ID: 1017908196

View in Genome Browser
Species Human (GRCh38)
Location 6:158771151-158771173
Sequence CAGGTGACTGTGGAGCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017908196_1017908204 8 Left 1017908196 6:158771151-158771173 CCCATCAGCTCCACAGTCACCTG 0: 1
1: 0
2: 0
3: 20
4: 244
Right 1017908204 6:158771182-158771204 TGGCTGCCAGTGGCTGAGTTGGG 0: 1
1: 0
2: 3
3: 71
4: 476
1017908196_1017908202 -2 Left 1017908196 6:158771151-158771173 CCCATCAGCTCCACAGTCACCTG 0: 1
1: 0
2: 0
3: 20
4: 244
Right 1017908202 6:158771172-158771194 TGACAGGCACTGGCTGCCAGTGG 0: 1
1: 0
2: 0
3: 35
4: 254
1017908196_1017908206 18 Left 1017908196 6:158771151-158771173 CCCATCAGCTCCACAGTCACCTG 0: 1
1: 0
2: 0
3: 20
4: 244
Right 1017908206 6:158771192-158771214 TGGCTGAGTTGGGAGAACACAGG 0: 1
1: 1
2: 2
3: 33
4: 277
1017908196_1017908203 7 Left 1017908196 6:158771151-158771173 CCCATCAGCTCCACAGTCACCTG 0: 1
1: 0
2: 0
3: 20
4: 244
Right 1017908203 6:158771181-158771203 CTGGCTGCCAGTGGCTGAGTTGG 0: 1
1: 0
2: 5
3: 38
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017908196 Original CRISPR CAGGTGACTGTGGAGCTGAT GGG (reversed) Intronic
900272149 1:1796471-1796493 CATGTAACTGGGGAACTGATGGG + Intronic
900323606 1:2096683-2096705 GCGGTGAATGTGGAGCTGAGCGG + Intronic
900415288 1:2531894-2531916 CAGGTGACTTTGGAGGTGGCAGG + Intergenic
900774020 1:4568131-4568153 CAGGTTACTATGGTGCTGTTTGG + Intergenic
900978635 1:6033919-6033941 CAAGTGGAAGTGGAGCTGATGGG + Intronic
901029592 1:6299208-6299230 AAGGTGACTGAGGAGCAAATGGG + Intronic
902690647 1:18108317-18108339 CCGGGGTCTGTGGAGCTGGTTGG + Intronic
907597968 1:55737327-55737349 GAGGTGAGAGTGGAGCTGAAAGG + Intergenic
907750494 1:57258460-57258482 CTGGTGACTCTCCAGCTGATGGG - Intronic
907756762 1:57318230-57318252 CAGTTGATTGTGGAACTGAATGG + Intronic
908623251 1:66009246-66009268 CTTGTGAATGTTGAGCTGATAGG - Intronic
912957441 1:114165458-114165480 CAGGTGGCTGTTGAGCTTTTTGG + Intergenic
913158958 1:116128337-116128359 CAGGTGAGTGTGGGGCAGGTTGG + Exonic
914584486 1:149048065-149048087 CTGGAGACCATGGAGCTGATAGG + Intronic
917226576 1:172789887-172789909 CAGGTGACTGTGGTTATGACTGG + Intergenic
919913798 1:202128071-202128093 CAGGTGACTGTGAAGAGGATGGG - Exonic
920268439 1:204744442-204744464 CTGCTGACTGTGCTGCTGATTGG - Intergenic
920724156 1:208417934-208417956 CAAGCGTCTGTGGAGGTGATAGG + Intergenic
921035047 1:211369080-211369102 CAGGTACCTGGGAAGCTGATGGG - Intronic
923092491 1:230750918-230750940 CAAGGGACTGTGGACCTGAGTGG + Intronic
923100892 1:230815996-230816018 TGGGTGAGTGTGGAGCTGAGAGG + Intergenic
923148900 1:231216859-231216881 CAGGTGACTGGGAAGATGAGAGG - Exonic
1062960693 10:1571671-1571693 CAGGTGAGTGTGCAGGTGAGTGG + Intronic
1062960702 10:1571743-1571765 CAGGTGAGTGTGCAGGTGAGTGG + Intronic
1062960733 10:1571992-1572014 CAGGTGAGTGTGCTGCTGAGTGG + Intronic
1062960751 10:1572124-1572146 CAGGTGAGTGTGCAGGTGAGTGG + Intronic
1067076988 10:43193599-43193621 CGGGTGTCTGTGGAGCAAATGGG - Intergenic
1067139669 10:43646613-43646635 CAGATAACTGGAGAGCTGATTGG - Intronic
1067355110 10:45516904-45516926 CAGGTGACTGGAGAGCTGTCTGG - Intronic
1067703065 10:48587545-48587567 GAGGAGTCTCTGGAGCTGATGGG + Intronic
1067932119 10:50572565-50572587 CAGATGATTGTGTAGCTGCTGGG - Intronic
1069251030 10:66267070-66267092 CAGGTGACTGAGGAACTGAAAGG + Intronic
1069669034 10:70186100-70186122 CAGCAGAATGTGGACCTGATGGG - Intergenic
1069799501 10:71073297-71073319 CAGGTGATGGAGGAGCTGAGAGG - Intergenic
1069957343 10:72060184-72060206 CAGCTCCCTGTGGAGCTGAAGGG - Exonic
1070346457 10:75547410-75547432 CAAGTGACTGTGGCTCTGACAGG + Intronic
1071481578 10:86068978-86069000 TAGGGGCCTGTGGAGCAGATTGG - Intronic
1072547984 10:96455323-96455345 CCTGGGACAGTGGAGCTGATTGG + Intronic
1073033451 10:100546693-100546715 CAGGTGTCTGGGGAGATGAAAGG + Intronic
1074695916 10:116050101-116050123 CTGGTGACTGGGGAGGTCATAGG + Intergenic
1076804997 10:132851055-132851077 CAGGCCACAGTGCAGCTGATGGG - Intronic
1077106361 11:844172-844194 CTGGTGGCTGTGGAGGTGAGGGG + Intronic
1083094112 11:60232551-60232573 CAGGTGTCTATGGTGGTGATGGG - Intronic
1083364128 11:62131128-62131150 CAGATGACTGGGCATCTGATGGG + Intronic
1083657347 11:64235872-64235894 CCCTTGACTGTGGAGCTCATGGG + Exonic
1083731996 11:64657320-64657342 CAGCTGTCAGTGCAGCTGATGGG - Intronic
1084115341 11:67039910-67039932 CTGGGGCCTCTGGAGCTGATGGG + Exonic
1087953440 11:104254525-104254547 AGGGTGACTATGGAGCTGAGAGG - Intergenic
1088367043 11:109050803-109050825 TAGGTGACTCTGGAGCTGGGAGG + Intergenic
1088713088 11:112525703-112525725 CAGGTGGCTGAGGAGCTGCTGGG - Intergenic
1088759559 11:112916340-112916362 GAGTTGACTGTGGAGCTGAGAGG - Intergenic
1089188216 11:116635472-116635494 CAGGTGCCAGAGGAGCTGAGAGG - Intergenic
1090076329 11:123582102-123582124 AAGGAGACTGTGGGGCTGCTGGG + Intronic
1090374151 11:126277226-126277248 CAGATGACAGTGGAGCACATTGG + Intronic
1092264106 12:6968061-6968083 GAGGGGACTGGGGAGCTGAAAGG + Intronic
1094186319 12:27646889-27646911 AAGGTGCCTGAGGAGCTGTTGGG - Intronic
1094385637 12:29890022-29890044 AAGGTGAATTTGGAGCTGAGAGG + Intergenic
1096149100 12:49297575-49297597 CCGGTGAGGGTGGAGCTGCTGGG + Exonic
1096324143 12:50643321-50643343 CAGCTGACTGTGGAGATTGTTGG + Intronic
1101235487 12:102784929-102784951 CAGGTGAAGGCTGAGCTGATTGG - Intergenic
1103206936 12:119137150-119137172 CATGTGAGTGTGGAGCTGTATGG - Intronic
1103862958 12:124028844-124028866 AAGGTGACTGGCGAGCTGATGGG - Intronic
1104083933 12:125457659-125457681 CAGGTGACGGTGAAGCTGCCTGG + Intronic
1104549905 12:129746920-129746942 GTGGTGAATGTGGAGCCGATAGG - Intronic
1106387212 13:29299453-29299475 CTTGTCCCTGTGGAGCTGATGGG + Intronic
1109412602 13:61992996-61993018 CATGTGACTGGGGGGCTGCTGGG + Intergenic
1109875082 13:68391735-68391757 GAGGTGACTGAGGAACTAATGGG + Intergenic
1110890968 13:80697705-80697727 CAAGTGACTGTGTTGCTGGTGGG - Intergenic
1111321126 13:86630493-86630515 CGGTTGACTGTGCAGTTGATAGG + Intergenic
1111902381 13:94215290-94215312 CAGATGATTGTAGAACTGATTGG - Intronic
1112601362 13:100858712-100858734 AAGGTGACTGTCCTGCTGATGGG + Intergenic
1113902870 13:113806300-113806322 CAGGGGCCTGTGGGGCTGCTGGG + Intronic
1114474404 14:22983504-22983526 CAGGTGACTGTGGAGATCGAAGG + Intergenic
1118611280 14:67542236-67542258 CAGGTGACTCCGGAAGTGATGGG - Intronic
1119585637 14:75832320-75832342 CAGGTGACTGTAGACTGGATAGG - Intronic
1119821859 14:77623300-77623322 CAGGTGACTGTTGAATTGATTGG + Intergenic
1122405963 14:101501145-101501167 GAGGTGACTGTGGATGGGATGGG + Intergenic
1123762503 15:23443748-23443770 CAGGAGACTGGGGAGGTGATTGG + Intronic
1126799963 15:52289499-52289521 CTGGTGACTGTTGGGCTGTTGGG - Intronic
1129664696 15:77573030-77573052 AAGGAGACTGTGGAGCAGAGCGG - Intergenic
1130543053 15:84835665-84835687 CAGGTGACGTTAGAGCTGAGGGG + Intronic
1131155986 15:90075876-90075898 CAGGTGTGGGTGGAGCTGAGAGG - Intronic
1131462629 15:92629401-92629423 CACCTGCCTGTGGAGCTCATCGG + Intronic
1131712166 15:95067878-95067900 CAGCAGCCTGTGGAGTTGATAGG + Intergenic
1131766602 15:95682515-95682537 CAGGTTTCTGTGGAGCTTCTTGG - Intergenic
1135590360 16:23700821-23700843 CAGGGGCCTGGGGAGCTGCTGGG + Intronic
1135622869 16:23970824-23970846 CAGGTGACTGAGGTGCAGAGTGG + Intronic
1135643118 16:24138188-24138210 AAGGGGACTATGGAGCTGAGTGG - Intronic
1136091817 16:27926173-27926195 CAGGTGGCTGTGGAACACATCGG - Intronic
1136297511 16:29312102-29312124 CAGGTGCCTGTGGGGCTGCAGGG - Intergenic
1137393081 16:48097648-48097670 CTAGGAACTGTGGAGCTGATGGG - Intronic
1139546266 16:67651214-67651236 CAGGAGCATGTGGAGCTGCTGGG + Exonic
1140665444 16:77223225-77223247 AAGGTGAATTTGGAGCTGAGAGG - Intergenic
1141080568 16:81048027-81048049 CAGGTGTCTGTGGTGGTAATGGG - Intergenic
1141376143 16:83532619-83532641 ATGGCGAATGTGGAGCTGATAGG - Intronic
1142143834 16:88484430-88484452 CACGTGTCAGGGGAGCTGATGGG - Intronic
1144773374 17:17771671-17771693 CAGGTGCCCGAGGAGCTGCTGGG + Intronic
1145986974 17:29053552-29053574 CAGGGGACGGAGGAGCTGGTTGG - Exonic
1146586815 17:34089908-34089930 GAGCTGACTGAGGAGCTGTTTGG - Intronic
1147028024 17:37606165-37606187 CAGATGACTGTGGCTCTGAGTGG - Intronic
1147120130 17:38330853-38330875 CAGGGGAAGGTGGAGCTGACAGG + Exonic
1147579341 17:41619523-41619545 CCGGAGACTGTGGGGCAGATGGG + Exonic
1147686597 17:42289717-42289739 CGGATGTCTGTGGAGCTGCTGGG + Intronic
1147884387 17:43675054-43675076 CAGGTCACTGTGGGCATGATAGG + Intergenic
1149531240 17:57397074-57397096 CAGTTCACTGTGGAGCTGAGTGG + Intronic
1150614011 17:66755046-66755068 AAGGTGACTGTGGAGCGACTGGG - Intronic
1151257115 17:72886483-72886505 GAGTTGAATGTTGAGCTGATGGG - Intronic
1152424545 17:80211775-80211797 CAGGTGATTCTGAAGCTCATCGG + Intronic
1153389165 18:4534725-4534747 CAGCTGACTGAAGAGCTGTTGGG - Intergenic
1153755476 18:8278787-8278809 CAGGAGAGTTTGGGGCTGATTGG - Intronic
1154382927 18:13868966-13868988 CAGGTGAAGGAAGAGCTGATGGG - Intergenic
1154405794 18:14090026-14090048 GAGGTGACTGTGGAGATGCTCGG + Intronic
1156525720 18:37765615-37765637 CAGGTGAGTGAGGAGGTGTTTGG - Intergenic
1157296543 18:46448908-46448930 AAGGAGACTGAGGAGCTGAGTGG - Intronic
1158867488 18:61651997-61652019 AAGCTGCCTGTGGAGCTGACTGG + Intergenic
1159652985 18:70999598-70999620 CAGGTGTCTGTGTAGGTGACAGG + Intergenic
1161042406 19:2117104-2117126 CAGGAGGGTGTGGGGCTGATTGG - Intronic
1161452621 19:4354944-4354966 CAGGTGACTGTGGAAGTCCTGGG - Exonic
1161498324 19:4599063-4599085 AAGGTGACTGGGGAGATGCTGGG + Intergenic
1161583651 19:5093769-5093791 CAGGTCACTGTTCAGCTGCTGGG + Intronic
1161588637 19:5118675-5118697 CAGGTGACCCTGCAGCTGAGCGG - Intronic
1161747418 19:6069647-6069669 CAAGTGACTCTGGGGCTGAGTGG + Intronic
1162870655 19:13584015-13584037 AAGGAGACTGTGGAGCTTATTGG - Intronic
1162937234 19:13987316-13987338 AAGGTGACTTTGGAGGTGGTAGG - Intronic
1163692122 19:18743727-18743749 CAGGTGGCGGTGGAGCTGGTGGG - Intronic
1165277750 19:34769578-34769600 CAGGTGGCTGTGGAGCTATTAGG + Intronic
1166365244 19:42274848-42274870 CAGGTCTCCATGGAGCTGATGGG + Intronic
1166406382 19:42524858-42524880 CATGTGACTCTGGGGCTGCTCGG - Intronic
1168688546 19:58362978-58363000 CAGGCGCCTGTGTAGCTGTTGGG - Intergenic
924995135 2:353458-353480 AATGAGACTGTGGAGCTGTTAGG - Intergenic
927467970 2:23351165-23351187 CATGGGCCAGTGGAGCTGATGGG - Intergenic
929516758 2:42610291-42610313 CAGGTGACTCTTGACCTTATAGG + Intronic
931160690 2:59687124-59687146 CAGGTGACTGTGCTGCTGGAGGG + Intergenic
932231656 2:70088302-70088324 CAGATGACTGGGGAGCTGGCCGG - Exonic
935194879 2:100807335-100807357 CAGGTGATTCTGGTGCTGACCGG + Intergenic
936689088 2:114864627-114864649 CAGGTAACTGGGGAGATGTTTGG + Intronic
937064900 2:119010574-119010596 CAGGTGTGTGTAGAGCTGAGTGG + Intergenic
937119182 2:119430347-119430369 CAGGTGACTCTGGTGCAGAATGG + Intronic
937816221 2:126253510-126253532 GAGGTGACTGTTGTGCTGAGTGG - Intergenic
937988892 2:127651345-127651367 CAGGTGACCGTGGTGATGAACGG - Exonic
942865621 2:180670865-180670887 CATGGGACTCTGGAGCTGAGAGG - Intergenic
943715709 2:191150526-191150548 CCGGTGACTGTGGCTTTGATGGG - Intronic
944202314 2:197120768-197120790 GAGGTGAATGTTGAGCTGATAGG - Intronic
946179141 2:217939652-217939674 CGGGGGCCTGGGGAGCTGATGGG - Intronic
947144959 2:227055970-227055992 CAGGTCCCTTTGGAGATGATGGG - Exonic
947169351 2:227295621-227295643 AAGGTGAAGGTGGAACTGATGGG + Intronic
948930586 2:241129313-241129335 CAGGTGACTGTGGAGAGAACGGG - Intronic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1168994754 20:2124877-2124899 CAGGTCACTGGGGAGCTTGTGGG - Intronic
1170087676 20:12552942-12552964 CGCTTGATTGTGGAGCTGATTGG + Intergenic
1170304948 20:14928194-14928216 AAGCTGCCTCTGGAGCTGATGGG - Intronic
1171122168 20:22577320-22577342 CTGGTGACTGCGGCGCAGATGGG + Intergenic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
1173907636 20:46640443-46640465 AAGGTGCCTGTGGTGCTGGTAGG - Intronic
1174502141 20:50993075-50993097 AGGGTGACTTTGGAGCTGAGAGG - Intergenic
1175489751 20:59371918-59371940 GGGGTGACTGTGGTGCTGAAAGG - Intergenic
1175704127 20:61163178-61163200 CTGGTGGCTGGGGAGCTGACAGG - Intergenic
1175776277 20:61655803-61655825 CAGGTGACCCTGCAGGTGATGGG - Intronic
1177376577 21:20278276-20278298 CAGGTGTCTGGGGACCTGTTTGG - Intergenic
1177769925 21:25502928-25502950 GAGGTGACTGAGGAAATGATTGG - Intergenic
1177825049 21:26073483-26073505 CAGGTGACTGTGGAGGGAACTGG + Intronic
1182872668 22:33662415-33662437 CAGTTGACTGTAGAGGAGATGGG - Intronic
1183422382 22:37719378-37719400 CAGGTGGCTGGGGAGCGGATGGG + Intronic
1183837483 22:40467910-40467932 CAGATGTCTTTAGAGCTGATGGG + Intronic
1185102951 22:48851333-48851355 CAGGTGAGTGTTTAGTTGATGGG + Intergenic
1185102987 22:48851543-48851565 CAGGTGAGTGTTTAGTTGATGGG + Intergenic
952669910 3:35953867-35953889 CAGGTGTCTGTGGGGGTCATGGG + Intergenic
953002746 3:38950494-38950516 CAGGGGCCTTGGGAGCTGATTGG + Exonic
954241657 3:49298610-49298632 CGTGTGACTGTGCCGCTGATGGG - Exonic
955029666 3:55204082-55204104 CAGCTGTATGTGGAGCTGATTGG - Intergenic
959449481 3:106481270-106481292 CAGGTGACCGTGGTGGTGATGGG + Intergenic
959479081 3:106849235-106849257 CAGGTGACTATGGAGCCCCTAGG + Intergenic
959702986 3:109315929-109315951 CAGTTTACTGAGGAACTGATTGG + Intronic
961076685 3:123989378-123989400 AAGGTGAATTTGGAGCTGAGAGG - Intronic
961432481 3:126892841-126892863 CAGGTGAAAGTGGTGCTGACTGG + Intronic
962196964 3:133372356-133372378 TATGTGAATGTGGAGATGATGGG + Intronic
965508205 3:169539538-169539560 CATTTGACTGTGGAGATGAGTGG - Intronic
965670100 3:171139048-171139070 AATATGACTGTAGAGCTGATGGG + Intronic
968108695 3:196023716-196023738 CAGGTGCGTGTGGAGCTGTGTGG - Intergenic
969495867 4:7525856-7525878 CAGGTGACTGAGGAGGGGACAGG - Intronic
969495872 4:7525875-7525897 CAGGTGACTGAGGAGGGGACAGG - Intronic
969495885 4:7525931-7525953 CAGGTGACTGAGGAGGGGACAGG - Intronic
969495903 4:7526003-7526025 CAGGTGACTGAGGAGGGGACAGG - Intronic
969495913 4:7526039-7526061 CAGGTGACTGAGGAGGAGACAGG - Intronic
970220505 4:13805559-13805581 CAGATGACTGTGATGCTGGTGGG + Intergenic
971056131 4:22914855-22914877 CATGTGACTATGGAGCAAATTGG + Intergenic
971494666 4:27251080-27251102 CTGGTGAATGTGGAGCTTTTGGG + Intergenic
975178628 4:71316707-71316729 CTGGGGACTGTGGAGGTGAGGGG - Intronic
978386679 4:108182814-108182836 CAAGTGACTAAGGACCTGATGGG + Intergenic
981049926 4:140299868-140299890 CAGGTGACTGTGGAGAACAAAGG - Intronic
982018004 4:151174874-151174896 CAGGTTTCAGTGGAGCTGAAGGG + Exonic
982128719 4:152207411-152207433 CAGGTGAGTTTGGTGCAGATAGG + Intergenic
983269379 4:165543556-165543578 CAGGAGACTGTGAGACTGATGGG + Intergenic
984227295 4:177050656-177050678 CAGGTGACTGTGGAGGTCTGGGG - Intergenic
984265946 4:177498046-177498068 CAGGTGACTGGAGAACTAATAGG - Intergenic
984932846 4:184862567-184862589 CAGGTGACTGTAAAGTTTATGGG - Intergenic
985539110 5:479612-479634 CTGGTGACTGTGGTGCTGGTGGG - Intronic
987119269 5:14751204-14751226 CAGGTGACTGTGAAGCAAAATGG + Exonic
987228355 5:15867309-15867331 CAGGAGAAGGTGGAGATGATAGG - Intronic
991464752 5:66898964-66898986 AAGGTGAGTTTGAAGCTGATGGG + Intronic
995000678 5:107124008-107124030 AAGCTGAATGAGGAGCTGATAGG - Intergenic
995523078 5:113029196-113029218 CAGGTGACAGTAGCGCTGTTGGG - Intronic
995739783 5:115343535-115343557 AGGGTGACTTTGGAGCTGAGAGG + Intergenic
998227963 5:140341509-140341531 CAAGTGACTGTGGACATGGTGGG + Intronic
998365773 5:141629840-141629862 GAGGTGAGTGAGGAGGTGATGGG - Exonic
999627303 5:153534296-153534318 CAAGTGAATGTTGAGCTGAAAGG + Intronic
1002190302 5:177474093-177474115 CAGATGACAGTGGATATGATGGG - Intronic
1002964450 6:1949202-1949224 CAGCTCACTGTGAAGGTGATGGG - Intronic
1003966675 6:11258662-11258684 CAAGTGAGTGTGAAGCTGAGAGG + Intronic
1006338016 6:33431182-33431204 GTGGTGACTGTGGGGCTGAGGGG + Intronic
1007270101 6:40629798-40629820 CAAGGGACTGGGGTGCTGATGGG - Intergenic
1008700998 6:54099475-54099497 CATGTGACTGTGTAGGAGATGGG - Intronic
1009759996 6:67993177-67993199 CTTGTGATTGTGGATCTGATTGG - Intergenic
1011794765 6:90940227-90940249 CAGGTTACTGTGGACTAGATTGG - Intergenic
1011918832 6:92546003-92546025 TGGGTGACTGTGAAGCTGCTGGG - Intergenic
1013158969 6:107522950-107522972 CAGGTAACTGGGTAGATGATAGG + Intronic
1013432004 6:110063798-110063820 CAGGTGAATGTGGGGATGACAGG - Intergenic
1013836467 6:114341786-114341808 GGGGTGGCTGTGGAGCTGTTTGG - Intronic
1016105792 6:140160433-140160455 CAGGTGTCTGTAGTGGTGATTGG - Intergenic
1016907923 6:149169624-149169646 CAGGTGTTTGTGGAGAAGATAGG - Intergenic
1017525713 6:155239982-155240004 CACAAGACTGTGGAGCTGAGCGG + Intronic
1017908196 6:158771151-158771173 CAGGTGACTGTGGAGCTGATGGG - Intronic
1018907717 6:168085070-168085092 CTGGGGACTGTGGAGCTCAGTGG - Intergenic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1018987123 6:168646344-168646366 CAGGAGAAAGTGGAGCTGAGTGG - Intronic
1019174319 6:170152497-170152519 CAGGGGACTGTGGACGTCATCGG - Intergenic
1019476931 7:1248793-1248815 CAGGTGCTTGTGGGGCTGAGGGG + Intergenic
1019921208 7:4164285-4164307 CGGGTGACTGTGGCCCTGAGAGG + Intronic
1020017395 7:4838879-4838901 CAGGGGACTGAGGAGCAGAGTGG - Intronic
1021237131 7:18155953-18155975 CTGGGGACTGGGAAGCTGATGGG - Intronic
1026179531 7:68026765-68026787 CAATAGACTGTGGAGTTGATTGG + Intergenic
1026651114 7:72216691-72216713 CAGGGGACAGTGAAGCTGAGTGG + Intronic
1028877618 7:95841537-95841559 CACCTAACTGGGGAGCTGATAGG - Intronic
1030060875 7:105620146-105620168 CAGGTAACTGTGGGGCAGCTTGG + Intronic
1030149863 7:106393099-106393121 CACGTGTCTGTGGAGATGCTGGG + Intergenic
1033107315 7:138539478-138539500 CAGGTGACTCTGATGCTGCTTGG + Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035225415 7:157429761-157429783 CAGGGGACGGTGGACCTGCTGGG + Intergenic
1037425966 8:18754988-18755010 CAGGAGACTGAGGAGCTCCTTGG - Intronic
1038430172 8:27493683-27493705 CAGGTGCCTGTCCAGCTGGTGGG + Intronic
1041335409 8:56776622-56776644 CCTGGGACTGTGGAGATGATGGG + Intergenic
1042152235 8:65800167-65800189 CAGGTGCCAGTGGATCTGTTAGG - Intronic
1044004754 8:86927011-86927033 CAGGTGCCTGTGCAGTTGGTGGG + Intronic
1044048518 8:87469035-87469057 CAGGGTACTGTGGCACTGATTGG + Intronic
1045320985 8:101081010-101081032 CTGCTGACTGTGGAACTGAGCGG - Intergenic
1047092389 8:121588477-121588499 TGGGTGAATTTGGAGCTGATAGG - Intergenic
1048192336 8:132301296-132301318 CAGGTGAGTGCTGACCTGATAGG - Intronic
1049442775 8:142616849-142616871 CAGGTGACAGGGGTGGTGATGGG - Intergenic
1049562381 8:143318202-143318224 CAGGTGACGGTGATGCTGCTCGG - Intronic
1050089250 9:2000355-2000377 CAGATCACCGTGGAGCTCATTGG - Intergenic
1050270479 9:3939162-3939184 GAGGTGACTGTGGAACAGAGTGG - Intronic
1055113773 9:72585823-72585845 GAGGTGAGTGTGGAGTGGATGGG + Intronic
1059801165 9:117750819-117750841 CAGGTGGCTATGGAGGTGATTGG - Intergenic
1061896590 9:133651665-133651687 CAGGTGTGTGTGGAGCTGAGAGG - Exonic
1061940926 9:133883357-133883379 CAAGTGAGTGTGGGGCTGACGGG + Intronic
1062280749 9:135750625-135750647 CAGGTGAATGTGGAGCCCCTGGG - Intronic
1185779130 X:2829837-2829859 CAGGTGACTGTGGGGAGGACAGG + Intronic
1187481071 X:19656137-19656159 GAGGTGACTGGAGAGCTGCTTGG + Intronic
1196873523 X:120135930-120135952 TAGCTGCCTGTGGAGCTGTTTGG - Intergenic
1196929544 X:120667756-120667778 CAGGTCACTGTGGGTCTGCTGGG + Intergenic
1198328389 X:135596800-135596822 AAGGTGAATTTGGAGCTGACAGG + Intergenic
1199161981 X:144623731-144623753 CAGGTGACTTTGACGTTGATGGG - Intergenic
1199278030 X:145969493-145969515 GAGGTGACTTTGGTGCTGCTGGG + Intergenic
1200080575 X:153574346-153574368 CAGATGCCTGGGGAGCTGACAGG + Intronic
1201290916 Y:12420656-12420678 CAGGTGACTGTGGGGAGGACAGG - Intergenic