ID: 1017907939

View in Genome Browser
Species Human (GRCh38)
Location 6:158769601-158769623
Sequence CAGGGTCACCCATTGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017907939 Original CRISPR CAGGGTCACCCATTGAAGGT GGG (reversed) Intronic
900185036 1:1328926-1328948 CAGGGGCACCCAGTGAGGGTGGG + Intergenic
901427533 1:9191962-9191984 AAGGGTCACCCACTGAAAGGTGG + Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
906421728 1:45674106-45674128 CAGTGTAAGCCATTGAAGTTGGG - Intronic
912345654 1:108961184-108961206 CATGGTCACTGATTGAAGGCTGG + Intronic
921379057 1:214505240-214505262 GCTGGTCACCCATTGAATGTAGG - Intronic
1063077734 10:2733312-2733334 AAGGGTCACTCTCTGAAGGTGGG + Intergenic
1069632472 10:69905372-69905394 CAGGCTCTCCCTTTGAAGCTGGG + Intronic
1075605040 10:123798765-123798787 CAAGGTCACCAAATGAAGTTAGG + Intronic
1075926877 10:126258533-126258555 CAGGGGAAGCCACTGAAGGTTGG - Intronic
1077900513 11:6483680-6483702 CAGGGTCACCTGATGAGGGTGGG - Exonic
1081429349 11:42958842-42958864 CACTGTCACACATTGCAGGTGGG + Intergenic
1082719963 11:56661987-56662009 CAGGATCAGCCATTGAATTTGGG - Intergenic
1082870081 11:57936322-57936344 CAAGGTCACTCTTTCAAGGTAGG - Intergenic
1083446423 11:62710612-62710634 CAGGGACACCCAGTGAACTTGGG + Intronic
1085715252 11:78866840-78866862 TAGGGTCACCCAACCAAGGTTGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088109898 11:106249269-106249291 CACTTTCACCCAATGAAGGTGGG + Intergenic
1089333842 11:117709146-117709168 CAGGGTCACACATTGAAACTAGG - Intronic
1095766350 12:45899788-45899810 CAGGCTCCCCCCTTGGAGGTGGG - Intronic
1096672129 12:53206368-53206390 CAGGGTCACCCAGTGAACTAGGG + Intronic
1103956134 12:124577927-124577949 CAGGGTCTCCCATTGCTTGTAGG - Intergenic
1105728391 13:23187504-23187526 CAGGGCCACCCATTGCAGTGTGG + Intronic
1106511012 13:30412598-30412620 CAGGGTCACACTTTGAAAGCAGG + Intergenic
1106899700 13:34342183-34342205 CCGAGTCACCCATTGACAGTGGG + Intergenic
1117420692 14:55542276-55542298 CAGGGAGACCCAGTCAAGGTGGG + Intergenic
1117507604 14:56418375-56418397 CGTGGTCACTCATTGAATGTGGG - Intergenic
1118752714 14:68818193-68818215 TGGGGTCACTCATTGCAGGTGGG + Intergenic
1122312350 14:100805110-100805132 CAGTGTCACCCCTGGAGGGTCGG - Intergenic
1127056441 15:55136718-55136740 CAGGTACACCAATTAAAGGTAGG - Intergenic
1129030175 15:72612147-72612169 CAGGGTTACACAGTGAGGGTGGG + Intergenic
1129476064 15:75785407-75785429 CAGGGTTACACATTGAGGGTGGG + Intergenic
1130997424 15:88911770-88911792 CAGAGTCACCCATCTAAGGCTGG + Intronic
1131282429 15:91032549-91032571 CAGGGTTACACAGTGAGGGTGGG - Intergenic
1138651258 16:58463039-58463061 CAGGGTCCCACCCTGAAGGTGGG - Intronic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1145739098 17:27257204-27257226 CATGGTGACTCATTTAAGGTTGG - Intergenic
1147253323 17:39166333-39166355 CAGGGTCTCCCCTTGATGCTTGG + Intronic
1157090970 18:44636644-44636666 CAGGCACTCCCATTGAAAGTGGG + Intergenic
1159095048 18:63892649-63892671 CATGGTGACCCATGTAAGGTGGG + Intronic
1161316841 19:3621207-3621229 CAGGGTCCCCCACTGCACGTGGG + Intronic
1161673745 19:5630080-5630102 CACCGTCACCCATTGTTGGTAGG - Intronic
1161798761 19:6403541-6403563 TAGGGTCACACAATGTAGGTGGG + Intergenic
1163215961 19:15877596-15877618 CAAGGTCACTCAGTGAAGGGTGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
935872330 2:107464499-107464521 CAGAGATTCCCATTGAAGGTTGG - Intergenic
936110720 2:109662256-109662278 CAGGGTGAACCAGAGAAGGTGGG - Intergenic
939635171 2:144573342-144573364 CAGGGTCACCAATAGGAGCTAGG + Intergenic
941248809 2:163135649-163135671 CTTGGTCACTCTTTGAAGGTAGG - Intergenic
941361521 2:164557562-164557584 CTGGCTAACCCATTGTAGGTAGG - Intronic
945182305 2:207104453-207104475 CCCTATCACCCATTGAAGGTGGG - Intronic
946187327 2:217988417-217988439 CAAGGTCACACAGTGAATGTTGG + Intronic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1173671271 20:44800680-44800702 CAGAGTCTCCCAGAGAAGGTAGG - Intronic
1178639186 21:34332581-34332603 CAGGGTCACCTGTTGAAAGGAGG + Intergenic
1180883596 22:19224119-19224141 CAGGGTCATCGAGGGAAGGTGGG - Intronic
1181034124 22:20161729-20161751 CAGGTTCACCCGTGGCAGGTGGG - Intergenic
1185235569 22:49710820-49710842 CAGGGGCACCCAGGGAGGGTGGG - Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
952101269 3:30016099-30016121 GAGGGTCTCCCATTGAAGTCTGG - Intergenic
959234094 3:103695669-103695691 CAGGGTTACCCATTGTATGGAGG + Intergenic
960001438 3:112735671-112735693 CAGGGTCCCTCATTGAAACTTGG + Intergenic
961638358 3:128349195-128349217 CAGGGCCAGCCATCGAAGCTAGG + Intronic
967385745 3:188909134-188909156 CAGTGTCTCCCATTTATGGTTGG - Intergenic
971157803 4:24102159-24102181 TAGTGGCACCCACTGAAGGTGGG - Intergenic
977995986 4:103497724-103497746 CAGGGTCAAGGACTGAAGGTGGG + Intergenic
981852953 4:149252976-149252998 GAATGTCACCCATTGAAGGAAGG - Intergenic
993715948 5:91276046-91276068 CATGGTCACCCCTGGAAGCTAGG + Intergenic
994510378 5:100695970-100695992 CAGGGTCTTCCTTTGAAGCTAGG - Intergenic
996985859 5:129563618-129563640 AAAGTTTACCCATTGAAGGTGGG - Intronic
997794504 5:136795138-136795160 CAGGGTCACCTCTGGAAGATGGG + Intergenic
998529430 5:142871248-142871270 CAGGGGCACCCATTGAACCAGGG - Intronic
1001213994 5:169838306-169838328 CAGGGTCACCCAGTGAGGAAGGG - Intronic
1003179468 6:3779789-3779811 CAAGGTCACCCTTTAAATGTGGG + Intergenic
1004373700 6:15074247-15074269 CAGGTTCTCCCATTGAAGCCAGG - Intergenic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1007318872 6:41011937-41011959 CAGGGTAACTCATTGTAGGGTGG - Intergenic
1007655184 6:43447391-43447413 CAGGGCCAGCCACTGCAGGTGGG + Exonic
1016433259 6:144009155-144009177 CAGGGTTACCCCCTAAAGGTAGG - Intronic
1016860372 6:148711979-148712001 CAGAGTCACCAATTGAGGGTGGG - Intergenic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1019141083 6:169943686-169943708 CAGGTTCACCCACTGAATATTGG + Intergenic
1022071500 7:26920148-26920170 AAGGGTTACCCATTGGAGCTAGG - Intronic
1026194641 7:68162614-68162636 CAGGGTCTCCCTCTGAAGGGAGG - Intergenic
1032485414 7:132283498-132283520 CAGGGTTACCCCTTGAAGTCCGG - Intronic
1033020431 7:137719058-137719080 CAGAGTCATCTATTAAAGGTGGG - Intronic
1035245542 7:157560213-157560235 CAGCCTGACCCCTTGAAGGTGGG + Intronic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1043294216 8:78644476-78644498 CAGGGTCACCACTTGCAGGTTGG - Intergenic
1044532022 8:93317922-93317944 CATGTTCACACATTGAAGGAGGG + Intergenic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1061062725 9:128258635-128258657 CAGGGTTACACAGTGAGGGTGGG - Intronic
1061154084 9:128846675-128846697 CAGGGTCACCCAGCCAAGGTGGG - Intronic
1187459529 X:19474333-19474355 CAGGGTCATCCATTTAGGATGGG - Intronic
1190643635 X:52504594-52504616 CAGGGTCACCCAGTGAGACTTGG - Intergenic
1192611432 X:72571246-72571268 CAGCCTCACCCATTAAAGTTTGG + Intronic
1195938199 X:110145080-110145102 CATAGTCACCCAGTGAAGGGTGG - Intronic
1197522786 X:127520304-127520326 CTGGGAGACCCATTGCAGGTTGG - Intergenic
1199401451 X:147404156-147404178 CAGTGTCACCCCATGAAGATTGG - Intergenic
1200286571 X:154828447-154828469 CAGAGTCACCCTTTGAAAGCAGG - Intronic