329785 5:122315749-122315771 TATCCTTCTGACAGTGGTGTTGG + Intronic
997147849 5:131456830-131456852 CATCCTTCTTACAGTGGTTTGGG - Intronic
1000517208 5:162252859-162252881 CATCATTATCACAGTGGGGAAGG - Intergenic
1004258892 6:14090186-14090208 CATCCTTTTCTCAGTTGGCTTGG + Intergenic
1006804813 6:36781212-36781234 CTTCCTTCTCCCTGTCTGGTGGG - Intronic
1007234612 6:40381620-40381642 CATCCTTCTGACACAGGGGTTGG - Intergenic
1007786138 6:44280382-44280404 CACCCTTCTCCCAGGACGGTGGG - Exonic
1009716589 6:67405598-67405620 CTTCCTTCTCCCAGTTGGTTTGG + Intergenic
1013069281 6:106713951-106713973 CTTCCTTCTTCCAGTGGGCTGGG - Intergenic
1016616295 6:146052454-146052476 CATCCTTCTCCCCATGGGAAGGG - Intronic
1017906408 6:158760028-158760050 CATCCTTCTCCCAGTGGGGTGGG - Intronic
1020023982 7:4885517-4885539 CATCCTTCTTCCACAGGGGTCGG + Intergenic
1020946475 7:14614844-14614866 CATCCTTCTCCCAGCTGAATTGG - Intronic
1022093877 7:27125917-27125939 CAGCCTCCTCCCTATGGGGTGGG - Intronic
1024063263 7:45714253-45714275 CATCCTTCCCTCCGTGGCGTAGG + Exonic
1025621817 7:63180001-63180023 CATCCTGCTCCCAATGGGAAAGG + Intergenic
1026735759 7:72947528-72947550 CATACTTCTCCCAAAGAGGTTGG - Intronic
1026786102 7:73302459-73302481 CATACTTCTCCCAAAGAGGTTGG - Intergenic
1027000617 7:74651171-74651193 CATCCTTCTCCCACTGAGGCAGG + Intergenic
1027107964 7:75417483-75417505 CATACTTCTCCCAAAGAGGTTGG + Exonic
1028381745 7:90208082-90208104 CATCCCTCTCACAGTGTGCTGGG - Intronic
1030772209 7:113488281-113488303 CAGCCATCTCCCCGTGGGGTAGG - Intergenic
1031230806 7:119103405-119103427 CATCCCTCTCCCTGTTGGGTGGG + Intergenic
1032135986 7:129278324-129278346 CATCAGTCTCCCAGTGTGTTGGG + Intronic
1034798644 7:154036858-154036880 AATCCATGTCCCAGTGGGGAAGG + Intronic
1037712364 8:21365057-21365079 CATTCTTCTCCCTGTGTTGTTGG + Intergenic
1038069899 8:24002240-24002262 CATAATTTTCCCAGTGAGGTAGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1042648430 8:71013013-71013035 CATCCTTCTCCCAAAGAGGAGGG - Intergenic
1055640093 9:78312786-78312808 CTACCTTCTCCCAGTGGGATGGG + Intronic
1056172279 9:83997543-83997565 CACCCTCCTCCCAGTGGGTGCGG - Intronic
1057194648 9:93110341-93110363 CCTCATACTCCCTGTGGGGTGGG - Intronic
1058728174 9:107823639-107823661 CATCCTTATCCCAGTGGGCAGGG + Intergenic
1059564575 9:115370914-115370936 CATCCTTCTTTCAGTTGTGTTGG - Intronic
1186828663 X:13367349-13367371 CATTCTTCTTCCCGTAGGGTTGG + Intergenic
1187931239 X:24295331-24295353 AATCCTTCTCCTCTTGGGGTTGG - Intergenic
1188544291 X:31286552-31286574 CTTCCTTCTCAAAGTGTGGTTGG + Intronic
1189134326 X:38533134-38533156 CATCCTTCTCCTTGTGGGAGAGG + Intronic
1189234117 X:39474630-39474652 CCTCCTCCTGCCAGTGGGGCCGG - Intergenic
1190170392 X:48107803-48107825 CAACCTTCTCAAAGTGGGGGCGG - Intergenic
1190200504 X:48356783-48356805 CAACCTTCTCAAAGTGGGGGTGG - Intergenic
1190868168 X:54402123-54402145 CATACTTCCCCCTGTGTGGTAGG - Intergenic
1192215629 X:69156326-69156348 CATCCTAGTCCCACTGTGGTGGG - Intergenic
1196320491 X:114334627-114334649 AAGCCATCTCCCACTGGGGTAGG + Intergenic