ID: 1017909737

View in Genome Browser
Species Human (GRCh38)
Location 6:158782532-158782554
Sequence CTGCTCTTTACGTGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017909732_1017909737 5 Left 1017909732 6:158782504-158782526 CCGGTACATCCAGGAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 308
Right 1017909737 6:158782532-158782554 CTGCTCTTTACGTGGAAAGCAGG No data
1017909734_1017909737 -4 Left 1017909734 6:158782513-158782535 CCAGGAACTCTGGGCCACTCTGC 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1017909737 6:158782532-158782554 CTGCTCTTTACGTGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017909737 Original CRISPR CTGCTCTTTACGTGGAAAGC AGG Intronic
No off target data available for this crispr