ID: 1017910519

View in Genome Browser
Species Human (GRCh38)
Location 6:158788337-158788359
Sequence CACCCAAAAGGGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 302}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017910506_1017910519 1 Left 1017910506 6:158788313-158788335 CCTGTTCTTCCCCCTCTTCCCAC 0: 1
1: 0
2: 17
3: 303
4: 2077
Right 1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 302
1017910508_1017910519 -9 Left 1017910508 6:158788323-158788345 CCCCTCTTCCCACTCACCCAAAA 0: 1
1: 1
2: 3
3: 41
4: 479
Right 1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 302
1017910507_1017910519 -8 Left 1017910507 6:158788322-158788344 CCCCCTCTTCCCACTCACCCAAA 0: 1
1: 0
2: 7
3: 51
4: 637
Right 1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 302
1017910504_1017910519 12 Left 1017910504 6:158788302-158788324 CCCAGGACTGACCTGTTCTTCCC 0: 1
1: 0
2: 1
3: 22
4: 233
Right 1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 302
1017910505_1017910519 11 Left 1017910505 6:158788303-158788325 CCAGGACTGACCTGTTCTTCCCC 0: 1
1: 0
2: 2
3: 20
4: 260
Right 1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 302
1017910509_1017910519 -10 Left 1017910509 6:158788324-158788346 CCCTCTTCCCACTCACCCAAAAG 0: 1
1: 1
2: 1
3: 26
4: 393
Right 1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG 0: 1
1: 0
2: 4
3: 29
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017910519 Original CRISPR CACCCAAAAGGGATGGGGGA AGG Intronic
900887590 1:5426231-5426253 CACCCAAAAGCGGGGAGGGAAGG - Intergenic
902708335 1:18221854-18221876 TACCCAAAAGGAAGGTGGGAAGG + Intronic
902822311 1:18950798-18950820 CTCCAAAAAGGGATGGTGGGTGG - Intronic
903054728 1:20627779-20627801 CACCCAAAGGACATGGGGGTGGG - Intergenic
903103085 1:21050519-21050541 CACCCGAAAGGGGTGCGAGACGG + Intronic
903325450 1:22566360-22566382 CAGCGAAATGGAATGGGGGAAGG + Intronic
903589672 1:24445105-24445127 CACCCAGAGGGCATGGGTGAAGG + Intronic
903929635 1:26854914-26854936 CACTCAAAGGGGATGGGGCAGGG - Exonic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
906173168 1:43745275-43745297 CTTGCATAAGGGATGGGGGATGG + Intronic
907588001 1:55638651-55638673 CACCCACTTGGCATGGGGGATGG - Intergenic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
910190162 1:84586725-84586747 CATCTAAAAGGGATGTGGGTGGG - Intergenic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
911234424 1:95395886-95395908 CCCACAAAAGGGAGGTGGGAAGG + Intergenic
911569574 1:99507214-99507236 CACCCAAAAATGAAAGGGGAGGG + Intergenic
911895802 1:103433475-103433497 TACCCAAAAGGGGTGAGGGTGGG - Intergenic
912192383 1:107354674-107354696 GACCAAAAGGGGATGGGAGAGGG - Intronic
913025288 1:114832432-114832454 CCCCCAGAAGTGATGGGGGTGGG + Intergenic
913077624 1:115354252-115354274 GACCCAACAGGGATGGGGTAGGG - Intergenic
914200529 1:145480710-145480732 CATCTCAAAGGGATGGAGGAAGG - Intergenic
914408314 1:147400093-147400115 CCCCCGCAAAGGATGGGGGATGG + Intergenic
914479643 1:148053837-148053859 CATCTCAAAGGGATGGAGGAAGG - Intergenic
918171859 1:182004826-182004848 CACCCCTAGGGGAAGGGGGAGGG + Intergenic
918525187 1:185456922-185456944 GATCCAAAAGGTATGAGGGAGGG - Intergenic
920071950 1:203308428-203308450 CGACCAGAAGGGAAGGGGGAGGG - Exonic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
922865345 1:228856015-228856037 CACAGACCAGGGATGGGGGATGG - Intergenic
1063187080 10:3661054-3661076 CAGCCTACAGGGAAGGGGGAAGG - Intergenic
1063909100 10:10811579-10811601 CATCTCAAAGGGATGGAGGAAGG + Intergenic
1065258805 10:23903151-23903173 AAACCTAAAGGGATGGAGGAGGG - Intronic
1065623265 10:27605587-27605609 AACCCAAAACGGTTTGGGGAAGG - Intergenic
1069262109 10:66411846-66411868 CACCCAAAAGGAAATGAGGAAGG + Intronic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1072937078 10:99723734-99723756 CTCCTAGAAGGGATGGTGGATGG - Intronic
1073065987 10:100759476-100759498 CAGCCAAAAGGGAGGGAGGCAGG + Intronic
1073592996 10:104774094-104774116 CATCCAGAAAGGATGGGAGATGG - Intronic
1074145101 10:110710638-110710660 CCCCCAAAGGGGAAGGGGGAGGG - Intronic
1074254175 10:111783821-111783843 CTCCAAAAAGGTATGAGGGAGGG - Intergenic
1074923353 10:118042275-118042297 CCCCCAAAATGGAAGGGGGTGGG + Intronic
1074972564 10:118551123-118551145 CATCAGAAAAGGATGGGGGAGGG + Intergenic
1075051274 10:119184017-119184039 CAACAAAAGGGGAGGGGGGAGGG + Intergenic
1075533523 10:123250818-123250840 CACACAAAAGTGACCGGGGAAGG - Intergenic
1075677409 10:124304895-124304917 CACCCAACAGGGAGGGGCCAAGG + Intergenic
1076402889 10:130195038-130195060 CACCCAGGAGGGAGTGGGGAGGG - Intergenic
1077410469 11:2401538-2401560 CACCCAATAAGGATGGGGTCAGG - Intronic
1078267866 11:9768335-9768357 CAAGCAAATTGGATGGGGGATGG - Intergenic
1078528168 11:12116503-12116525 CACCCCAAAGTGATGGAGCAGGG - Intronic
1078649663 11:13177010-13177032 GGCCCAAAAGGGATGTGAGACGG + Intergenic
1078869135 11:15327831-15327853 GACCCAAAACGGATTGGGAAGGG - Intergenic
1080536588 11:33227589-33227611 GACCCTAAAGGAATGGGAGAAGG - Intergenic
1082984748 11:59158750-59158772 GACCCAAAAGGGATGCCAGATGG - Intergenic
1083310805 11:61782740-61782762 TGCCCAGAAGGGATGTGGGAAGG + Intronic
1083696730 11:64448524-64448546 CACCCAGAGGGGGAGGGGGAAGG - Intergenic
1083889088 11:65586968-65586990 CACACAATGGGCATGGGGGAGGG - Intronic
1086412320 11:86554985-86555007 CAGCCTGAGGGGATGGGGGAGGG + Intronic
1088110945 11:106260614-106260636 CCACGAACAGGGATGGGGGATGG + Intergenic
1089063301 11:115643601-115643623 CATCCACAAGGGAAGGGAGAGGG - Intergenic
1089290242 11:117433290-117433312 CAGCCATAAGGGGTTGGGGAAGG + Intronic
1089647817 11:119891780-119891802 CACACACAGGGGCTGGGGGATGG - Intergenic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1090078572 11:123595027-123595049 CACCCAAAGGGGAGGGAGGGAGG - Intronic
1090081870 11:123618890-123618912 CATCCCAGAGGGATGGGGAAGGG - Intronic
1090110377 11:123901271-123901293 CATCCAATATGAATGGGGGAAGG + Intergenic
1090249783 11:125243312-125243334 CACCCAGAAGGGGAGAGGGAAGG - Intronic
1090599472 11:128355423-128355445 CACCTCAAGGGGATGCGGGATGG + Intergenic
1091727312 12:2855084-2855106 CATCCAGGAGGGAGGGGGGATGG + Intronic
1093896782 12:24583532-24583554 CACCCCAGAGGCATGGGAGATGG - Intergenic
1094173725 12:27521292-27521314 CAGCCACAGGAGATGGGGGAGGG - Intergenic
1094414423 12:30202001-30202023 CACCCAGAGGGGCTGGCGGAAGG - Intergenic
1094452976 12:30601646-30601668 CACTGCACAGGGATGGGGGATGG - Intergenic
1096143263 12:49260181-49260203 TATCCTAAAGGAATGGGGGAAGG + Intronic
1096787676 12:54026951-54026973 CACCCAAAAATGGTGGGGGGGGG + Intronic
1097747737 12:63318059-63318081 CACCCAAAAGAGAGGTGGCAGGG + Intergenic
1099317816 12:81106527-81106549 CACCGAACTGGGGTGGGGGAAGG - Intronic
1099640894 12:85282099-85282121 CAGCAATTAGGGATGGGGGAGGG - Intronic
1101124204 12:101614363-101614385 CTCACAAGAGGGATGGAGGAGGG - Intronic
1101412645 12:104482217-104482239 CAAAGAGAAGGGATGGGGGAAGG - Intronic
1101814349 12:108134312-108134334 AACCCCAAAGGGAGGGGGCAGGG - Intronic
1104796981 12:131526836-131526858 CACCCACATGGCATGGGGTATGG - Intergenic
1106706102 13:32281483-32281505 CACCCAAGAGGGATGAGAGTGGG + Intronic
1108081146 13:46737522-46737544 CAGCACAAAGGGATGTGGGATGG - Intronic
1108305266 13:49125245-49125267 CAGCCAAAAGGGATGGGCAGGGG + Intronic
1111644704 13:91017494-91017516 CACCACAAAGGGATGGAAGATGG - Intergenic
1112727327 13:102319446-102319468 CCCCAGAGAGGGATGGGGGAAGG - Intronic
1114370315 14:22079506-22079528 GACCAAAAGGGGATGGGGGGTGG + Intergenic
1114486552 14:23066051-23066073 CACCCCACAGAGAGGGGGGAAGG + Intronic
1118925408 14:70187097-70187119 CACCCGAAGGGGGTGGGGGGAGG - Intronic
1118952433 14:70446771-70446793 CAGCCAAAAGGGAAGAGGGGCGG + Intergenic
1119208747 14:72813555-72813577 GACCCAAAAGGAATGGGTGCCGG - Intronic
1119674977 14:76546840-76546862 CTTCCAAAAGGGATTGTGGATGG + Intergenic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1122276227 14:100592155-100592177 CACCAACTAGGGATCGGGGAGGG - Intergenic
1122312003 14:100803351-100803373 CACACCAGAGGGATGTGGGAGGG - Intergenic
1122500110 14:102191739-102191761 CACTGGAAAGGGATTGGGGAGGG + Intronic
1124068776 15:26371593-26371615 CACACACAAGGGTTTGGGGAGGG - Intergenic
1124883069 15:33659986-33660008 CACCCAAAAGAGGTGGGAAAAGG - Intronic
1126797860 15:52274962-52274984 CACCCAAAAGGCACAGAGGAGGG - Intronic
1127354982 15:58189440-58189462 CACCCGAAAGAGGTGGGGTAGGG - Intronic
1127357497 15:58214572-58214594 CACAAAAAGGGGGTGGGGGAAGG + Intronic
1127507266 15:59609518-59609540 AACTCAAAGGGGGTGGGGGATGG - Intronic
1128312100 15:66637253-66637275 CTCCCACAGGGGTTGGGGGATGG + Intronic
1129154212 15:73707670-73707692 TACCAAAAAAAGATGGGGGAAGG - Intronic
1129246184 15:74280321-74280343 CACCCATCAGTGATGGGGGAGGG + Intronic
1129615882 15:77098446-77098468 CACCCAAAGGGCAGGGGGTAGGG + Intergenic
1129944164 15:79524660-79524682 CTCCCCAGAGGGATGGTGGAGGG + Intergenic
1130230272 15:82091618-82091640 CCCCCAAAAGGGGTGGGGGAGGG + Intergenic
1130372303 15:83295336-83295358 GTCCCAAAAGGTATGGTGGATGG - Intergenic
1130814358 15:87415171-87415193 CTCCCCAAAGTTATGGGGGAGGG + Intergenic
1131547498 15:93328120-93328142 CAACCAAATGGGGTGGGTGAGGG - Intergenic
1131696393 15:94881895-94881917 CACCCAAGAGTGATGGGGGTGGG + Intergenic
1132252700 15:100346147-100346169 CAGTGAAAAGGGATAGGGGAGGG - Intergenic
1133595549 16:7287849-7287871 CACACGAAATGGGTGGGGGAAGG - Intronic
1133902486 16:9990373-9990395 ATCCCAAAAGGGAGGAGGGAGGG + Intronic
1134821749 16:17252573-17252595 CACCGAAAAGGGATGGAGCTGGG + Intronic
1135513068 16:23104895-23104917 CCCCAAAAAGGGATGCGGCATGG + Intronic
1136511427 16:30740028-30740050 CACCCTTAGGGGAAGGGGGAGGG + Exonic
1136912325 16:34154375-34154397 CGCCGACAAGGGGTGGGGGAAGG - Intergenic
1137029856 16:35512102-35512124 CACACAAAGGGGAGGGGTGAGGG + Intergenic
1137430774 16:48416703-48416725 CTCCCAAAAGGGGTGGCGGCCGG + Intronic
1137560089 16:49496931-49496953 CACCCAGAGGGGAAGGGGGAGGG - Intronic
1137695673 16:50460608-50460630 CCCCAAAAAGGCTTGGGGGAAGG - Intergenic
1137874171 16:51980041-51980063 CACCAAAGAGGGGAGGGGGAGGG - Intergenic
1138435307 16:56995578-56995600 CACCCACAAGGGATAGGTGCTGG - Intronic
1141139575 16:81488600-81488622 CACAGAGAGGGGATGGGGGAAGG - Intronic
1141290422 16:82713459-82713481 CACCCAACAGTGCTGGGGGCAGG - Intronic
1141660198 16:85437276-85437298 CCCCCAAAAGAAGTGGGGGAGGG + Intergenic
1142695086 17:1628996-1629018 CAAACAAGAGAGATGGGGGACGG + Intergenic
1142884827 17:2905965-2905987 GACTGAAAAGTGATGGGGGAAGG - Intronic
1143382124 17:6503127-6503149 CACCCAAAAGTGATGGGCACAGG + Intronic
1143568729 17:7741033-7741055 CCGCCAGGAGGGATGGGGGATGG + Intronic
1143729673 17:8874071-8874093 GCCCCCAGAGGGATGGGGGATGG + Intergenic
1144210121 17:13007538-13007560 CACCCAAACGGGTTTGAGGATGG + Intronic
1145062716 17:19742988-19743010 CCCCCAACAGGGGTGGGGGAAGG + Intronic
1145904278 17:28507808-28507830 CACCCCGAGTGGATGGGGGAAGG + Intronic
1146930978 17:36777710-36777732 AACACAAATGGGAGGGGGGATGG + Intergenic
1147254450 17:39173890-39173912 CACCAGACAGGGAGGGGGGAAGG + Exonic
1148019059 17:44541792-44541814 CCCCCAAAATAGAGGGGGGAAGG - Intergenic
1148697189 17:49567680-49567702 ACCCCAAAAGGGGTGGAGGAAGG + Intergenic
1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG + Intronic
1150003364 17:61455450-61455472 CACCCTTAAGGGATGCGGGCAGG + Intronic
1150618554 17:66791139-66791161 CAAACAAAAGGGAGGGGGGAGGG - Intronic
1151043626 17:70893963-70893985 CACGAACCAGGGATGGGGGATGG + Intergenic
1151269403 17:72982168-72982190 AACCCTATAGGGATGGGGTATGG + Intronic
1151971745 17:77460903-77460925 CACTTAAAAGGAGTGGGGGATGG - Intronic
1152293235 17:79452663-79452685 CACACAGCAGGGATGAGGGAGGG + Intronic
1152315089 17:79575443-79575465 CAGCCAGCAGGGCTGGGGGACGG + Intergenic
1152581354 17:81166702-81166724 CACCCAAAGGGCATGGGGTGGGG - Intergenic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1153912129 18:9713669-9713691 AAGACATAAGGGATGGGGGAAGG - Intronic
1155431723 18:25766287-25766309 CTCCCAAAAGGAAGGAGGGATGG - Intergenic
1157584917 18:48794806-48794828 CACACAAAGGGCCTGGGGGAAGG - Intronic
1160429584 18:78802224-78802246 CAGGAGAAAGGGATGGGGGAGGG + Intergenic
1161586801 19:5110071-5110093 CACCCAAGAGAAATGGGGGCTGG - Intronic
1162110326 19:8396556-8396578 CACACGAAGGGGATGAGGGAGGG + Intronic
1164514051 19:28919065-28919087 CACCCCACAGGCATGGAGGATGG - Intergenic
1167195356 19:48024424-48024446 CACCCCAAAGGGAGGAGGGATGG - Intronic
1167632552 19:50634548-50634570 ACCCCAAGAGGGAGGGGGGAAGG - Intronic
1168320838 19:55508654-55508676 CATCCACAGGGGATGGGGGGAGG + Intronic
1168320860 19:55508728-55508750 CATCCACAGGGGATGGGGGGAGG + Intronic
1168320903 19:55508875-55508897 CATCCACAGGGGATGGGGGGAGG + Intronic
1168382930 19:55939459-55939481 CACCTATAAGGGTTGGGGGGTGG + Intergenic
925376530 2:3389657-3389679 CAGCCGAAGGGGGTGGGGGATGG + Intronic
925838265 2:7966415-7966437 GTCCCAAAAGGGAAGGAGGAGGG + Intergenic
925978606 2:9158453-9158475 TACTAAAAAAGGATGGGGGAGGG - Intergenic
926718800 2:15943437-15943459 CACCCACCGAGGATGGGGGAAGG - Intronic
926722767 2:15973883-15973905 CACCAAAAAGGGGTGGGAGAGGG - Intergenic
927903448 2:26840272-26840294 TGCCAAAAAGGGATGGGAGAGGG + Intergenic
929391585 2:41474443-41474465 CAACCAAGAGGGATGGGGCTAGG + Intergenic
933261266 2:80134385-80134407 CAACCAAAGGGTTTGGGGGAGGG - Intronic
936856623 2:116966060-116966082 CACCCTAAAGGCAGGGTGGAAGG - Intergenic
937428114 2:121816603-121816625 CACCCAGAAGGGATGGATGGAGG - Intergenic
937560444 2:123218267-123218289 CACTATCAAGGGATGGGGGAGGG - Intergenic
937878751 2:126849581-126849603 GACTCTAAAGGGATGGGGGGAGG - Intergenic
939827494 2:147032339-147032361 CACCCAAAAGTGGTCTGGGATGG - Intergenic
940139269 2:150475318-150475340 CACTAAAAAGGGAGGGGGCAAGG + Intronic
940549525 2:155135422-155135444 CACCTATCAGGGATGAGGGAAGG + Intergenic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
941611858 2:167671012-167671034 CACCCAAAAAGGAGCAGGGATGG + Intergenic
942227410 2:173829514-173829536 CATCCAAAGGGGTTGGGGCAAGG - Intergenic
942351474 2:175057595-175057617 CACACAGAAAGGATGGGGGTGGG - Intergenic
942633744 2:177979146-177979168 CATCCAAAGGGGTTGGGGAAAGG - Intronic
943277046 2:185880776-185880798 CATCCAAAGGGGATGGTGAAAGG + Intergenic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946039646 2:216772898-216772920 CCCGCAACAGGGATGGGGGGTGG - Intergenic
1168771833 20:420727-420749 GAGCCAGTAGGGATGGGGGATGG - Intronic
1170742032 20:19066617-19066639 CACACACCAGGGGTGGGGGAAGG - Intergenic
1171952666 20:31435160-31435182 CACTGAATAGAGATGGGGGAAGG - Intergenic
1171992249 20:31705652-31705674 CACCCTAAAGGGATCTGAGAAGG + Intronic
1172095292 20:32457383-32457405 CACCCAGAGTGGGTGGGGGAGGG + Intronic
1172297662 20:33824830-33824852 TCCCCAAAAGGGTGGGGGGAGGG + Intronic
1174611216 20:51800568-51800590 CACCCAAAATGAAGGGGGAAGGG + Intronic
1174641530 20:52048719-52048741 CCCCCAAAAAGGAGGGAGGAGGG - Intergenic
1175179392 20:57134830-57134852 TACCCAAAAGGGACCAGGGATGG + Intergenic
1175804623 20:61820649-61820671 AACACAAGAGGGATGGGGGGCGG - Intronic
1177109713 21:17010671-17010693 CAACCAAAAGGGAAGAAGGAAGG + Intergenic
1178352459 21:31882068-31882090 CACTCACGAGTGATGGGGGAGGG - Intronic
1178421638 21:32448047-32448069 AAACCATATGGGATGGGGGATGG - Intronic
1179492600 21:41751062-41751084 CACCCACAGGGGATGGGGGGCGG + Intronic
1179969977 21:44830599-44830621 CACCCAAAAGGGGTGGGGGTGGG + Intergenic
1180121760 21:45756084-45756106 GGCTCAAAATGGATGGGGGATGG - Intronic
1180131556 21:45830107-45830129 CCCCCAAAAGGGTCAGGGGAAGG - Intronic
1180376816 22:12101276-12101298 CACCAAAAAGTGATAGGTGAGGG + Intergenic
1181317832 22:21982438-21982460 CACCCTAAAGAGCTGTGGGAGGG + Exonic
1181625123 22:24118053-24118075 CACCTCAAAGGGTAGGGGGAGGG + Intronic
1181901474 22:26159845-26159867 CATCCAACAGAGATGGGGGCAGG + Intergenic
1182304452 22:29358281-29358303 AACCCAACAAAGATGGGGGAAGG + Intronic
1182557714 22:31138088-31138110 CAACCCAGCGGGATGGGGGATGG - Intronic
1183691135 22:39389015-39389037 ACCCCAAAAGGGATGGGGGATGG + Intergenic
1184391381 22:44205416-44205438 TACCCAATAGGGATCAGGGAAGG - Intronic
1185175270 22:49322865-49322887 CACCCAAGAGAGTTTGGGGAGGG + Intergenic
949579115 3:5369385-5369407 TACCCAAAAAGGATGGTAGATGG - Intergenic
950214185 3:11146568-11146590 CATCCACAAGGGATGGGGGTAGG + Intronic
950647077 3:14383576-14383598 TGCCCAAAAGGGCTGGAGGAAGG + Intergenic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
952479771 3:33749123-33749145 CTCCAGAAAGGGATGGGGAAGGG + Intergenic
953399625 3:42601139-42601161 CTCCCAAAAAGGCCGGGGGAGGG - Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
954109621 3:48426770-48426792 CACCCAAGGGGGCGGGGGGAAGG + Intronic
955814280 3:62825566-62825588 CACCAACAAGGGATTGGAGATGG - Intronic
956278274 3:67527472-67527494 TACACAAAAGGGATGGTGAAAGG + Intronic
956308200 3:67849769-67849791 CACCCTAAAGGAATATGGGAAGG + Intergenic
957407079 3:79785321-79785343 CACAGGAAGGGGATGGGGGAGGG + Intergenic
957532789 3:81461526-81461548 AACTGGAAAGGGATGGGGGAAGG + Intergenic
958636845 3:96755791-96755813 CAGCCAAAAGGAATGGGGCAGGG - Intergenic
959375777 3:105587253-105587275 CATCCAAAGGGGTTGGGGAAAGG + Intergenic
960509865 3:118536421-118536443 AACTCAAAAGGGATGGGGCAGGG - Intergenic
960854787 3:122091933-122091955 CATCCCATGGGGATGGGGGAAGG + Intronic
961101209 3:124200793-124200815 CTCCCAAGAGGGATGGTGTAGGG - Intronic
961780278 3:129316807-129316829 CATCCAAAGGGGATGGCGGATGG + Intergenic
962249145 3:133824387-133824409 CACTTTAAAGGGATGGGTGAGGG + Exonic
964244373 3:154633601-154633623 CACGGCAAGGGGATGGGGGAGGG + Intergenic
964512484 3:157467948-157467970 TACTTAAAAGGGATGGGGTATGG - Intronic
964538965 3:157757741-157757763 GACAGAAAAGGGATGGGGGTTGG + Intergenic
965145126 3:164890875-164890897 CACTGCCAAGGGATGGGGGAGGG + Intergenic
965465579 3:169026561-169026583 CAAAAAAAAGGGAGGGGGGAGGG - Intergenic
968728922 4:2260825-2260847 CACACAAAAGGGCTGGGCCAAGG + Intronic
969339169 4:6529625-6529647 CAGGGAAGAGGGATGGGGGATGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969722208 4:8898339-8898361 AAGCCAGAAGGGCTGGGGGAAGG + Intergenic
969934868 4:10670322-10670344 TACTCTTAAGGGATGGGGGATGG - Intronic
970171975 4:13299433-13299455 CACCCAAGAGAGATGGAGAAAGG + Intergenic
970564165 4:17315143-17315165 CAATCAAATGGGAAGGGGGAGGG + Intergenic
972263808 4:37439642-37439664 CATCCAAATGGGGTGAGGGATGG - Intronic
973346129 4:49057920-49057942 TAACCAAAAGAGATGTGGGATGG - Intronic
974028973 4:56758829-56758851 CCCCCAAAAAGAATGGGGAAGGG - Intergenic
975170860 4:71230671-71230693 ATCCCAAAAGGCATCGGGGATGG - Intronic
975895368 4:79083797-79083819 CACCCAGATGGGATGGAGGGAGG - Intergenic
979390581 4:120122307-120122329 CACCCAACAGGTAAGGGGAAAGG - Intergenic
979492436 4:121343358-121343380 CCCCCAAAAAGGATTGGGAAGGG - Intronic
980237228 4:130124213-130124235 TAATCAAAAGGGATTGGGGAAGG - Intergenic
1202758416 4_GL000008v2_random:86709-86731 CACCAAAAAGTGATAGGTGAGGG + Intergenic
985756690 5:1723598-1723620 CACCCAGAGGGGGTGTGGGAGGG - Intergenic
986255204 5:6096639-6096661 CACCCAACAGGGGAGGGGGGAGG + Intergenic
990364084 5:55051734-55051756 CACCCACAATGGGTGGGGGATGG + Intergenic
993683986 5:90915702-90915724 CACCCACGGGGGCTGGGGGAGGG - Intronic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
997882713 5:137604627-137604649 GCCTCAAAAGGGATAGGGGAAGG + Intergenic
998240618 5:140440378-140440400 TACCAAAAAGGGAAGGAGGATGG - Intronic
999339676 5:150759188-150759210 CTCACAAAAGCGCTGGGGGACGG - Intergenic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1001612598 5:173015491-173015513 CAACCATAGGGGAAGGGGGAGGG + Intronic
1002792494 6:446451-446473 CACGCAAAAGGGATGCTGTACGG + Intergenic
1004574545 6:16882535-16882557 AACCCAAAAGACCTGGGGGAAGG - Intergenic
1004906602 6:20242409-20242431 CACCCACCAGGGAGGGGAGAGGG - Intergenic
1006467025 6:34201946-34201968 CACCCAAATGGGATGTGAGATGG + Intergenic
1007285834 6:40746748-40746770 CACCAACAGGAGATGGGGGAAGG + Intergenic
1007461470 6:42022384-42022406 CACACAAAAAGGGTGGAGGATGG + Intronic
1007573095 6:42907439-42907461 GGCCCAAGAGGGATGGGGGCAGG - Intergenic
1007812922 6:44498996-44499018 CAACCAAAAGGGCTGGGGAGAGG - Intergenic
1007914797 6:45551514-45551536 AACCCAAAAGAGATGTGGAAAGG - Intronic
1009533832 6:64855144-64855166 CACACAAACGCGGTGGGGGATGG - Intronic
1010029252 6:71256149-71256171 CAACCAACAGGGATAGGGGTGGG + Intergenic
1011882223 6:92043401-92043423 CCTTCAATAGGGATGGGGGAAGG - Intergenic
1012300187 6:97577954-97577976 CACCCAAATGGGATGGCTGGTGG + Intergenic
1012749129 6:103135191-103135213 CACCCAAAATGGATGGACTAGGG + Intergenic
1013261910 6:108452555-108452577 GAACCAAAAGGGATGGGGGCAGG + Intronic
1013626342 6:111940924-111940946 AGACCCAAAGGGATGGGGGAGGG - Intergenic
1015688790 6:135896895-135896917 CACACTGAAGAGATGGGGGATGG - Intronic
1015749396 6:136544921-136544943 TACCCCAAAGAGATGGGGGGCGG - Intronic
1016035219 6:139376811-139376833 CTCCTTTAAGGGATGGGGGATGG - Intergenic
1017075350 6:150612668-150612690 CAACCCAAAGGGAAGGGTGAGGG + Intronic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1019218335 6:170457691-170457713 GACCCAAAGGGGATAGGGGCAGG + Intergenic
1021133038 7:16934177-16934199 CACACATTATGGATGGGGGAAGG - Intergenic
1022463687 7:30636299-30636321 CTCCCAAAAATGATGGGGGAAGG + Intergenic
1023307033 7:38841450-38841472 CCACCAAAATGGCTGGGGGAAGG + Intronic
1027220009 7:76207983-76208005 CACCCAAGAGGGACAGGGCAGGG - Intronic
1027235801 7:76297116-76297138 CACCCACAAGGGAGAGGAGATGG - Intergenic
1028703644 7:93813081-93813103 CAAGCAAAATGGCTGGGGGATGG - Intronic
1029414688 7:100435617-100435639 CACCCAAAGGTGATGGGGTCTGG - Exonic
1029421164 7:100472512-100472534 AACTCAACAGGGGTGGGGGAGGG + Intronic
1029540469 7:101179621-101179643 CAGCCAAAGGGGGTGGGGGGAGG + Intronic
1031923769 7:127619800-127619822 GACCCAGAGGTGATGGGGGAGGG + Intergenic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032122796 7:129169106-129169128 CACCCAAAACAGGAGGGGGATGG + Intronic
1035545649 8:480359-480381 CCTCCAAAAGGGAGGAGGGAAGG - Intergenic
1036789152 8:11706757-11706779 CAATCAGAAGGGGTGGGGGAAGG - Intronic
1039248638 8:35636664-35636686 CACAGAAAAGTGCTGGGGGATGG + Intronic
1039334241 8:36572405-36572427 AAACCAAAAGGGAAGGAGGAAGG + Intergenic
1040999330 8:53434921-53434943 CATCCGAAGGGGATGGGAGAGGG + Intergenic
1042521243 8:69713457-69713479 CACAAAAAAGGGAGGAGGGAGGG - Intronic
1047488148 8:125351390-125351412 CACCCATGAGGGATGGAGCAAGG - Intronic
1047773958 8:128053816-128053838 CAACCAGAAGGGTTGGGGCAAGG + Intergenic
1057566653 9:96170999-96171021 CACCCAGGAGGGAAAGGGGATGG + Intergenic
1058666253 9:107318731-107318753 CACTAAAAAGGGAGGGTGGAGGG - Exonic
1060670794 9:125467621-125467643 CCCCCAAATGGGAAGGGGAAGGG + Intronic
1060777938 9:126390289-126390311 CACCCCACAGGGATGTGGGTTGG - Intronic
1061953560 9:133949790-133949812 CCCCAAAAAGGGATGGGGCAAGG + Intronic
1203539205 Un_KI270743v1:71581-71603 CACCAAAAAGTGATAGGTGAGGG + Intergenic
1185548790 X:967089-967111 CGCCCAAAAGGTATTGGGAAAGG + Intergenic
1185620500 X:1450669-1450691 AACCCCCTAGGGATGGGGGAGGG - Intronic
1185620777 X:1451376-1451398 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185620832 X:1451519-1451541 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185621052 X:1452093-1452115 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185621203 X:1452479-1452501 GTCCCCATAGGGATGGGGGAGGG - Intronic
1186545589 X:10445857-10445879 CACCCAAAAAGAAAAGGGGAGGG - Exonic
1187262819 X:17702927-17702949 CACCTTAAAGGGATGGGGAAGGG - Intronic
1187285029 X:17897054-17897076 CACCTAACTGGGATGTGGGACGG - Intergenic
1189563200 X:42212391-42212413 AAGCCAAAAGGCATGGGGTAGGG + Intergenic
1191634688 X:63363159-63363181 CAGCCACAGGGGACGGGGGAAGG - Intergenic
1191864144 X:65690414-65690436 AACCCAAAAGTGCTGGAGGAAGG + Intronic
1192783303 X:74315265-74315287 AAAAAAAAAGGGATGGGGGAGGG + Intergenic
1193493895 X:82187035-82187057 CACACACAAGCGATGGGGAAAGG - Intergenic
1194067899 X:89284544-89284566 CACTGAAAAGGAATGGGAGAGGG + Intergenic
1196006137 X:110839230-110839252 TCCCCAAAAGGCATGGGGGTGGG - Intergenic
1196368728 X:114951919-114951941 CACTCAGAGGTGATGGGGGAGGG - Intergenic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1199192471 X:144986569-144986591 CACCCAAAGGGGATGAGATAGGG + Intergenic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1200722044 Y:6618705-6618727 CACTGAAAAGGAATGGGAGAGGG + Intergenic
1201321244 Y:12700461-12700483 ACCCCAAGAGTGATGGGGGAGGG + Intergenic
1201523939 Y:14910053-14910075 CACCCAAAAGCTATAGGGCAAGG + Intergenic