ID: 1017913406

View in Genome Browser
Species Human (GRCh38)
Location 6:158814244-158814266
Sequence ACCACAGCTGTTCCTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017913403_1017913406 15 Left 1017913403 6:158814206-158814228 CCCTAAGCAGCTGTGGGAAAAGC 0: 1
1: 0
2: 1
3: 9
4: 198
Right 1017913406 6:158814244-158814266 ACCACAGCTGTTCCTCCCTGTGG No data
1017913404_1017913406 14 Left 1017913404 6:158814207-158814229 CCTAAGCAGCTGTGGGAAAAGCA 0: 1
1: 0
2: 2
3: 26
4: 252
Right 1017913406 6:158814244-158814266 ACCACAGCTGTTCCTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017913406 Original CRISPR ACCACAGCTGTTCCTCCCTG TGG Intronic
No off target data available for this crispr