ID: 1017912803

View in Genome Browser
Species Human (GRCh38)
Location 6:158808758-158808780
Sequence CAGGATAAATAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 620}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017912803 Original CRISPR CAGGATAAATAGAGGGAAGA AGG (reversed) Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903037847 1:20505950-20505972 CAGGAGAAATACAGGGCAGCTGG + Intronic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
904480691 1:30791541-30791563 AAGGACAAAGAGAGGGAAGGAGG + Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
907823056 1:57989523-57989545 CAGGAGAAATTGAGGGGTGAGGG - Intronic
908292503 1:62682500-62682522 CAGTATAAAAACAGGGAAGGGGG + Intronic
908342821 1:63199612-63199634 CAGGCTAAATGGGGGGAAAAAGG - Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
908954780 1:69610249-69610271 CAGGAGAAAAGGAGGGAAAAAGG - Intronic
909165660 1:72221180-72221202 GAGGATACATAGAGGAAAGAAGG - Intronic
909385884 1:75056293-75056315 CAGAAAAAATAAGGGGAAGAAGG + Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911035060 1:93533831-93533853 AAGGGTAATTAGAGAGAAGAGGG - Intronic
911172366 1:94783229-94783251 CAGGAGAAAGAGAGAGAATAAGG + Intergenic
911190648 1:94945177-94945199 AAAGATAAAAATAGGGAAGAAGG - Intergenic
911285024 1:95979899-95979921 GAGGAGAAAGAAAGGGAAGAGGG - Intergenic
911624893 1:100112361-100112383 TACAATAAATAGAAGGAAGATGG + Intronic
911688639 1:100806187-100806209 CAGCATAAATACAGAGCAGAGGG + Intergenic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912108983 1:106316672-106316694 TAAGATCAATAGAGGGAATAAGG + Intergenic
912219343 1:107654610-107654632 AAGGATAAAGTGAGGGAAAAAGG - Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915388471 1:155518784-155518806 CAGGAGAGGTAGAGGGGAGACGG + Intronic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916152633 1:161810320-161810342 CAGGAGAAAGAGAGAAAAGAGGG + Intronic
917205237 1:172564464-172564486 CAGGAGAAAGAGAGTGAAGGGGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
1063183108 10:3624067-3624089 CACTATAAATAGAGGAAGGAGGG + Intergenic
1063921503 10:10938089-10938111 CAAGAGAGATAGAGGGGAGATGG + Intergenic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1064827782 10:19425317-19425339 GATGATGAATAAAGGGAAGAAGG - Intronic
1064968624 10:21040490-21040512 AAGGAGAAATAGAGGAGAGAAGG + Intronic
1065144237 10:22751831-22751853 CAGGTTGAATCAAGGGAAGAAGG - Intergenic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067949427 10:50715846-50715868 CAGGATAAATTGCGAGAACAAGG + Intergenic
1068087123 10:52388226-52388248 AAGGAAAAATAAAGAGAAGAAGG + Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1069255211 10:66323869-66323891 CAGCAGAGAAAGAGGGAAGAGGG + Intronic
1069725305 10:70573724-70573746 CAGGCTACGTAGAGGCAAGAGGG - Intergenic
1070163708 10:73881929-73881951 CAGGAGAAATGGAGGGGAGGGGG + Intergenic
1070754639 10:78984446-78984468 AAGGAAAGATAGAGGGAACATGG + Intergenic
1070884739 10:79880864-79880886 CAGGATAAATTGTGAGAACAAGG + Intergenic
1070987008 10:80697787-80697809 AAGGATAAAAAGAGGAAGGAAGG - Intergenic
1071437287 10:85659258-85659280 CAGGAAGAAGAGAGGAAAGATGG + Intronic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072042564 10:91622637-91622659 CAAGAAAAATAGAGGAAAGGGGG + Intergenic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072616133 10:97049845-97049867 CAGGATAAATACGGGGATGGTGG + Intronic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1072973098 10:100034449-100034471 CAGGAAAAATGGGGGGAAAAAGG - Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073959594 10:108911668-108911690 GCGGAGAATTAGAGGGAAGATGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1075963027 10:126585579-126585601 AAGGAAAAATAAAGGAAAGAAGG + Intronic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1078293492 11:10040780-10040802 AGGGATAAAGAGAGGAAAGAAGG + Intronic
1078393530 11:10957059-10957081 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078567001 11:12424316-12424338 GAGAATAAATACAGGAAAGATGG - Intronic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1078740624 11:14062994-14063016 GAGGAAAAAAAGAGGGAAGGAGG - Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1079992027 11:27256270-27256292 CAGGAGAAAGAGAGAGAAGTAGG + Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080539005 11:33248784-33248806 GAATATAAAGAGAGGGAAGAAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083209017 11:61171080-61171102 CAGAAAAACTAGAGGGAAGCAGG + Intergenic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1084586476 11:70065575-70065597 CAGGCCAACTAGAGGGACGACGG - Intergenic
1086285680 11:85247487-85247509 AAGGAAAAAATGAGGGAAGAAGG - Intronic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1087100730 11:94361650-94361672 CTGGATAAATAGCGAAAAGAAGG + Intergenic
1087107102 11:94421685-94421707 CAGCTTAAATACAGGGAACATGG + Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1087586223 11:100125324-100125346 GAGGATTACTAGAGGGAAGTAGG - Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088760095 11:112921279-112921301 TAGGATAATTAGAGAGAAGGAGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089943038 11:122439607-122439629 ACAGATAAATACAGGGAAGAAGG - Intergenic
1090243336 11:125199139-125199161 GAGGAGAAAAAAAGGGAAGAAGG - Intronic
1090562572 11:127948211-127948233 CAGGAGAGAAAAAGGGAAGAAGG - Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091324285 11:134672935-134672957 AAGGATAAATATAGGTAACAGGG + Intergenic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1091854767 12:3730669-3730691 CAAGATAAATCGAGTGAAAAAGG + Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092021945 12:5210142-5210164 CAGTAAAAATAGAGAAAAGATGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092811300 12:12273686-12273708 AAAGAAAAATAGAGGCAAGAAGG - Intergenic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097377572 12:58858276-58858298 GAGGAGAGAGAGAGGGAAGAGGG - Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1097540721 12:60938784-60938806 CAGGGTAAAAAGAGGCAAAAAGG - Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1102552503 12:113702082-113702104 AAGGAGAAAGGGAGGGAAGAAGG - Intergenic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103038991 12:117679134-117679156 AAGGATACATGGAGAGAAGACGG - Intronic
1104096596 12:125563784-125563806 AAGGAGAAATACAGAGAAGAAGG + Intronic
1104209684 12:126676875-126676897 TAGGATAAATAAAGGTAAAAAGG - Intergenic
1104508282 12:129353130-129353152 CAGGATAAAAAGAAGAGAGAAGG - Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106271749 13:28161063-28161085 CAAGATAAAAAAAGGGAAAATGG - Intronic
1106481212 13:30138316-30138338 GAGGGTAAAAAGAGGGAAAAGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107315471 13:39126972-39126994 CAGGATATATAGAAGCCAGATGG + Intergenic
1107731607 13:43354839-43354861 CAGGATAAAAAGAGGCATAAAGG - Intronic
1107870700 13:44744076-44744098 CAGGCTGAATAGAGTGAATAAGG - Intergenic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108281171 13:48863726-48863748 AAGGACAAGTACAGGGAAGAAGG - Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1108981927 13:56524680-56524702 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1111413396 13:87907341-87907363 CAGGAAAAAGAGAGGGCAAAGGG + Intergenic
1111506152 13:89191600-89191622 AAGGAGAAATAAAGAGAAGATGG + Intergenic
1111622924 13:90747356-90747378 AAGGATAAAAGGAGGGAACAGGG - Intergenic
1111705076 13:91738795-91738817 TAGCATAAAAAAAGGGAAGAGGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1111988255 13:95087662-95087684 CAGGATGAATAGAAGCAAAAGGG + Intronic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1114519674 14:23325312-23325334 GAGGAAAAAAAGAGGAAAGAAGG + Exonic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116343919 14:43763572-43763594 CAGCATAAAAAGAGAGAAAAGGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116975231 14:51108575-51108597 CAGGATCTAAAGAGGGAAAAGGG + Intergenic
1117172129 14:53111441-53111463 CACGTTAACTACAGGGAAGAAGG - Intronic
1119010355 14:70979565-70979587 AAGCATAAATAAAGGGAATAGGG - Intronic
1120230692 14:81837472-81837494 CAGGATAAAGAGAGTTAAGGGGG - Intergenic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120577987 14:86207768-86207790 CAGGAGAAAGAGAGCGAAGGGGG + Intergenic
1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1121907174 14:97757169-97757191 GAGCATAAATAAAAGGAAGAGGG - Intronic
1123468625 15:20534065-20534087 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123649489 15:22466997-22467019 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1123728943 15:23129276-23129298 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1123747107 15:23326741-23326763 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124279376 15:28350057-28350079 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1124303322 15:28561551-28561573 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124532221 15:30517991-30518013 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126445665 15:48740952-48740974 CAGGAGAAATAGAGGGCCTAGGG - Intronic
1126497426 15:49307442-49307464 CAGGTTGATTAGAGGGGAGAGGG + Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126595691 15:50382565-50382587 CAGGATACAAAGAGAGAAGGGGG - Intergenic
1126806981 15:52360812-52360834 GAGAATAACTTGAGGGAAGAAGG + Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128903503 15:71447096-71447118 CAAAAAAAATGGAGGGAAGAGGG - Intronic
1129030001 15:72611167-72611189 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1129038220 15:72663915-72663937 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129211670 15:74073316-74073338 CAGTTTAAATGGTGGGAAGAAGG - Intronic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1129398733 15:75267768-75267790 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129402341 15:75292044-75292066 CAGTTTAAATGGTGGGAAGAAGG + Intronic
1129728792 15:77917591-77917613 CAGTTTAAATGGTGGGAAGAAGG - Intergenic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1129839726 15:78736280-78736302 CAGTTTAAATGGTGGGAAGAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1133537953 16:6720270-6720292 CAGGAGAAAAAGAGTGAAGGGGG - Intronic
1133563462 16:6970838-6970860 CAGCATCAATAGAAGAAAGAAGG + Intronic
1133621642 16:7532205-7532227 CAAGCCAATTAGAGGGAAGAGGG - Intronic
1134057025 16:11176880-11176902 CAGCATATAGAAAGGGAAGAGGG - Intronic
1134410577 16:14000382-14000404 CAGGATAAAAAGAGGGGCTACGG - Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135159379 16:20080106-20080128 TAGGATAAATCTAGGGATGATGG - Intergenic
1135263325 16:21000003-21000025 AAGGAGAAAAGGAGGGAAGAAGG + Intronic
1136738163 16:32482969-32482991 CAGGATAAATACAAGAAACAAGG + Intergenic
1137063061 16:35809785-35809807 CAGGAGAAAAGGAGGGGAGAGGG + Intergenic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1139240746 16:65389445-65389467 CAGGACAGAAAGAGGAAAGAAGG - Intergenic
1140806201 16:78534581-78534603 AAGGTGAAATATAGGGAAGATGG + Intronic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141938865 16:87261049-87261071 CAGGAGAGAGAGAGGCAAGAGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1203014910 16_KI270728v1_random:346604-346626 CAGGATAAATACAAGAAACAAGG - Intergenic
1203033245 16_KI270728v1_random:619763-619785 CAGGATAAATACAAGAAACAAGG - Intergenic
1144406662 17:14958618-14958640 CAGAATAAATAGGGGGATGTAGG - Intergenic
1145200891 17:20943975-20943997 CAGGATGAAGAGAGAAAAGAGGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146004814 17:29154585-29154607 CAAGATCAACAGAGGCAAGAGGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146296361 17:31653660-31653682 CAGGATACGGAGAGGGGAGAGGG - Intergenic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1148701475 17:49589549-49589571 TTGGGTAAATAGAGGGTAGACGG + Intergenic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150645289 17:66974082-66974104 CAAGATAAATAAAGAGATGAGGG + Intronic
1151050916 17:70978240-70978262 AAGGAGAGATGGAGGGAAGAAGG + Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152137561 17:78513730-78513752 CAGATTAAATAGAGGAAAGCCGG - Intronic
1152153062 17:78615074-78615096 CAGGAGAAAGAGAGAGACGAGGG - Intergenic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1156229619 18:35140690-35140712 CAGGATAAAAAGAGGGGTGGTGG - Exonic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156427583 18:37031314-37031336 CAAGATACATAGTGGAAAGACGG - Intronic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1156918202 18:42486281-42486303 CAAGATAAATAGAGGAAACGTGG + Intergenic
1158021175 18:52843858-52843880 CAGGAAATATGTAGGGAAGAGGG + Intronic
1158079886 18:53577278-53577300 CAGGAGAAAGAGAGGGAAGCAGG - Intergenic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1159310262 18:66698469-66698491 GAGGAGAAAGGGAGGGAAGAAGG + Intergenic
1159556439 18:69950688-69950710 CTGGATACATTGAGGGGAGATGG + Intronic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165787142 19:38468419-38468441 GATGACAGATAGAGGGAAGAAGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167913627 19:52723192-52723214 GAGAAGCAATAGAGGGAAGAAGG - Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167924297 19:52810731-52810753 GAGGAAAAAAAGAGGAAAGAAGG + Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
925683889 2:6451978-6452000 CAGGATAAATAGGAGGACAAAGG + Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926461239 2:13131521-13131543 CAGGAGAGAGAGAGAGAAGAGGG - Intergenic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
927541455 2:23915282-23915304 CATGTTAAATAGAGGGTTGAGGG + Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928477944 2:31650463-31650485 GAAGCTAAATAGAGGAAAGAGGG - Intergenic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929494252 2:42425476-42425498 GAAGAGAAATAGAGGGATGATGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
931082105 2:58785220-58785242 AAGGAGAAAGAGAGGGAAGTTGG + Intergenic
931254417 2:60557278-60557300 CAAGATAAAAAGGGGGAGGAGGG - Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931376095 2:61709688-61709710 CATGATTAATAGAACGAAGAAGG + Intergenic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
933071862 2:77869244-77869266 AAGGAGACATACAGGGAAGAAGG + Intergenic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933346532 2:81093081-81093103 GAGGAGAGAGAGAGGGAAGAAGG + Intergenic
933654385 2:84875597-84875619 TGGGATGAATAGAGGGATGAGGG + Intronic
934033087 2:88065280-88065302 CAGAAAAAAAAGAGGGAAGGGGG - Intergenic
934144905 2:89082594-89082616 CAGGACCAATAGAGGCTAGAAGG - Intergenic
934224355 2:90117958-90117980 CAGGACCAATAGAGGCTAGAAGG + Intergenic
935410596 2:102757881-102757903 CAGGAAAAAGAGAGTGAAGTGGG + Intronic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
937043735 2:118839766-118839788 AAGGAAAAATGGAGAGAAGATGG + Intergenic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939009571 2:136829914-136829936 AAAGATAAAAAGAGGCAAGAGGG - Intronic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
939183637 2:138833679-138833701 AAGGATAAAGAAATGGAAGAAGG - Intergenic
939255450 2:139738468-139738490 TAGGATAAATGTAGGTAAGATGG + Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939828665 2:147046370-147046392 CAGGAACAATAGAGGGAAAGAGG - Intergenic
940086132 2:149861198-149861220 CAGGAGGAATAGAGAGAAAAGGG + Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
941124823 2:161571999-161572021 AAGAAAAAATTGAGGGAAGATGG - Intronic
941169672 2:162121246-162121268 CAGGATCAATAGACTGAAGACGG + Intergenic
942374079 2:175318075-175318097 CATGATGAATAGACAGAAGATGG + Intergenic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
942892081 2:181002825-181002847 CACAATAAAAAGAGGTAAGAGGG - Intronic
943128603 2:183827988-183828010 CAGGAAAGAGAGAGTGAAGAGGG + Intergenic
944209229 2:197189062-197189084 GAGGATAAAAAGAGAAAAGAGGG - Intronic
944486811 2:200215461-200215483 CAAGCCAAATAGAGGGAGGAAGG - Intergenic
944937578 2:204585136-204585158 CAAGAAAACAAGAGGGAAGAGGG - Intronic
945318282 2:208393560-208393582 CAGGAGAAAAAGAGGAGAGAGGG - Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946879060 2:224159517-224159539 CAGGATAGAGAGAGAGAAAAAGG + Intergenic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948336343 2:237210370-237210392 CAGGATAATTAGAGGAGGGACGG - Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
1168973174 20:1944933-1944955 GAGGATAGATGGATGGAAGAAGG + Intergenic
1169178238 20:3538630-3538652 CAGGCTAAATGTAGGGAATAAGG - Intronic
1169180299 20:3559957-3559979 AAGGATAAAAAAAGGGAAAAGGG - Intronic
1169947436 20:11004235-11004257 CAGGATAAATAGAGAATGGAAGG + Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1171014353 20:21526292-21526314 CAGAATAAAAATTGGGAAGATGG - Intergenic
1171490861 20:25516107-25516129 CAGGAGGAATAGAGTGAAGCGGG - Intronic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172896601 20:38304616-38304638 GAGGTTACATAGAGGGAAGGAGG - Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173300048 20:41794437-41794459 TAGGAGAAAAAGAGGAAAGAAGG - Intergenic
1173336495 20:42116321-42116343 CAGGATGATTAGTGAGAAGAGGG - Intronic
1173584462 20:44171688-44171710 CAGGATGAATAGAGGTAAACTGG - Intronic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174026091 20:47576855-47576877 CAAAATAAATACAGGAAAGAGGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177402625 21:20624996-20625018 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1179474718 21:41635819-41635841 ATGGATATATAGAGGGATGATGG - Intergenic
1182655670 22:31887924-31887946 CATGATTTATAGGGGGAAGAAGG + Intronic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1184093731 22:42305570-42305592 CAGGACAAATGGATGGATGAAGG + Intronic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
1184635478 22:45825313-45825335 AAAGAAAAATAAAGGGAAGAGGG - Intronic
949655645 3:6215402-6215424 TTGGATAGATAGAGGGAAGCAGG + Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950281266 3:11710048-11710070 CAGGAGCAAAAGAGGCAAGAAGG + Intronic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
952078128 3:29723525-29723547 CAGTTTAAATAGAGCTAAGAAGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
953565945 3:44032211-44032233 CATGATCAATATAGGGAGGAGGG + Intergenic
954843069 3:53530273-53530295 CAGGAAAAATACAGGGAAAAAGG + Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955316127 3:57940672-57940694 CAGATTAAAAAGGGGGAAGAAGG + Intergenic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
956922224 3:73941940-73941962 CAAGATAAATAGAGGAAACTGGG - Intergenic
957114161 3:76003191-76003213 CAGGATTAAGAGAGGGCATAGGG - Intronic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
960671890 3:120162406-120162428 TAGGAGAAAAAAAGGGAAGATGG - Intergenic
960701989 3:120448682-120448704 CAGGCAAACTACAGGGAAGAAGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962144817 3:132829724-132829746 AAGGATAAATAGTTGGAAAATGG - Intergenic
962203048 3:133415742-133415764 AGGGATGAATAGAGGGGAGATGG - Intronic
962355269 3:134688679-134688701 CAGGAGCAAAAGTGGGAAGAAGG + Intronic
962511142 3:136101832-136101854 GTGGAAAAATAAAGGGAAGAAGG + Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
962907256 3:139815424-139815446 AAGGAAAAATAGAGGGGAGAAGG - Intergenic
963053534 3:141163388-141163410 CCAGAAAAAGAGAGGGAAGAGGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964472778 3:157072086-157072108 AAGGAAAAAAAGAGAGAAGAAGG + Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965282998 3:166777909-166777931 AATTATAAATAGAGGAAAGAAGG + Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966261011 3:177979418-177979440 AAGGAAAGATGGAGGGAAGAAGG + Intergenic
966706048 3:182915028-182915050 CAGGTTATAAAGAGTGAAGAAGG + Intronic
968243949 3:197122481-197122503 CAGTATAAAGATAGGAAAGAAGG + Intronic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
968952946 4:3703981-3704003 TGGGATAATTACAGGGAAGAGGG - Intergenic
969032128 4:4223951-4223973 GAGGAGAGAGAGAGGGAAGAGGG + Intronic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969169375 4:5347781-5347803 CAGGAGAAAGAGAGCAAAGAGGG - Intronic
969449983 4:7267501-7267523 CTGGATACATGGAGGAAAGATGG + Intronic
969989270 4:11243786-11243808 CAATAAAAATAGAGGGCAGATGG - Intergenic
970398657 4:15696943-15696965 CAGGAAATATAGAGGATAGAGGG - Intronic
970495177 4:16617833-16617855 CATGATAAATGGAGAGAAGGAGG + Intronic
970738904 4:19209581-19209603 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
972208476 4:36807029-36807051 CAGGAGAGAGAGAGAGAAGAAGG + Intergenic
972886281 4:43493218-43493240 CAGGAAAAATAGAGGGAGCTGGG + Intergenic
973849036 4:54943018-54943040 CAGCTTAAATAAAGTGAAGAGGG + Intergenic
974491885 4:62574293-62574315 AAGAAGAAATAGAGGAAAGAAGG + Intergenic
974606629 4:64160200-64160222 CAGGAGAGAGAGAGGGAAGGCGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975237252 4:72013732-72013754 CAGGAAGACTAGAGGGTAGAAGG + Intergenic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975778624 4:77818136-77818158 CAAGATAACTAGAGGCAATACGG + Intronic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
976373306 4:84315345-84315367 GAAGATAAATGGGGGGAAGATGG - Intergenic
976662075 4:87550219-87550241 AAGGACAAAGAGAGGGAAGGAGG - Intergenic
976679153 4:87735548-87735570 CAAGCTACATGGAGGGAAGAGGG - Intergenic
976954046 4:90872266-90872288 CAGGATAGAAGGTGGGAAGAAGG - Intronic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977878853 4:102181414-102181436 CAGGACAAGTAGAGGGCAAAGGG - Intergenic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979502173 4:121453236-121453258 AAGGAAAAAGAAAGGGAAGAAGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
979909542 4:126344542-126344564 AAGGAAAAAGAGAGGGAAGGAGG + Intergenic
980269271 4:130563416-130563438 CAGGAAAAATTGAAGGAAAATGG - Intergenic
980948152 4:139343945-139343967 CACAATAAATATGGGGAAGAAGG - Intronic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
982846839 4:160263843-160263865 GGGGATAGAGAGAGGGAAGATGG - Intergenic
982903447 4:161037882-161037904 CTGGAGAAATAGAGTGAAGGAGG + Intergenic
982917366 4:161228543-161228565 CAGGATATATATAGAGAAGGGGG + Intergenic
983010541 4:162540241-162540263 CAGGAGAAAGAGAGAGAAAAGGG + Intergenic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984362288 4:178750331-178750353 AAGAATAAATACAGGAAAGAAGG - Intergenic
984820756 4:183879794-183879816 GATGCTAAATACAGGGAAGAGGG + Intronic
985220059 4:187695062-187695084 GAGGAAAAATTGAGGGCAGAAGG - Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986879083 5:12147813-12147835 AAGGAAAGAAAGAGGGAAGAAGG - Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
988371745 5:30378803-30378825 CAGGATAAAGTAAGGAAAGAGGG + Intergenic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990213892 5:53509466-53509488 CAGGAGAGAGAGAGAGAAGAGGG + Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990552390 5:56896813-56896835 CATGATAAATAAATGGGAGAAGG - Intergenic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
990986231 5:61643251-61643273 CAGGAGCAAGAGAGAGAAGAGGG - Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992902995 5:81317639-81317661 CAGGAGAGATAGAGTGAAGGGGG + Intergenic
993080841 5:83298334-83298356 TAGGATAAACAGAGGGAAATGGG - Intronic
993275505 5:85851418-85851440 CAGGAAAAAGAGAGAGAAGGAGG + Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995280957 5:110335214-110335236 TAGGATAAAGAGAGGCAAAATGG + Intronic
995290770 5:110450079-110450101 CAGGAGACAGAGAGGAAAGAGGG - Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995785182 5:115820122-115820144 GGGGATAACTAGAGGGAGGATGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997712200 5:136015267-136015289 CAGGATAAATAAAGAGAAGTGGG + Intergenic
998477872 5:142436586-142436608 AAGGAAAAATAGAGGTGAGAAGG - Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
999446296 5:151642639-151642661 CAGGAGAAAGAGAGGGCAAAGGG + Intergenic
1000016335 5:157280572-157280594 CAGGAGAAAAAAAGGGAAGTTGG + Intronic
1000388585 5:160699792-160699814 CATGAGAAATAGAGATAAGATGG + Intronic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000681858 5:164194937-164194959 CAGAATAAATAGGGGGAAACTGG - Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001780848 5:174367839-174367861 TAGGAGAAAAAGAGGCAAGATGG + Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1005500614 6:26426141-26426163 AAGGAAAAAAAGAGGGAAGTAGG - Intergenic
1006100232 6:31681801-31681823 CAGGATGATAAGGGGGAAGATGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007263771 6:40582197-40582219 CAGGAAACATGGAAGGAAGAGGG + Intronic
1008699311 6:54079815-54079837 CAGGACAAATACAGGGATGATGG - Intronic
1008854303 6:56063354-56063376 GAGGTTAAATGAAGGGAAGAAGG + Intronic
1008938288 6:57016664-57016686 CAGGAAAAAGAGACAGAAGAGGG - Intronic
1009292919 6:61906543-61906565 CAGGAAGAATAGTGGGAAGGAGG - Intronic
1009567779 6:65334761-65334783 CACAATAAAAGGAGGGAAGAAGG - Intronic
1011764560 6:90606188-90606210 CAGAATAACTTGAGGGTAGATGG - Intergenic
1011823461 6:91279258-91279280 CAGCATAAATAGAGATATGATGG + Intergenic
1012511715 6:100010134-100010156 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1012670803 6:102044736-102044758 CAGGTTAGATGTAGGGAAGAGGG - Intronic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1013854666 6:114557377-114557399 TAGGATAAATGAAGGGAGGAAGG - Intergenic
1013855989 6:114572584-114572606 CAGGAGAAAGAGAGTGAAGGAGG - Intergenic
1014016019 6:116531063-116531085 CAGGATAATTAGATAGAACATGG - Intronic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1016201393 6:141414380-141414402 GAGGATAGTTAGAGGGTAGATGG - Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018204289 6:161422687-161422709 AAGGAAAAATAGAGGAAAAAAGG + Intronic
1018463033 6:164017205-164017227 ATGGAGAAATAGAGGGACGAGGG - Intergenic
1018814856 6:167322976-167322998 CAGGCTCAGTAGAGGGTAGAAGG + Intergenic
1018903954 6:168064495-168064517 CAGGATACTTAGAGAGAAGCAGG + Intronic
1019559703 7:1649895-1649917 CAGGAGAGGTAGAGGGGAGATGG + Intergenic
1020704459 7:11526696-11526718 CAGGAGAAAGAGAGGGGAAAGGG - Intronic
1020825320 7:13020346-13020368 CATGATAAATAGAGAAAAGTCGG + Intergenic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1021385803 7:20028296-20028318 CAGGAGAGAGAGAGGGAAAAGGG - Intergenic
1021483450 7:21143597-21143619 AAGGATAAAGAAAGAGAAGAAGG + Intergenic
1021605422 7:22404934-22404956 CAGGATAAATAAATGGTAAATGG + Intergenic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1025174653 7:56792490-56792512 CAAGATAAAAAGGAGGAAGACGG + Intergenic
1025581703 7:62727780-62727802 CAGGATAAAAACTGGAAAGAAGG + Intergenic
1025697150 7:63783924-63783946 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025826902 7:65018035-65018057 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025914448 7:65854453-65854475 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025964882 7:66259898-66259920 AAGGATAAATAGGGGGAACACGG - Intronic
1026559081 7:71433129-71433151 AAGTAAAAATAGAGGAAAGATGG + Intronic
1026603375 7:71795322-71795344 CCAGAGAAAAAGAGGGAAGATGG - Intronic
1026941744 7:74291020-74291042 CAGGAGAAATAGCGTGAATAAGG + Intronic
1027990720 7:85357329-85357351 TGGTATAAATTGAGGGAAGAGGG + Intergenic
1028167567 7:87555984-87556006 AAGGAGAAATAAAGGAAAGAAGG + Intronic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1029984620 7:104911711-104911733 CAGGAGAAATAGAGAGAATAAGG + Intergenic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1030552294 7:110977726-110977748 CAGGAAAAAGAAAGGAAAGAAGG - Intronic
1030695202 7:112577634-112577656 CAGGAGCAAGAGAGTGAAGAGGG + Intergenic
1031301285 7:120064328-120064350 CAGGAGAGATACAGGGAAGGGGG - Intergenic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032248263 7:130231414-130231436 CAGGAGAAAGAGAGTGAAGTGGG + Intergenic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033843383 7:145402694-145402716 CAGGAGAAATAAAGGGAACTGGG - Intergenic
1033926244 7:146464573-146464595 GAAGAGAAAAAGAGGGAAGAAGG - Intronic
1034121627 7:148633225-148633247 CAGGAGCAATAGAGGAAAGGGGG - Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034721555 7:153298855-153298877 CAGGATAAATAGAAGACAGAAGG - Intergenic
1035972798 8:4270288-4270310 CAGTATAAAGACTGGGAAGAAGG - Intronic
1036798467 8:11772442-11772464 CATTATAAATTGAGGGAACAGGG - Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037601567 8:20400628-20400650 AAGAATAAGTAAAGGGAAGATGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038650852 8:29402009-29402031 TCTGATAAAGAGAGGGAAGAGGG - Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039953033 8:42187148-42187170 GATGATAAATAGACGGTAGATGG - Intronic
1040652704 8:49466563-49466585 CAGGACAAAATGAGGGAAGAGGG + Intergenic
1041692608 8:60703750-60703772 CTGGCTCAATAGAGGGAAGGTGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042790972 8:72605781-72605803 GAGCATAAATATAGAGAAGATGG + Intronic
1042803300 8:72744599-72744621 GGGGCTAAATAGAGGAAAGATGG + Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1044320775 8:90798451-90798473 GGGGACTAATAGAGGGAAGAGGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1046220793 8:111211584-111211606 AAGGAGAAAGAAAGGGAAGAGGG - Intergenic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047259113 8:123240679-123240701 GAAGCTAAATAGAGGGAAGGGGG + Intronic
1047365796 8:124210193-124210215 CAGAATAAATAGTGGCTAGAAGG - Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047781090 8:128111705-128111727 AAGGAAAAAGAGAGGGCAGAGGG + Intergenic
1047928615 8:129704461-129704483 CAGGAAAAAAGGAGGGAAGAAGG - Intergenic
1048247793 8:132827660-132827682 TAGGATTAATAGAGGAAAAATGG + Intronic
1048392422 8:133980301-133980323 GAGGAGAAATAGAGTGTAGATGG - Intergenic
1048870992 8:138798562-138798584 TAGCACAAAAAGAGGGAAGAAGG - Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050039744 9:1476626-1476648 AAGGACAAATAAAGGGAAGGTGG + Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051748499 9:20318008-20318030 CAGCACAGATAGAGGCAAGAAGG - Intergenic
1052252134 9:26410913-26410935 GAGAATAAATTGTGGGAAGATGG - Intergenic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1053036337 9:34829772-34829794 CAGTAAAAATAGAGGAAAGGGGG + Intergenic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053736764 9:41107298-41107320 TAAGAAAAATGGAGGGAAGAGGG - Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054691609 9:68324099-68324121 TAAGAAAAATGGAGGGAAGAGGG + Intergenic
1054969312 9:71066827-71066849 CTAGATAAAAAGAGGGAACAGGG - Intronic
1055018549 9:71645078-71645100 AAGGAAAAAAAGAGGGAAGGAGG - Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056115539 9:83437936-83437958 CAGGATAAAAAGAGAGAAGGGGG + Intronic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057524592 9:95787133-95787155 CAGGATAAAGAGAGTGGAGGGGG - Intergenic
1059106945 9:111520285-111520307 CAGAATAGGTACAGGGAAGAGGG - Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1061022069 9:128022423-128022445 CAGGACAGAAAGAGGCAAGAGGG + Intergenic
1061595200 9:131624473-131624495 CAGGGTCTATAGAGGGGAGAAGG - Intronic
1061673907 9:132204545-132204567 CAGGAAAAACAGGGGCAAGAAGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1186173930 X:6905497-6905519 CAGGAGAGAGAGAGAGAAGAGGG + Intergenic
1187073857 X:15914838-15914860 CAGGAGAAAGAAATGGAAGATGG - Intergenic
1187204896 X:17172404-17172426 CAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1187923449 X:24228550-24228572 CAGGGTAAATACATGGAAGTGGG + Intergenic
1188029914 X:25252801-25252823 GAGGAGACATACAGGGAAGAAGG + Intergenic
1188901750 X:35741276-35741298 AAGGAGAGATAGAGGGAAGGAGG + Intergenic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1191589237 X:62862537-62862559 CGAGATAGATAGAGAGAAGAAGG - Intergenic
1192675826 X:73195251-73195273 GAGGATAGAGAGTGGGAAGAAGG - Intergenic
1193498842 X:82247407-82247429 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1193729834 X:85089464-85089486 CAGGAAAAATAGAGAGCAAAGGG - Intronic
1193965269 X:87976837-87976859 CAGGAGAAAGAGAGAGAAGTGGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194453720 X:94077047-94077069 CAGGAGAAAGAAAGTGAAGAAGG - Intergenic
1194769648 X:97886049-97886071 AAGGAGAAATAGAGGGGAAAAGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196458782 X:115908694-115908716 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196462766 X:115947121-115947143 GAGGATGAATAGAAGGCAGAGGG + Intergenic
1196664481 X:118302304-118302326 AAGGATAAATATAGTTAAGATGG + Intergenic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199628678 X:149761736-149761758 CAGGATCAATGGGAGGAAGAGGG - Intergenic
1200366202 X:155667355-155667377 CAGGACAAATAGGGGGAAATTGG + Intronic
1201517668 Y:14835446-14835468 AAGGAAAGAAAGAGGGAAGAGGG + Intronic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic
1202241986 Y:22780640-22780662 CATGACAAGTAGAGAGAAGAAGG - Intergenic
1202394970 Y:24414384-24414406 CATGACAAGTAGAGAGAAGAAGG - Intergenic
1202475814 Y:25255708-25255730 CATGACAAGTAGAGAGAAGAAGG + Intergenic