ID: 1017909732

View in Genome Browser
Species Human (GRCh38)
Location 6:158782504-158782526
Sequence CCCAGAGTTCCTGGATGTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 308}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017909732_1017909740 25 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909740 6:158782552-158782574 AGGAACCCAGGCCAAAAGGCAGG No data
1017909732_1017909737 5 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909737 6:158782532-158782554 CTGCTCTTTACGTGGAAAGCAGG No data
1017909732_1017909741 26 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909741 6:158782553-158782575 GGAACCCAGGCCAAAAGGCAGGG No data
1017909732_1017909739 21 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909739 6:158782548-158782570 AAGCAGGAACCCAGGCCAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 245
1017909732_1017909735 -3 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909735 6:158782524-158782546 GGGCCACTCTGCTCTTTACGTGG 0: 1
1: 0
2: 1
3: 11
4: 84
1017909732_1017909738 13 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909738 6:158782540-158782562 TACGTGGAAAGCAGGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017909732 Original CRISPR CCCAGAGTTCCTGGATGTAC CGG (reversed) Intronic
901176014 1:7299694-7299716 CCCACAGTCCCTGCTTGTACAGG - Intronic
901494225 1:9612281-9612303 CCCAGAGAGCCTGGGTGCACCGG + Intronic
901711572 1:11119620-11119642 TCCAGAGTACCTGGAATTACAGG - Intronic
902662627 1:17915782-17915804 CCCAGATTTTCTGGGTTTACAGG + Intergenic
903042609 1:20542686-20542708 CTCAGAATTCCTGGGTGTCCAGG - Intergenic
903422015 1:23224936-23224958 CCCATGGTTCCTGCATCTACTGG + Intergenic
904027183 1:27511731-27511753 CCCAAAGTGCTTGGATTTACAGG - Intergenic
904658610 1:32068132-32068154 CCCAGAGTTTCTGGAACTACAGG - Intergenic
905043970 1:34982161-34982183 CCCTGAGCTCCTGGATCTCCTGG - Intronic
905756507 1:40514610-40514632 CTCAGAGTTCCTGGAGTTTCTGG + Exonic
907028233 1:51143784-51143806 CCCAGAGTAGCTGGCTCTACAGG + Intronic
907148004 1:52254428-52254450 CCCAGAGTGCTAGGATTTACAGG - Intronic
909274249 1:73665094-73665116 CCCAGAATTCCTACATGTAGTGG + Intergenic
910706290 1:90133089-90133111 GCCAGATTTACAGGATGTACTGG - Intergenic
911029077 1:93466978-93467000 TCCAGAGTAGCTGGAAGTACAGG + Intronic
912318585 1:108689418-108689440 CCCTGAGTAGCTGGATCTACAGG + Intergenic
915521707 1:156449049-156449071 CCCAGAGTTGCTGGGATTACAGG - Intergenic
916424212 1:164665406-164665428 CCCAGAGTAGCTGGAATTACAGG + Intronic
918485348 1:185023026-185023048 CCCACAGTTCTTGGATATTCTGG - Intergenic
920113466 1:203603289-203603311 GCCAGAGTTACTGGTTCTACTGG + Intergenic
923269350 1:232341002-232341024 CCCAAAGTGCTTGGATTTACAGG + Intergenic
923909350 1:238422910-238422932 CCCAGAGTAGCTGGAACTACAGG + Intergenic
924546297 1:245031019-245031041 CCCAGAGTTTCTGAATGTATAGG - Intronic
1063421472 10:5915920-5915942 CCCAGGTCTCCTGGATGTAGAGG + Intronic
1063950098 10:11214158-11214180 CCCTGAGTACCTGGGAGTACAGG - Intronic
1064048405 10:12039877-12039899 CCCAAAGTTCTGGGATTTACAGG + Intronic
1065288032 10:24203756-24203778 CCCAGAGTTCCTGAAGGGCCAGG - Intronic
1065330145 10:24587241-24587263 CCCAAAGTGCCAGGATTTACAGG + Intronic
1065338872 10:24684161-24684183 TCCTGAGTTCCTGGAATTACAGG - Intronic
1065631684 10:27686898-27686920 CCCAGATGTCCTGGATCCACAGG + Intronic
1066584553 10:36918389-36918411 CCCAAAGTGCCGGGATTTACAGG - Intergenic
1067037074 10:42928422-42928444 CCCAGAGTCCCAGGCTGTCCTGG - Intergenic
1067749006 10:48957696-48957718 CCCAGAGATGCTGGGTGTCCTGG + Intronic
1069814856 10:71187226-71187248 CCCCCAGTGCCTGGATGTCCGGG - Intergenic
1070182968 10:74032113-74032135 CCCTGAGTAGCTGGAAGTACAGG - Intronic
1073288159 10:102400692-102400714 CCCTGAGTGCCTGGATCTGCTGG + Exonic
1074289926 10:112130765-112130787 TCCAGATTTCCTGGCTGAACAGG + Intergenic
1074311986 10:112329997-112330019 TCCAGAGTACCTGGAATTACAGG - Intergenic
1075681836 10:124338916-124338938 CCCTGAGTACCTGGAATTACAGG + Intergenic
1078775256 11:14388078-14388100 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1079400200 11:20100789-20100811 TCCAGTGTTCCTGGGTGTGCAGG + Intronic
1082747517 11:56981182-56981204 CCAAAATTTCCTGCATGTACTGG - Intergenic
1083469468 11:62873362-62873384 CCCAGAGTACCTGGGACTACAGG - Intronic
1084992480 11:72940509-72940531 TCCATAGCTCCTGGATGTGCGGG - Intronic
1085321257 11:75575400-75575422 CCCAGGTTTCCTGGCTGTAGAGG + Intergenic
1085623554 11:78055240-78055262 CCCAGAGTATCTGGATGATCTGG - Intronic
1090195694 11:124814839-124814861 CCCTGAGTTGCTGGAATTACAGG + Intergenic
1091065816 11:132510484-132510506 CCCAGAATTCCCGTATGTTCTGG + Intronic
1092289013 12:7147772-7147794 CCCAAAGTGCCAGGATTTACAGG + Intronic
1092378532 12:7975793-7975815 CCCCGAGTACCTGGAATTACAGG - Intergenic
1092524488 12:9301406-9301428 CCCAGAGTTCTGGGATGCACTGG - Intergenic
1092542777 12:9430406-9430428 CCCAGAGTTCTGGGATGCACTGG + Intergenic
1092975004 12:13736258-13736280 CCCAGAGTGCCTGACTGCACTGG - Intronic
1092981988 12:13804936-13804958 CCCAGGGTTCATGGATTTACTGG + Intronic
1094016311 12:25868080-25868102 CCCAAAGTGCCGGGATTTACAGG + Intergenic
1094827409 12:34280980-34281002 TCCAGAGTAGCTGGAAGTACAGG + Intergenic
1097094823 12:56538290-56538312 CCCAAAGTGCCTGGAATTACAGG + Intronic
1098153440 12:67572282-67572304 TCCAGAGTTGCTGGGTTTACAGG + Intergenic
1098301423 12:69057926-69057948 GCCAGAGTAGCTGGAAGTACAGG - Intergenic
1099125844 12:78757074-78757096 CTCATAGTTCCTGCATTTACTGG + Intergenic
1099513125 12:83562812-83562834 CCCAGAGTGCTGGGATTTACAGG + Intergenic
1099947303 12:89259151-89259173 CCCAGAGATCCTGGAATTAAAGG + Intergenic
1101286230 12:103315540-103315562 CCCACAGTTCTTGTATGTTCTGG - Intronic
1101577081 12:106007573-106007595 ACCAGACTTCCTGGATGTTCAGG - Intergenic
1101747152 12:107551230-107551252 CTCAGAGTTGCTGGATGAATGGG + Intronic
1102103647 12:110301124-110301146 CCCAAAGTTCTGGGATTTACAGG + Intronic
1102214193 12:111148735-111148757 CCCAGAGTGCTGGGATTTACAGG - Intronic
1102258973 12:111431863-111431885 CCCAAAGTTCTGGGATTTACAGG + Intronic
1103557826 12:121776508-121776530 CCCAGAGCTTCTGGATGTTGTGG + Exonic
1104016646 12:124966190-124966212 CCCAGAGTAGCTGGGAGTACAGG + Intronic
1104351215 12:128045598-128045620 CCCAGCGTACCTGGAGGTAGGGG + Intergenic
1106929790 13:34651965-34651987 CCAACAGTGCCTGGATGTCCAGG - Intergenic
1108241821 13:48472686-48472708 ACCAGAGTACCTAAATGTACTGG - Intronic
1110320104 13:74151527-74151549 TCCAGAGTTACTGGAACTACAGG - Intergenic
1112085598 13:96028884-96028906 CCCAAAGTTCTGGGATTTACAGG - Intronic
1113702545 13:112397921-112397943 CCCGGAGTTCCTGTTTGTACAGG + Intronic
1114193715 14:20459689-20459711 CTCAGAGGTCCGGGATGCACAGG + Exonic
1115644364 14:35357603-35357625 CCCCGAGTAGCTGGAAGTACAGG + Intergenic
1115677684 14:35697603-35697625 CCCAAAGTTGCTGGGGGTACAGG + Intronic
1115720116 14:36151531-36151553 CCCACAGTTCTTGGATGTTCTGG + Intergenic
1115849044 14:37573512-37573534 CCCTGAGGTCCTGGCTGCACTGG - Intergenic
1115862058 14:37698529-37698551 CCCAGAGTACCTGGGAGTCCTGG + Intronic
1116148063 14:41100423-41100445 CCCAGAATTCCTGCATGTTTTGG + Intergenic
1116225645 14:42148547-42148569 CCCACAGTCCTTGGATGTTCTGG + Intergenic
1116723850 14:48535834-48535856 CCCATAGTTCTTGGATATTCTGG + Intergenic
1116876646 14:50118762-50118784 CCCAGAGTTCCTGTTCCTACTGG - Exonic
1117427511 14:55616033-55616055 CCCAGAGTAGCTGGAACTACAGG + Intronic
1117963796 14:61187427-61187449 CCCAGAGATCCTGGCTTTGCTGG + Intergenic
1119333194 14:73810758-73810780 TCCAGAGTTACTGGGGGTACAGG - Intergenic
1120338106 14:83184988-83185010 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1120403901 14:84070055-84070077 TCTAGAGTTCCAGGATTTACTGG + Intergenic
1121849203 14:97204028-97204050 CTCAGAATTCCTGGAGGGACAGG - Intergenic
1124098071 15:26667761-26667783 CCCAGAGTTTCTGAATAAACTGG - Intronic
1124435022 15:29640536-29640558 CCCAGAGTAGCTGGGTCTACAGG - Intergenic
1126064979 15:44819683-44819705 CCCAGAGCTCCTGGATCCAGCGG + Intergenic
1126098213 15:45104155-45104177 CCGAGAGTTCCTGGACATCCTGG - Exonic
1126106012 15:45147621-45147643 CCGAGAGTTCCTGGACATCCTGG + Exonic
1126398881 15:48248782-48248804 CCCAAAGTGCCAGGATGAACAGG - Intronic
1127430483 15:58902649-58902671 CCCAAAGTTCTAGGATTTACAGG + Intronic
1127753736 15:62069457-62069479 CCCAGAGTAGCTGGAACTACAGG - Exonic
1128275746 15:66352420-66352442 TCCCGAGTACCTGGAAGTACAGG + Intronic
1128498750 15:68212632-68212654 CCCAGAGTAGCTGGAACTACAGG + Intronic
1128545797 15:68566745-68566767 CCAAGGGTGCCTGGATATACAGG - Intergenic
1129160146 15:73742851-73742873 CCCAGAGTTTCTGGTTCTGCTGG + Intronic
1129480350 15:75820161-75820183 CCCTGGGTCCCTGGAGGTACAGG + Intergenic
1129553292 15:76476550-76476572 TCCAGAGTAGCTGGATCTACAGG + Intronic
1129583396 15:76836612-76836634 CCCAGAGTGCTGGGATTTACAGG - Intronic
1129889777 15:79064252-79064274 CCCAGAGGTGCAGGATGTAAGGG + Intronic
1130509151 15:84574052-84574074 CCCTGGGTCCCTGGAGGTACAGG - Intergenic
1130951465 15:88593555-88593577 TCCAGAGTTGCTGGAACTACAGG + Intergenic
1131216207 15:90537641-90537663 CCCAAAGTTCTGGGATTTACAGG + Intronic
1132721731 16:1319891-1319913 CCCAGACTGCCTGGCTGTGCTGG + Intronic
1134366533 16:13584189-13584211 CCCAGAGTTGCTGGGATTACAGG + Intergenic
1135200899 16:20436897-20436919 CCCAGAGTTCCCCAATGGACAGG - Intronic
1135218215 16:20590970-20590992 CCCAGAGTTCCCCAATGGACAGG + Intergenic
1135237007 16:20766600-20766622 TCCAGAGTACCTGGAATTACAGG - Intronic
1135243365 16:20830854-20830876 CCCAGAGTCCCTGGGTCTTCAGG - Intronic
1136022804 16:27450704-27450726 CCCAGAGTAGCTGGAATTACAGG + Exonic
1136120862 16:28133076-28133098 CCCAGAGTGCTGGGATTTACAGG - Intronic
1138574002 16:57895184-57895206 CCCAGAGTTGCTGGGATTACAGG - Intronic
1138647936 16:58438800-58438822 CCCAGAGTGCCTGCAGGGACTGG - Intergenic
1139507856 16:67408287-67408309 TCCAGAGTAGCTGGAAGTACAGG + Intronic
1139832872 16:69814282-69814304 TCCAGAGTTGCTGGAACTACAGG + Intronic
1139954606 16:70687108-70687130 CCAGGAGTTCCTGGATGAAAGGG - Intergenic
1140089410 16:71825388-71825410 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1142499665 17:325245-325267 CTCAGAGTTCCTGGAAGGCCTGG + Intronic
1144743564 17:17598120-17598142 CCCTGAGGTCCTGGATGGTCCGG + Intergenic
1144757618 17:17689427-17689449 GCCAGAGTTTCTGTATGTAAAGG + Intronic
1144802491 17:17939931-17939953 CCCAGAGTGCTAGGATTTACAGG - Intronic
1144852015 17:18248621-18248643 CCCAGAGTTCTGGGAGGCACTGG - Exonic
1145278206 17:21448728-21448750 CCCAGAGGCCCTGGATGTCTTGG + Intergenic
1147379655 17:40046341-40046363 CCCAAAGTTCCTGGGATTACAGG + Intronic
1148005079 17:44421215-44421237 CCCAGAGTAGCTGGAATTACAGG - Intronic
1151635444 17:75344649-75344671 CCCAAAGTGCCAGGATTTACAGG + Intronic
1151695392 17:75713537-75713559 CCCCGAGTACCTGGGAGTACAGG - Intergenic
1152933582 17:83123191-83123213 CCCAGGGTCCCAGGAAGTACCGG + Intergenic
1153519875 18:5941578-5941600 CCCAGGTATTCTGGATGTACAGG - Intergenic
1153750054 18:8220008-8220030 TCCTGAGTTCCTGGATGTGATGG - Intronic
1154109331 18:11552390-11552412 CCCTGAGTGCCTGGATCTGCTGG + Intergenic
1156230022 18:35144387-35144409 CCCAGAGTTCGTGGATTAAATGG - Intergenic
1160368481 18:78350045-78350067 CCCTGAATTCCTGGATCTAAAGG - Intergenic
1160825053 19:1075735-1075757 TCCTGAGTTCCTGGGTCTACAGG + Intronic
1161574002 19:5045730-5045752 CCCAAAGTGCCGGGATTTACAGG + Intronic
1161952244 19:7474213-7474235 CCCAGAGTAGCTGGAATTACAGG - Intergenic
1162448562 19:10739730-10739752 CCCAGAGTAGCTGGAATTACAGG - Intronic
1162756690 19:12865157-12865179 CCGAGAGTTCCTGGACAAACAGG + Exonic
1162874676 19:13612048-13612070 TCCAGAGTAGCTGGAAGTACAGG + Intronic
1163309158 19:16502493-16502515 CCCAAAGTGCCGGGATTTACAGG + Intronic
1165437006 19:35801204-35801226 CCCAGAGTTGCTGGGATTACAGG - Intronic
1166089594 19:40499654-40499676 CCCAGAGTGCCTGGGATTACAGG + Intronic
1166795365 19:45422511-45422533 CCCAAAGTGCTGGGATGTACAGG - Intronic
1166933085 19:46313361-46313383 CCCAAAGTTCTGGGATTTACAGG - Intronic
1166957594 19:46475260-46475282 CCCAGATGTCCTGGATGCAGAGG - Intergenic
1167891696 19:52545039-52545061 CCCAAAGTTCTGGGATTTACAGG + Intronic
1168307678 19:55444243-55444265 CCCAGAGTGCTGGGATTTACAGG - Intergenic
925267711 2:2578602-2578624 CTGAGAGTTCTTGGATGTTCTGG - Intergenic
927246008 2:20957790-20957812 CCCAGAGTTCCTGTGTGTTCAGG - Intergenic
927401763 2:22720498-22720520 CCCAGAATTCCTGCATGTGTGGG - Intergenic
927805813 2:26145618-26145640 CCAAGAGTTCCAGGATTTATAGG + Intergenic
928608088 2:32962847-32962869 CCCAGAGCTCCTGGTTTAACAGG - Intronic
929442709 2:41977838-41977860 CCCAAAGTGCCAGGATTTACAGG + Intergenic
929522102 2:42662986-42663008 CCCAGAGTTGCTGGGATTACAGG + Intronic
929845150 2:45517875-45517897 CCCAGAGTAGCTGGGAGTACAGG - Intronic
930190549 2:48454959-48454981 CCCAGAGTGGCTGGAAGTATAGG + Intronic
930340751 2:50111513-50111535 CCCAGAGTAGCTGGAATTACAGG - Intronic
930575149 2:53137906-53137928 CCCAGACTTGCTGGAAGTTCAGG - Intergenic
931569267 2:63650971-63650993 CCCAGTGGACTTGGATGTACAGG + Intronic
931641510 2:64384719-64384741 TCCAGAGTACCTGGAATTACAGG + Intergenic
932528486 2:72499649-72499671 CCCAGAGTGCCTGGGACTACAGG + Intronic
932543248 2:72679325-72679347 CCCAAAGTGCCAGGATTTACAGG + Intronic
932881238 2:75504151-75504173 CCCAAAGTGCTTGGATTTACAGG - Intronic
934762027 2:96861693-96861715 CCCTGAGTCCCTGGAGGTCCTGG + Intronic
935773150 2:106446306-106446328 CCCAGAGTGCTGGGATTTACAGG - Intronic
935906918 2:107849627-107849649 CCCAGAGTGCTGGGATTTACAGG + Intronic
936268254 2:111027924-111027946 CCCAAAGTTGCTGGAATTACAGG - Intronic
936464934 2:112739437-112739459 CCCTGATTTCCAGAATGTACTGG + Intronic
938593914 2:132767368-132767390 TCCAGAGTACCTGGAATTACAGG + Intronic
940047796 2:149428267-149428289 GCCAGAGTTCCTGGCTGCAAGGG + Intronic
941560413 2:167036780-167036802 CCCAGAATTCCTGCATGTTGTGG + Intronic
941592123 2:167432816-167432838 CCCAGAGTTCCTGCATACCCTGG + Intergenic
941636577 2:167941304-167941326 CCCAGAATTCCTGTATGTTGTGG - Intergenic
941804402 2:169695511-169695533 TCCAGAGTACCTGGAACTACAGG - Intronic
944243392 2:197507600-197507622 TCCAGAGTAGCTGGAAGTACAGG + Intronic
946324631 2:218978828-218978850 CCCAAAGTGCCTGGTTTTACAGG - Intergenic
946367605 2:219259021-219259043 CCCAGAGTGCTAGGATTTACAGG - Intronic
947165844 2:227261096-227261118 CCCGGAGTTCCTGGAAGTCCTGG + Exonic
948036743 2:234863852-234863874 CCCAGAAGTCCTGGAAGTCCTGG - Intergenic
948633288 2:239316338-239316360 CCCAGAGTGCTGGGATTTACAGG - Intronic
948836123 2:240626814-240626836 CCCAGAGTGCCTGGCTGGCCTGG - Intronic
949039628 2:241841906-241841928 CCCAGACTTCCTGGAAGAGCTGG + Intergenic
1170351191 20:15443233-15443255 CCCAGAGTTCCTAGGTACACAGG - Intronic
1172466264 20:35157048-35157070 CCCAAAGTGCCGGGATTTACAGG + Intergenic
1173156194 20:40612023-40612045 CCCAGAGTGCTGGGATTTACAGG - Intergenic
1175456012 20:59114807-59114829 CCCTGAGTACCTGGAACTACAGG - Intergenic
1177515206 21:22141124-22141146 TCCAGAGTAGCTGGATCTACAGG - Intergenic
1179018624 21:37617340-37617362 TCCAGAGTAGCTGGGTGTACAGG + Exonic
1179639629 21:42738807-42738829 CCCAGAGTAGCTGGAATTACAGG + Intronic
1181552200 22:23646623-23646645 TCCTGAGTTGCTGGATCTACAGG - Intergenic
1182593267 22:31398551-31398573 CACATAGTTCCTGGACGTCCTGG + Intergenic
1183085544 22:35484692-35484714 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1185374807 22:50477512-50477534 CCCAGAGTGCTGGGATTTACAGG - Intergenic
949346000 3:3077507-3077529 CCCAAAGTGCTTGGATTTACAGG - Intronic
949408135 3:3735782-3735804 TCCCGAGTACCTGGATTTACAGG - Intronic
951105020 3:18732338-18732360 TCCAGAGTACCTGGAACTACAGG - Intergenic
951627548 3:24682496-24682518 CCCAGAGTGCTGGGATTTACAGG - Intergenic
952559034 3:34568266-34568288 TCCAGAGTACCTGGAATTACAGG - Intergenic
953317490 3:41942393-41942415 CCCTGAGTTCCTGGAATTTCAGG - Intronic
953678162 3:45019351-45019373 TCCAGAGTACCTGGCTCTACAGG + Intronic
953974439 3:47371540-47371562 CCTAGAGTTCCTGGAGGGTCTGG + Intergenic
955018776 3:55098112-55098134 TCCTGAGTTCCTGGAAGAACAGG + Intergenic
955765541 3:62340591-62340613 CCCAAAGTGCCGGGATTTACAGG - Intergenic
957909124 3:86599021-86599043 TCCAGAGTTGCTGGGAGTACAGG + Intergenic
959915043 3:111807456-111807478 CCCAGAGTTGCTGGGATTACAGG - Intronic
959988465 3:112603389-112603411 CCCTGAGTAGCTGGATTTACAGG - Intergenic
960699800 3:120428608-120428630 TCCAGAGTAGCTGGATTTACAGG - Intronic
961192280 3:124971910-124971932 TCCTGAGTAGCTGGATGTACAGG + Intronic
962778107 3:138683228-138683250 CCCAGAGTAGCTGGAACTACAGG - Intronic
964111558 3:153093052-153093074 CCCAGAGTGCTGGGATTTACAGG + Intergenic
964573632 3:158139889-158139911 CCCAAAGTGCTTGGATTTACAGG + Intronic
965323139 3:167271621-167271643 CTCAGAGTTCATGGGTGTATAGG + Intronic
965937165 3:174128749-174128771 CCCAGCCTTCCTGAATGTCCAGG - Intronic
966645790 3:182245205-182245227 CCCACAGTTCCTGGAAGTGCTGG - Intergenic
966673023 3:182550475-182550497 CCCAGAGCTCCTGGATTTCTTGG - Intergenic
967655095 3:192038415-192038437 CCCATAGCACCTGTATGTACAGG + Intergenic
968422571 4:497945-497967 CCCAGAGTGCTGGGATTTACAGG - Intronic
968943680 4:3652534-3652556 CCCAGGGTTCTTGGGTGCACCGG + Intergenic
969044395 4:4326300-4326322 CCCAAAGTTCCAGGATGACCTGG + Intergenic
969738560 4:9007773-9007795 CCCAGAGTTTCTGGGAGTACAGG + Intergenic
970546820 4:17138038-17138060 CCCAGAGTCTCTGGATGGGCTGG + Intergenic
971663303 4:29448658-29448680 ATCAGAGTTCCTGGATTTATAGG + Intergenic
971698717 4:29939179-29939201 CCCAGAGTGCTGGGATTTACAGG + Intergenic
972495213 4:39628181-39628203 TCCAGAGTAGCTGGGTGTACAGG - Intronic
976609366 4:87013841-87013863 CCCAGAGATTCTGAATGGACAGG + Intronic
976787310 4:88836698-88836720 CCCAAAGTTCTGGGATTTACAGG - Intronic
981950333 4:150398884-150398906 CCCAGAGTGCCGGGATTTACAGG + Intronic
982066957 4:151662661-151662683 CCCAGAGTTCCTGAAGGAGCTGG + Exonic
982111711 4:152062746-152062768 CCCCGAGTACCTGGAATTACAGG + Intergenic
982185871 4:152798124-152798146 CCCAGAGTAGCTGGAATTACAGG - Intronic
985949038 5:3209243-3209265 CCCAGAATTCCTGCATGTTGTGG - Intergenic
987080192 5:14419100-14419122 CCCAGAGGTCCTGGATTTTCTGG - Intronic
989573174 5:42964399-42964421 CCAAGAGTTCCTGGTTTTCCTGG + Intergenic
990368434 5:55093211-55093233 CCCAGTGGTCTTGGATTTACGGG - Intergenic
991180029 5:63739584-63739606 CCCAGAGTTACTGAATCTAGAGG + Intergenic
991620807 5:68543820-68543842 CCCAGAGTAGCTGGAATTACAGG + Intergenic
995218431 5:109621541-109621563 CCCTGAGTAGCTGGATTTACAGG + Intergenic
995259162 5:110081803-110081825 CCCTGAATCCCTGGAGGTACGGG + Intergenic
997315860 5:132935187-132935209 CCCAGAGTAGCTGGGAGTACAGG - Intronic
997761652 5:136454360-136454382 ATCACAGTTCCTAGATGTACAGG - Intergenic
998540764 5:142979445-142979467 CCCATAGTCTCTGGATGCACAGG - Intronic
1000797330 5:165681210-165681232 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1000965141 5:167647361-167647383 CCCAAAGTTCTGGGATTTACAGG - Intronic
1001005142 5:168043143-168043165 TCAAGAGATCCTGGATGCACTGG - Intronic
1001296832 5:170504366-170504388 CCCTGAGTCCCTGCATGTGCGGG + Intronic
1001452212 5:171835555-171835577 TCCAGAGTACCTGGGAGTACAGG - Intergenic
1002032054 5:176437497-176437519 CCCAGAGTGCTGGGATTTACAGG - Intergenic
1003283374 6:4713019-4713041 TCCCAAGTTCCTGGATCTACAGG - Intronic
1004062094 6:12207643-12207665 CCCAAAGTTCTCGGATTTACAGG - Intergenic
1005931503 6:30488382-30488404 TCCAGAGTTGCTGGAATTACAGG + Intergenic
1006003642 6:30986300-30986322 CCCAGAGTTGGTGGCTGTGCTGG - Exonic
1006003822 6:30987245-30987267 CCCAGAGTTGGTGGCTGTGCTGG - Exonic
1012454191 6:99386304-99386326 TCCAGAGTTACTGGAATTACAGG - Intronic
1014485563 6:121994769-121994791 CCCAGAAACCCTGGATGTGCAGG - Intergenic
1015230390 6:130908393-130908415 GACACTGTTCCTGGATGTACTGG - Intronic
1015471828 6:133614640-133614662 CCCAGGGTCCCTGGTGGTACAGG - Intergenic
1015781267 6:136868811-136868833 CCCAGAGGTCCTGGCTGAATAGG - Intronic
1016128498 6:140435689-140435711 CTCACAGTTCTTGGATGTTCTGG + Intergenic
1017632266 6:156407990-156408012 CCCAGACTTCCTGATTGTCCTGG + Intergenic
1017643772 6:156519376-156519398 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1017909732 6:158782504-158782526 CCCAGAGTTCCTGGATGTACCGG - Intronic
1018271317 6:162081451-162081473 ACCAGAGTTCCTGGGTGACCAGG + Intronic
1018288401 6:162265039-162265061 CCCAGAATTCTTGTATGTATTGG - Intronic
1019652635 7:2168745-2168767 CCCAGAGCTCCTTGGTGTTCCGG - Intronic
1020160916 7:5770929-5770951 TCCAGAGTTGCTGGAATTACAGG + Intronic
1026055366 7:66979091-66979113 TCCAGAGTTGCTGGAACTACAGG - Intergenic
1026299942 7:69089222-69089244 CTCAGAGTTCCTGGGTTTTCTGG - Intergenic
1026722334 7:72842736-72842758 TCCAGAGTTGCTGGAACTACAGG + Intergenic
1027345024 7:77250793-77250815 CCCAGAGTTCTTGGATATTCTGG + Intronic
1027660767 7:80985786-80985808 CCCAAAGTTCTTGGAATTACAGG + Intergenic
1028318435 7:89433398-89433420 CTCAGATTTTCTGGATCTACAGG - Intergenic
1029058409 7:97771282-97771304 CCCAGAGTCCCTGGTTTTTCAGG - Intergenic
1030048275 7:105516711-105516733 CCCAAAGTTCCTGGGATTACAGG + Intronic
1030113928 7:106049210-106049232 CCCAGAATTCCTGAAAGTGCTGG + Intergenic
1030286601 7:107833321-107833343 TCCAGAGTTCCTGGGACTACAGG + Intergenic
1030898306 7:115089072-115089094 TCCAGAGTTGTTGGATGAACAGG + Intergenic
1035118183 7:156542668-156542690 CCCAGAGTAGCTGGGGGTACAGG - Intergenic
1035550358 8:518903-518925 CACAGAGTTCCTGAAAGTATTGG + Intronic
1038045307 8:23761157-23761179 TCCAGAATTGCTGGATGTTCTGG + Intergenic
1038199509 8:25398977-25398999 CCAAGAGCTCCTGGAACTACAGG - Intronic
1039547130 8:38418338-38418360 CCCAGAGTTCATGGATGCACTGG + Exonic
1041400139 8:57433988-57434010 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1042565419 8:70105434-70105456 CCAGGAGTTCGTGGATGTAGTGG + Intergenic
1047868890 8:129060525-129060547 CCAAGAGTACCTGGGTCTACAGG + Intergenic
1049202850 8:141350317-141350339 CCAAGAGTTCCTGGGGGAACAGG - Intergenic
1049529312 8:143146604-143146626 CCCAGAGTTCGAGGATGTTGGGG - Intergenic
1049611001 8:143555295-143555317 CCCAGAGCTCTTGGAGGTAAAGG + Intronic
1052919335 9:33951274-33951296 CCCAAAGTTCTGGGATTTACAGG + Intronic
1053298176 9:36929983-36930005 CCCAGAGTGCTGGGATTTACAGG + Intronic
1055049044 9:71961169-71961191 CCCAGAGTGCTGGGATTTACAGG + Intronic
1055417227 9:76096858-76096880 CCCAAAGTTCTGGGATTTACAGG + Intronic
1055489300 9:76788460-76788482 GCCAGAGTTCCTGGATTGAAAGG + Intronic
1056741262 9:89257442-89257464 CTCAGAATCCCTGGATGTTCTGG - Intergenic
1057265601 9:93615620-93615642 CCCAGGGTTTCTGCATGCACTGG + Intronic
1060652230 9:125338131-125338153 CCCAGAGTTGCTGGGATTACAGG + Intronic
1060910480 9:127345942-127345964 CCCAGAGTTTCTGATTGAACAGG + Intronic
1061669114 9:132178679-132178701 CCCAGAGTGCTAGGATTTACAGG - Intronic
1062077306 9:134597759-134597781 CCCCGTGCTCCTGGATGGACAGG - Intergenic
1062103147 9:134738752-134738774 CCCATGGTTCCTGGAGGTCCGGG - Exonic
1062330441 9:136040835-136040857 CCCAGAGTAGCTGGAACTACAGG - Intronic
1186116110 X:6306681-6306703 CCCCGAGTACCTGGAACTACAGG - Intergenic
1187258820 X:17666510-17666532 CCCAGAGGAGCTGGATGTCCAGG - Intronic
1187343757 X:18444573-18444595 CCCAAAGTGCTGGGATGTACAGG + Intronic
1188822060 X:34787489-34787511 CTCAGAGTTCTTGGATGACCAGG + Intergenic
1189508457 X:41637210-41637232 CCCAGAGTGCTGGGATTTACAGG + Intronic
1189734998 X:44060874-44060896 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1189814809 X:44814030-44814052 CCCAGAGTACCTGGGACTACAGG + Intergenic
1189972795 X:46434946-46434968 CCCTGAGCTCCTGAATGTAGAGG - Intergenic
1190401300 X:50037974-50037996 CTCAGAGTTCCTGGAAGAAATGG + Intronic
1191920362 X:66249758-66249780 CCCAGAGTTTCTGAATCTTCAGG + Intronic
1193845559 X:86466298-86466320 CCCACAGTTCCTGCATGTTGTGG - Intronic
1195040694 X:101011487-101011509 CCCAGAGTAGCTAGAAGTACAGG - Intronic
1195115479 X:101694187-101694209 CCCAGTGCTCCTGGATGGAGAGG + Intergenic
1196123114 X:112071186-112071208 CCCCGAGTAGCTGGAGGTACAGG - Intronic
1196203173 X:112909145-112909167 CCCAGAGTGCTGGGATTTACAGG + Intergenic
1196456666 X:115895894-115895916 CCCAGGCATCCTGGATGTCCAGG + Intergenic
1196515013 X:116600153-116600175 CCCACACTTCCTGGGTGTAATGG + Intergenic
1201940011 Y:19449139-19449161 CTCAGGGTTCATGGATGTACAGG + Intergenic