ID: 1017909734

View in Genome Browser
Species Human (GRCh38)
Location 6:158782513-158782535
Sequence GCAGAGTGGCCCAGAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017909734_1017909741 17 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909741 6:158782553-158782575 GGAACCCAGGCCAAAAGGCAGGG No data
1017909734_1017909739 12 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909739 6:158782548-158782570 AAGCAGGAACCCAGGCCAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 245
1017909734_1017909738 4 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909738 6:158782540-158782562 TACGTGGAAAGCAGGAACCCAGG No data
1017909734_1017909737 -4 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909737 6:158782532-158782554 CTGCTCTTTACGTGGAAAGCAGG No data
1017909734_1017909744 22 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909744 6:158782558-158782580 CCAGGCCAAAAGGCAGGGCTTGG No data
1017909734_1017909740 16 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909740 6:158782552-158782574 AGGAACCCAGGCCAAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017909734 Original CRISPR GCAGAGTGGCCCAGAGTTCC TGG (reversed) Intronic
900243372 1:1627111-1627133 GAAGAGTGACCCAGAGCACCCGG + Exonic
900987731 1:6082990-6083012 GCAGCGGGGCCCAGAGCACCCGG + Intronic
903031377 1:20466467-20466489 GCAACGTGGCCCAGAGTGACAGG - Intergenic
903158822 1:21469846-21469868 GGAGACAGGCCCAGAGTCCCTGG - Intronic
903293318 1:22328498-22328520 CCCAACTGGCCCAGAGTTCCTGG + Intergenic
905321188 1:37118614-37118636 ACAGTGTGGCCCAGGGTCCCAGG + Intergenic
906645918 1:47474802-47474824 GCAGCCTCGCCCAGAATTCCTGG + Intergenic
907547896 1:55278065-55278087 GCAGAGTGGCTGGGAGTCCCAGG + Intergenic
910328295 1:86037444-86037466 GCAGAGTCACCCACAGTTTCTGG - Intronic
912553880 1:110502047-110502069 GCAGAGAGGCCGAGAGCTCTAGG + Intergenic
912798048 1:112704785-112704807 GCTGAGTGACCCAGTGTTGCTGG - Intronic
913683822 1:121213007-121213029 TCAGAGAGGCCAAGAGTTCAAGG - Intronic
914035661 1:144000623-144000645 TCAGAGAGGCCAAGAGTTCAAGG - Intergenic
916056643 1:161073009-161073031 GCATAGGGGCCCAGAGATCGGGG + Intronic
917868216 1:179218114-179218136 GCAGATTGGGCTACAGTTCCTGG - Intronic
919933308 1:202235691-202235713 GCAGGGAGGCCCAGTGTTCAGGG - Intronic
920471128 1:206231503-206231525 TCAGAGAGGCCAAGAGTTCAAGG - Intronic
921031970 1:211341709-211341731 GGAGAATGGGCCAGAGCTCCAGG + Intronic
921608247 1:217179953-217179975 GCAGAATTGCCCATAGCTCCTGG + Intergenic
922802538 1:228370959-228370981 GCAGAGGACCCCAGAGCTCCTGG + Intronic
922963675 1:229669134-229669156 GCAGAATGGCCATGAGCTCCTGG - Intergenic
1066311478 10:34201134-34201156 TCAGAGTGGCCCATAGTACATGG - Intronic
1069587456 10:69617839-69617861 ACAGAGCAGCCCACAGTTCCAGG - Intergenic
1069629331 10:69888372-69888394 GCAGAATGACCAAGAGATCCAGG - Intronic
1069722284 10:70557451-70557473 GCAGAGTGGCCCACGGCACCAGG + Intronic
1069834313 10:71299157-71299179 GCAGAGCTTCCCAGAGGTCCAGG - Exonic
1071458107 10:85866930-85866952 GCATAGTGTCCCAGGGTTCCTGG + Intronic
1071514923 10:86291068-86291090 GCAGAGCAGCGCAGACTTCCAGG - Intronic
1075625824 10:123963980-123964002 TCAGAGAAGCCCAGTGTTCCAGG - Intergenic
1076512904 10:131025053-131025075 GCAGGGAGACCCAGAGATCCAGG + Intergenic
1076921716 10:133457745-133457767 GCAGAGTGGAGCTGAGTTTCTGG + Intergenic
1078321600 11:10339867-10339889 GCAGAGTGTACCAGTTTTCCAGG - Intronic
1078668662 11:13346299-13346321 GCAGAGTGGATCAGTGTTCCAGG - Intronic
1078856248 11:15208321-15208343 GCAGAGAGGCCCAGGGTCCCAGG + Intronic
1083291467 11:61692682-61692704 GCAGAGTGGCTCTGGGGTCCTGG - Intronic
1083897962 11:65629713-65629735 GCTGCGTGGCCTTGAGTTCCGGG + Exonic
1084422448 11:69067107-69067129 GCAGAGGGGCCCAGGCTGCCAGG - Intronic
1085273820 11:75285669-75285691 GCACAGTGCCCCAGAGTTCTCGG + Intronic
1085509592 11:77081587-77081609 TCACAGTGGCCCAGAGGCCCTGG + Intronic
1090238099 11:125164422-125164444 GGAGGGTGCTCCAGAGTTCCTGG + Intergenic
1091666022 12:2419087-2419109 GCAGAGAGGCCTAGGGTTGCAGG - Intronic
1091859954 12:3772122-3772144 GCACACTGTCCCAGAGATCCTGG - Intergenic
1093412892 12:18887589-18887611 GCAGAGTGTTGCCGAGTTCCTGG - Intergenic
1094481299 12:30884373-30884395 GCAGAGAGGCCCCAAATTCCAGG - Intergenic
1096797973 12:54090560-54090582 GCAGTCTGGCCCAGCGTCCCGGG - Intergenic
1098514572 12:71358868-71358890 GCAGAGTTGCCCACAGAACCAGG - Intronic
1099951796 12:89312025-89312047 GAAGAATTGCCCAGAGATCCAGG - Intergenic
1100277740 12:93086710-93086732 AAAGAGAGGCCCAGAGTTTCAGG - Intergenic
1102202538 12:111067624-111067646 ATGGAGTGGCCAAGAGTTCCCGG - Intronic
1103895799 12:124272394-124272416 GCAGAGTGGCCCAGAGGGGCAGG + Intronic
1104375859 12:128265745-128265767 CCAGCCTGGCCCAGACTTCCGGG + Intergenic
1105292017 13:19059265-19059287 ACAGGGTGGCCCAGGGTACCTGG - Intergenic
1106021096 13:25916252-25916274 GCTGAGTGGCGCAGAGGGCCTGG - Intronic
1107836744 13:44417727-44417749 GCAGAGGGGCCCAACGGTCCAGG + Intergenic
1107992960 13:45834518-45834540 GCAGAGAGGCCTCGGGTTCCAGG + Intronic
1112653656 13:101425327-101425349 CCAGAGTTCCCCAGAGGTCCAGG + Intergenic
1113588610 13:111482825-111482847 GCAGCCTGGCCCAGGGTTCCAGG - Intergenic
1113940050 13:114014338-114014360 GCCGAGGGGCCCAGGGTTCTGGG - Intronic
1114832741 14:26164487-26164509 GCAGACTTGCCCGGACTTCCTGG + Intergenic
1116048010 14:39768147-39768169 GAAGAGTAGCACAGTGTTCCTGG - Intergenic
1116510771 14:45743891-45743913 GCATAGTGGCCCAGAGTTTGGGG - Intergenic
1119774887 14:77242254-77242276 CCATAGTGGCCCTGAGCTCCTGG + Intronic
1121884962 14:97534598-97534620 GGAGAGTGGCCCAAGGTTTCAGG - Intergenic
1122455822 14:101850187-101850209 TCAGCGTTGCCCAGAGGTCCTGG + Intronic
1123473499 15:20571338-20571360 GCCGAGTGTCCCAGAGGACCTGG + Intergenic
1123644510 15:22429015-22429037 GCCGAGTGTCCCAGAGGACCTGG - Intergenic
1123665826 15:22608923-22608945 GCCGAGTGTCCCAGAGGACCTGG - Intergenic
1123733797 15:23166349-23166371 GCCGAGTGTCCCAGAGGACCTGG + Intergenic
1124319649 15:28703336-28703358 GCCGAGTGTCCCAGAGGACCCGG - Exonic
1124482862 15:30092094-30092116 GCCGAGTGTCCCAGAGGACCCGG + Exonic
1124489316 15:30144165-30144187 GCCGAGTGTCCCAGAGGACCTGG + Exonic
1124520714 15:30405124-30405146 GCCGAGTGTCCCAGAGGACCCGG - Exonic
1124537945 15:30561095-30561117 GCCGAGTGTCCCAGAGGACCTGG + Exonic
1124544405 15:30613156-30613178 GCCGAGTGTCCCAGAGGACCCGG + Exonic
1124564367 15:30800592-30800614 GCCGAGTGTCCCAGAGGACCTGG + Intergenic
1124754213 15:32394162-32394184 GCCGAGTGTCCCAGAGGACCTGG - Exonic
1124760707 15:32446491-32446513 GCCGAGTGTCCCAGAGGACCCGG - Exonic
1124777926 15:32602572-32602594 GCCGAGTGTCCCAGAGGACCTGG + Exonic
1125267373 15:37898672-37898694 GCAGAGAAGCCCAGATTACCTGG + Intergenic
1127698585 15:61475172-61475194 CCAGAGTGGCCCTGAGTGGCTGG + Intergenic
1129071211 15:72952998-72953020 GCAGAGCTGCCCTGAGATCCTGG - Intergenic
1129150016 15:73682709-73682731 GTGGAATGGTCCAGAGTTCCTGG + Intergenic
1130013931 15:80173274-80173296 GCAGAGTGCCTGGGAGTTCCTGG + Intronic
1131558358 15:93418469-93418491 GCAGAGTGGGGCTGACTTCCTGG + Intergenic
1132556922 16:576583-576605 GCAGAGGGCCCCAGAGAGCCAGG - Intronic
1132729799 16:1355783-1355805 GTAGAGTGGCCCCGGGATCCTGG + Intronic
1134179920 16:12039277-12039299 GCAGAATCGCCCAGGGTTACTGG - Intronic
1135067585 16:19323559-19323581 GCAGCCAGGCCCACAGTTCCTGG - Intergenic
1135306665 16:21373044-21373066 GCAGAATCGCCCAGGGTTACTGG - Intergenic
1136117671 16:28105238-28105260 GGAGACTGGCCCAGAGAGCCTGG - Intronic
1136227895 16:28871412-28871434 CCAGGTTGGCCCTGAGTTCCTGG - Intronic
1136556711 16:31011258-31011280 GCAGATGGGCCAAGAGGTCCTGG - Intergenic
1137426838 16:48386845-48386867 GCAGAGCGGCCCAGGGGTTCTGG - Intronic
1139612938 16:68071968-68071990 TCAGAGTCCCACAGAGTTCCAGG - Intronic
1141990402 16:87605997-87606019 GAAAAGTGGCCCAGATGTCCAGG - Intronic
1141990583 16:87607117-87607139 GTACAGTGGCCCAGAATTGCAGG + Intronic
1144795276 17:17887102-17887124 GCAGAGTCTCCCAGAAGTCCAGG - Intronic
1146274759 17:31509613-31509635 CCAGAGTGGCTCAGAGGCCCCGG - Intronic
1147170121 17:38613452-38613474 GCAGAGTGGGGAGGAGTTCCAGG + Intergenic
1147568605 17:41552984-41553006 GCTGTGTGGCCCAGAGTCCCTGG + Intergenic
1147657028 17:42096880-42096902 CCAGAGAGGTCCAGAGATCCAGG + Intergenic
1148381067 17:47198136-47198158 TCAGAGTTGCCCAGACTCCCTGG - Intergenic
1151050567 17:70973775-70973797 GCAAGGTGGCCCAGATTTGCAGG + Intergenic
1151441114 17:74129751-74129773 GCAGAGTGGCCAGGGGCTCCTGG + Intergenic
1151750311 17:76033385-76033407 GCAGAGAGGCCCAGAGCCCTTGG - Intergenic
1151945816 17:77319370-77319392 CCAGTGGGGCCCCGAGTTCCCGG + Intronic
1152768961 17:82156001-82156023 GCACAGTGGCCCACTGTGCCTGG - Intronic
1153024389 18:659495-659517 GCAAAGTGGGCCAGAGATCACGG - Intronic
1153756604 18:8290016-8290038 GCAGAGTGCCCCAGAAGTTCAGG - Intronic
1154382910 18:13868856-13868878 TGAGAGTGTCCCAGTGTTCCGGG - Intergenic
1157477739 18:48034288-48034310 GCAGAGTTGCCCAGAGTGTGGGG - Intronic
1159115078 18:64104836-64104858 GCAGCCTGGGCCAGATTTCCTGG - Intergenic
1160903596 19:1441339-1441361 GCAGAGTGGCCCAGGGATGTGGG + Intergenic
1162789998 19:13057859-13057881 GCAGAGAGGCCCAGGCTTCCAGG - Intronic
1163389348 19:17020955-17020977 GCAGATTGGCTCAGAGTCCCAGG - Intronic
1165022181 19:32934271-32934293 GTACAGAGGCCCAGAGTCCCAGG + Intronic
1166345085 19:42160530-42160552 GCTGACTGGACCTGAGTTCCAGG - Intronic
1166697305 19:44859443-44859465 ACTGAGTGGCCCATAGTTCATGG - Intronic
1166726643 19:45032482-45032504 GCACAGTGGTCCAGATGTCCTGG + Intronic
1167426460 19:49432277-49432299 GCAGGGTGGGCGAGACTTCCCGG - Intronic
925839281 2:7976128-7976150 GCAGAGTGGAGGAGAGGTCCTGG + Intergenic
925943262 2:8839358-8839380 GGAGGGTGGCCCAAAGTTCCAGG + Intergenic
926219059 2:10923077-10923099 TCAGTGTGGCTCAGATTTCCTGG - Intergenic
927453807 2:23232092-23232114 GGAGATGGGCCCAGAGTTCAGGG + Intergenic
929757466 2:44779250-44779272 GCAGAGTGGCCCAGCGTGGGCGG - Intergenic
931573841 2:63698920-63698942 GGAAAATGACCCAGAGTTCCTGG + Intronic
931786097 2:65620674-65620696 GCAGAGGGGAGTAGAGTTCCAGG + Intergenic
936526826 2:113247043-113247065 GCAGAGGGGCCCACAGGGCCTGG - Intronic
936901819 2:117489636-117489658 GAAGAGTTGCCCAGAGTTGATGG - Intergenic
937294863 2:120803980-120804002 GCAGAGCGCTCCAGTGTTCCAGG + Intronic
937453454 2:122021693-122021715 GCAGCGTGGCCCAGAGAGCTTGG + Intergenic
938089964 2:128425000-128425022 GAGGAGTGGCCCAGAGCACCGGG + Intergenic
938119449 2:128623446-128623468 GCAGAGTGGGCCAGGGGTCGGGG + Intergenic
938787818 2:134648457-134648479 TCACAGTGGGCCACAGTTCCAGG + Intronic
938949384 2:136242972-136242994 GCAGTGTGGCCCAGAGTTGCTGG - Intergenic
938960125 2:136333220-136333242 ACAGGGTGTCCCAGTGTTCCAGG + Intergenic
944525069 2:200610796-200610818 ACAGAGTAGCCCAGAGTTTCAGG - Intronic
946445931 2:219740027-219740049 TCAGAGTGGCCCAGAGAGCTGGG + Intergenic
947447144 2:230172714-230172736 CCAGAGAGGCCCAGAGTCTCTGG + Intronic
948387816 2:237592573-237592595 GCAGAGAGGCCCTGAGGGCCAGG + Intronic
948461269 2:238131050-238131072 GGAGGGTGGCCCAGGGCTCCTGG - Exonic
948877804 2:240839486-240839508 GCAGTGTGGCCTGGAGTTCCAGG + Intergenic
948988577 2:241540634-241540656 GGAGGGTGGCCCGGGGTTCCAGG + Intergenic
1169187774 20:3633183-3633205 GCAGAGAGGCCCAGAGATGAAGG + Intronic
1172855084 20:37995522-37995544 TCAGAGCGGCACAGAGTGCCAGG + Intronic
1173989129 20:47286805-47286827 GGAGAGTGGCCCAGGTGTCCAGG - Intronic
1174702532 20:52623634-52623656 CCAGGGTGGCCCCGAATTCCTGG - Intergenic
1175188071 20:57193017-57193039 GTAGAGGGGCCCAGAGGTCATGG + Intronic
1175374053 20:58512912-58512934 GCAGAGAAGCCAAGAGTGCCCGG - Intronic
1175543626 20:59763785-59763807 GCAGAGGTGGCCAGAGCTCCAGG + Intronic
1176121060 20:63454790-63454812 GGAGTGTGTCCCAGTGTTCCCGG - Intronic
1176170208 20:63693328-63693350 GCAGTGTGGGCCAGAGTCCTGGG + Intronic
1176604172 21:8815466-8815488 GCAGAGAGGCCCACAGCGCCGGG - Intergenic
1178893827 21:36542719-36542741 GCAGAGTCCCCCAGCGCTCCGGG - Intronic
1180346463 22:11707073-11707095 GCAGAGAGGCCCACAGCGCCGGG - Intergenic
1180958547 22:19751884-19751906 GCAGAAGGGCCCAGAGTACAGGG + Intergenic
1181009008 22:20029338-20029360 GCAGATGGGCCCAGAGTGCCTGG + Intronic
1181366116 22:22378319-22378341 GCAGTGTGACCCAGAAGTCCAGG + Intergenic
1181397017 22:22629866-22629888 GCAGTGGGGCCCTGGGTTCCAGG + Intergenic
1181499762 22:23309225-23309247 GCAGTGGGGCCCTGGGTTCCAGG + Intronic
1181805153 22:25370106-25370128 CCTGTGTGGCTCAGAGTTCCAGG - Intronic
1182072991 22:27476472-27476494 GCAGAGAGGGTCAGAGATCCAGG + Intergenic
1182272855 22:29166480-29166502 GTAAAGTGGGCCAGAGTTCGAGG - Intronic
1182796152 22:32993145-32993167 GTAGAGGGGCCCAGGGATCCAGG + Intronic
1184336625 22:43857325-43857347 TCAGACTGGCCTAGAATTCCTGG - Intronic
1184493203 22:44822305-44822327 GCAGAGAGGCCGAGGGTTGCAGG - Intronic
949571178 3:5294615-5294637 GTAGAGTAGCCCGGAGTTCCTGG - Intergenic
950005071 3:9686308-9686330 GTAGAATGTCCCAGAGCTCCGGG - Intronic
950441843 3:13015097-13015119 ACACAGTGGCCCAGGGCTCCTGG - Intronic
950495943 3:13334730-13334752 GCAGAGGGGCCCAGAGGGGCAGG + Intronic
950543456 3:13625598-13625620 GAAGAGGGGCCCAGAGCTTCTGG - Intronic
950672313 3:14534725-14534747 GCAGCGTGGGCCTGAGTACCAGG - Intronic
953607844 3:44423609-44423631 GAAGAGTCGCCCAGACTTGCAGG - Intergenic
954583996 3:51718806-51718828 GCAGACTGGCCCAGGCATCCTGG + Intergenic
956027031 3:64993953-64993975 GCAGACTGCCTCTGAGTTCCGGG - Intergenic
961881081 3:130061681-130061703 GAAGCTTGGGCCAGAGTTCCAGG - Intergenic
964710728 3:159668617-159668639 TCAGAGAGGCCCAGTGTGCCAGG - Intronic
965477999 3:169181690-169181712 ACAGTGTGACCCAGAGGTCCTGG + Intronic
968094755 3:195921039-195921061 GCACAGCTGCCCAGAGCTCCTGG + Intergenic
968591444 4:1461694-1461716 GCAGAGTGGCCCACAGTGCCCGG + Intergenic
968604118 4:1523541-1523563 GGAGATTGGCCCAGAGGGCCTGG - Intergenic
969668935 4:8579084-8579106 GCAGAGTGGCCCACTCTTCCTGG + Intronic
973373942 4:49275454-49275476 GCAGAGAGGCCCACAGCGCCGGG + Intergenic
973373950 4:49275483-49275505 GCAGAGAGGCCCACAGCGCCGGG + Intergenic
973383462 4:49334756-49334778 GCAGAGAGGCCCACAGCGCCGGG - Intergenic
973383470 4:49334785-49334807 GCAGAGAGGCCCACAGCGCCGGG - Intergenic
973387075 4:49519799-49519821 GCAGAGAGGCCCACAGCGCCGGG - Intergenic
981634790 4:146864260-146864282 GAAGATGGGCCCTGAGTTCCTGG - Intronic
984811472 4:183798749-183798771 GCAGAGTCGCCCAGAGGTGAAGG + Intergenic
986329674 5:6708408-6708430 GCATGGTGGCCCAGTGTCCCAGG - Intergenic
986337354 5:6765713-6765735 GCACGGTGGCCCAGGGTTCGTGG + Intergenic
992037669 5:72797160-72797182 CCAGACTGGTCTAGAGTTCCTGG - Intergenic
993718294 5:91296828-91296850 GTGGAGTGGCCCAGCATTCCAGG - Intergenic
994649136 5:102504667-102504689 GCAGAGTTGCCCAAAGTTGTGGG + Intergenic
995627026 5:114091137-114091159 GCTGTGTGCCCTAGAGTTCCAGG + Intergenic
996096062 5:119400439-119400461 ACAGGGAGGCCCAGAGCTCCAGG + Intergenic
996343011 5:122458682-122458704 GCAGAGTGGCCCGGCCATCCAGG - Intronic
996971104 5:129369021-129369043 ACAGTGTGGCCCAGAGCCCCAGG - Intergenic
997718791 5:136061934-136061956 GAAGAGTGACCCAGAGGCCCCGG - Intronic
998135391 5:139671634-139671656 GCAGGCTGGGCCAGAGCTCCGGG - Intronic
998382580 5:141736170-141736192 GCAAATTGGCCCAGACATCCTGG + Intergenic
1000230861 5:159313937-159313959 GCAGAGTGGCATAGGGCTCCAGG + Intergenic
1002474211 5:179454673-179454695 GCGGAGTGGGGAAGAGTTCCCGG - Intergenic
1004918055 6:20350539-20350561 GCTCAGTGGCCCAGAGTTTCAGG - Intergenic
1007621087 6:43215112-43215134 ACAGTGTGGCCCAGGGTTCCAGG - Exonic
1007761550 6:44136265-44136287 GCTGAGTGCTCCAGAGCTCCAGG - Intronic
1010698871 6:79016045-79016067 GCAGCATGGCACAGAATTCCTGG - Intronic
1015210136 6:130687414-130687436 GCAGAGTGGTTCAGAGTTTGGGG + Intergenic
1015375512 6:132505395-132505417 TCAAAGTGCACCAGAGTTCCAGG - Intronic
1016809334 6:148244516-148244538 AGAGAGTGGGCCAGTGTTCCTGG + Intergenic
1017909734 6:158782513-158782535 GCAGAGTGGCCCAGAGTTCCTGG - Intronic
1019441597 7:1050228-1050250 GCACAGTGGCCCAAAGTCACAGG + Intronic
1023670879 7:42575340-42575362 GCAGAGTGGCCCCGAGGGCCAGG + Intergenic
1024958058 7:54946876-54946898 GAGGTGTGGCCCAGTGTTCCAGG + Intergenic
1024963373 7:55001764-55001786 GCAGAGTGTCTGAGAGTGCCAGG - Intergenic
1026277025 7:68888960-68888982 GTAGAGTGGCCTAGAGTTGAAGG + Intergenic
1027639054 7:80711841-80711863 GCAGTCAGGCCCAGAATTCCTGG + Intergenic
1029963944 7:104718488-104718510 TCAGACTGGCACAGAATTCCTGG + Intronic
1030751465 7:113236884-113236906 GAACATTGGGCCAGAGTTCCAGG + Intergenic
1033074438 7:138235263-138235285 CCAAAATGGCTCAGAGTTCCTGG + Intergenic
1034841713 7:154403655-154403677 GAAGAGTGGGCCAGAGTGCCAGG + Intronic
1036503483 8:9334646-9334668 GTAGAGGGGCCCAGGATTCCGGG + Intergenic
1039427389 8:37496830-37496852 GCTGAGCAGGCCAGAGTTCCTGG - Intergenic
1039871535 8:41549969-41549991 ACAAAGTGGCTCTGAGTTCCTGG - Intergenic
1040388856 8:46932929-46932951 ACAGAGGGGCCCAGAGCCCCAGG + Intergenic
1042272509 8:66969578-66969600 GCAGAGTGGCTCAGGCTTGCTGG - Intronic
1042960972 8:74303403-74303425 TCAGAGTGGCTCCAAGTTCCTGG - Intronic
1044015320 8:87043575-87043597 GCTGAGGGAACCAGAGTTCCAGG - Intronic
1044382584 8:91551791-91551813 GCAGAGTGGTCCACAGTTTGAGG - Intergenic
1047938312 8:129803126-129803148 GGAGAAAGGCCCAGACTTCCTGG - Intergenic
1049188230 8:141270691-141270713 GCAGACTCGCCCAGACCTCCAGG + Intronic
1049472795 8:142783785-142783807 GCACAGTGGCCCTGGGTCCCAGG + Intergenic
1049554599 8:143275665-143275687 GCAGGGTGACCCAGAGCTGCTGG - Intronic
1049558002 8:143293082-143293104 ACAGTCGGGCCCAGAGTTCCAGG + Intronic
1049807171 8:144546322-144546344 GCAGAGAGGCCCAGGGTGCATGG - Intronic
1053165672 9:35842067-35842089 GGACAGTGTCCCAGAGGTCCTGG - Intronic
1057476837 9:95410319-95410341 GCAGGGAGGGCCAGAGCTCCTGG + Intergenic
1059396512 9:114037459-114037481 GCAGAGTGGCCAACTGTCCCGGG - Intronic
1061314711 9:129787720-129787742 TGATAGTGGCCCAGAGTTCAAGG + Intergenic
1061726054 9:132582627-132582649 GGAGGTTGGCCCAGAGCTCCCGG + Exonic
1061792703 9:133066887-133066909 GCGGCGTGGCCCTGAGTCCCTGG + Exonic
1062360350 9:136185324-136185346 GCCGAGTGCCCCAGCGTTCTGGG + Intergenic
1203551574 Un_KI270743v1:167592-167614 GCAGAGAGGCCCACAGCGCCGGG - Intergenic
1185513108 X:677722-677744 GCAGATGGGCACAGACTTCCAGG - Intergenic
1185549648 X:972979-973001 ATGGAGTGCCCCAGAGTTCCGGG + Intergenic
1186677292 X:11832093-11832115 TCAGAGTGACCTTGAGTTCCTGG - Intergenic
1188579833 X:31698138-31698160 ACAGAGTACGCCAGAGTTCCAGG + Intronic
1191249215 X:58252074-58252096 GCCCAGAGGCCCAGAGTGCCTGG - Intergenic
1192800076 X:74457405-74457427 GCAGAGTGGCCCAAAGTCAATGG - Intronic
1195627662 X:107020286-107020308 CCAGAGTGGCCCAGATTTTGGGG + Intergenic
1197887748 X:131235973-131235995 GTAGAGTGACCAAGAGTTACAGG + Intergenic
1198018528 X:132635608-132635630 GCCAAGTGGCCCAGAGTTGGGGG - Intronic