ID: 1017913987

View in Genome Browser
Species Human (GRCh38)
Location 6:158818472-158818494
Sequence CCCAGCATGAAGGGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017913968_1017913987 24 Left 1017913968 6:158818425-158818447 CCAGTTGGGGGTGGGTCCGAGGA 0: 1
1: 0
2: 2
3: 15
4: 132
Right 1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 252
1017913966_1017913987 25 Left 1017913966 6:158818424-158818446 CCCAGTTGGGGGTGGGTCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 252
1017913973_1017913987 8 Left 1017913973 6:158818441-158818463 CCGAGGAGAGGGGGTGCGCACCC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 252
1017913963_1017913987 28 Left 1017913963 6:158818421-158818443 CCCCCCAGTTGGGGGTGGGTCCG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 252
1017913964_1017913987 27 Left 1017913964 6:158818422-158818444 CCCCCAGTTGGGGGTGGGTCCGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 252
1017913965_1017913987 26 Left 1017913965 6:158818423-158818445 CCCCAGTTGGGGGTGGGTCCGAG 0: 1
1: 0
2: 0
3: 6
4: 158
Right 1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017913987 Original CRISPR CCCAGCATGAAGGGGCTGGT GGG Intronic
900335568 1:2161341-2161363 CCCAGCATCAGGGGCCTGGCAGG + Intronic
900505922 1:3029708-3029730 CCCAGGAAGAAGGGGTTGGTGGG + Intergenic
901008025 1:6180913-6180935 CCCAGCCTGGAGGGGCTTTTTGG - Intergenic
902604474 1:17561270-17561292 GCCAGCATGACGGGGCGGGGGGG - Intronic
904409714 1:30318185-30318207 CACAGCAGGAAGGGGCGGGCTGG + Intergenic
904748363 1:32725287-32725309 CCCAGCTGGAAGGGGCAGGAAGG - Intergenic
907670814 1:56473420-56473442 CCCAGAAGGAAGGGTCAGGTAGG + Intergenic
912172078 1:107112947-107112969 CTCAACATGAAGTAGCTGGTTGG + Intergenic
913128043 1:115811502-115811524 CCCAGCAAGAAGGGGTAGTTTGG + Intergenic
917033749 1:170723226-170723248 TGCAGCATGAAGGGCCTGGGTGG - Intronic
917057976 1:171004375-171004397 CCAAGCAGGAATGGGCTGCTTGG + Intronic
920261670 1:204692564-204692586 CTCAGCAGGTAGGGGCTGGTAGG - Intergenic
920396364 1:205648847-205648869 CCCAGCATGATGGGGCAGTGAGG + Intergenic
922236932 1:223729009-223729031 CCGAGAATGGAGGGACTGGTTGG - Intronic
924553255 1:245097931-245097953 CCGAGCATGAAGGGCCTTGTGGG + Intronic
1067438312 10:46294199-46294221 CCCAGGGTGCAGGGGCTGGCAGG + Intronic
1067448825 10:46368944-46368966 GGCAGCAGGAAGGGGCTGGGCGG - Intergenic
1067575103 10:47403948-47403970 CCCAGAGTGCGGGGGCTGGTGGG + Intergenic
1067588547 10:47491821-47491843 GGCAGCAGGAAGGGGCTGGGCGG + Intergenic
1067635673 10:47999912-47999934 GGCAGCAGGAAGGGGCTGGGCGG + Intergenic
1068611063 10:59060852-59060874 CCAAGCATGAAGGGGGTGATGGG + Intergenic
1069724287 10:70567355-70567377 CCCAGCCTGGTGGGGCTGGCAGG + Exonic
1070132231 10:73663919-73663941 GGCAGCAGGAAGGGGCTGGGCGG + Intergenic
1071334377 10:84589251-84589273 CCAGGGATGAGGGGGCTGGTAGG - Intergenic
1071609451 10:87020156-87020178 GGCAGCAGGAAGGGGCTGGGCGG - Intergenic
1073051132 10:100668101-100668123 CCCAGGGTGATGGGGCTGGGAGG + Intergenic
1073101416 10:101008620-101008642 AGCAGCATCAAGGGGTTGGTGGG + Intronic
1074150561 10:110755921-110755943 CCTAACTTGAAGGGGCTGGATGG - Intronic
1074320003 10:112392953-112392975 CCCAGCCTGAAGGGAGTGGCTGG + Intronic
1075568175 10:123519896-123519918 CCCAATGTGAAGGGCCTGGTTGG - Intergenic
1076732738 10:132446593-132446615 CCCAGCTTGGAGGGGCTTGTGGG + Intronic
1078759649 11:14242082-14242104 CCATGCAGGAAGGGGCTGCTGGG - Intronic
1079117744 11:17651353-17651375 CCCAGGAAGATGGGTCTGGTGGG + Intergenic
1083944699 11:65917414-65917436 CCCAGCATGGAGGGGGGAGTGGG + Exonic
1084279272 11:68076566-68076588 CACAGCATGAGGGTGGTGGTGGG - Intronic
1086560835 11:88167239-88167261 CACAGCATAAAGGGGAAGGTAGG + Intronic
1088797269 11:113274316-113274338 CCCAGCATCAAATGGCTGCTGGG + Intronic
1089127800 11:116189610-116189632 CCCAGCATGGCGGGGCTGCCGGG + Intergenic
1089554437 11:119308313-119308335 CGCAGCACGAAGGGCCTGGCAGG - Intergenic
1089789164 11:120929968-120929990 GCCAGCAAGAAGGGGCTCGAGGG + Intronic
1092889379 12:12954541-12954563 ACCAGCAGGAAGGGGGTGGGAGG - Intergenic
1095990767 12:48033030-48033052 CCCAGCCTGAAGGTTCTGGAGGG - Intergenic
1096406223 12:51346215-51346237 CAAAGCATTAGGGGGCTGGTGGG - Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1098865804 12:75761992-75762014 GCCATCATTGAGGGGCTGGTGGG - Intergenic
1101925536 12:108968450-108968472 CCCAAAATGAAAGGGCAGGTGGG - Intronic
1103948383 12:124539411-124539433 GTGAGCATGAAGGAGCTGGTGGG - Intronic
1110967696 13:81721576-81721598 CACAGCAGGAAGGGGTTGGAGGG + Intergenic
1113912320 13:113848758-113848780 CCCAGCATGGAGAGGCCGCTGGG - Intronic
1116617180 14:47154512-47154534 CCAAGCATGCAGGGGCAGGGGGG - Intronic
1117100676 14:52343232-52343254 CACATCATCAAGGGGGTGGTGGG + Intergenic
1118989982 14:70789213-70789235 CACAGTTAGAAGGGGCTGGTGGG + Intronic
1121015347 14:90545665-90545687 CCCAGCAGGAAGGGACTGGTGGG - Intronic
1121410544 14:93745729-93745751 CCCAGGAAGGAGGGGCTGGCAGG - Intronic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1122419086 14:101564136-101564158 CCCAGCACGGAGCGGGTGGTGGG - Intergenic
1202860663 14_GL000225v1_random:79349-79371 CCCTGCATGCCGGGGCAGGTTGG + Intergenic
1202889839 14_KI270722v1_random:145736-145758 TCCAGAATGGAGGGACTGGTGGG - Intergenic
1202921993 14_KI270723v1_random:35357-35379 CCCCGCATGCCGGGGCAGGTTGG - Intergenic
1202922935 14_KI270724v1_random:2256-2278 CCCCGCATGCCGGGGCAGGTTGG + Intergenic
1124234000 15:27971004-27971026 CCCAGCATGCAAGGCATGGTGGG + Intronic
1124354595 15:28985303-28985325 CAAAGCATGAAGGGGCGTGTGGG - Intronic
1125724495 15:41861389-41861411 CCCAGCAGGAATGGGCAGGAGGG - Intronic
1127258275 15:57309153-57309175 CACAGCATGGAGGTGCTGCTGGG + Intergenic
1127266222 15:57364526-57364548 CCCAGCACGAAGGCGCAAGTAGG - Intergenic
1127902342 15:63350116-63350138 CCCAGCATGTAATGGCTAGTGGG + Intronic
1129251921 15:74313950-74313972 CGCGGCAAGGAGGGGCTGGTAGG - Intronic
1129456189 15:75677209-75677231 CCCAGCATGGAGGGGCTCCTCGG + Exonic
1131261439 15:90890071-90890093 CCCTGCAGGCAGGGGCGGGTGGG - Exonic
1132581048 16:684783-684805 CACATCATGAAGTGGCTGGAAGG - Exonic
1132666358 16:1082962-1082984 ACCAGCATGAAAGGCCGGGTGGG + Intergenic
1132797043 16:1729715-1729737 CCCAGGAGGAGGGAGCTGGTTGG + Intronic
1132881381 16:2163143-2163165 CCCAGAAGAGAGGGGCTGGTGGG - Intronic
1133070866 16:3246127-3246149 CCCAGCAGGAAGGGGAGGGGAGG - Intronic
1133270510 16:4608973-4608995 CCCAGCAGGCAGGCGCTGGGAGG + Exonic
1136287522 16:29253160-29253182 CCCAGGATGAAGATGCTGGCAGG - Intergenic
1138112816 16:54338029-54338051 CCCAGCATGAAGAAGCTTCTTGG + Intergenic
1138444444 16:57054773-57054795 GCCAGCAGGAAGGGGCTTTTCGG - Exonic
1138599498 16:58046337-58046359 CCCAGGGAGAGGGGGCTGGTGGG + Exonic
1138715870 16:59021509-59021531 CCCAGCAGGGAGGGGCTGGAGGG + Intergenic
1141212321 16:81993105-81993127 CCCTGCATAAAGGAGCAGGTGGG + Exonic
1141436448 16:84002373-84002395 CACAAGAAGAAGGGGCTGGTGGG - Exonic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141996486 16:87639377-87639399 CCCTGCATGAAGCTCCTGGTGGG + Intronic
1142239481 16:88938676-88938698 CCCAGCATGGAGGGACTAGCAGG - Intronic
1142271200 16:89090339-89090361 CCCAGCACGAGGGTGCAGGTGGG - Intronic
1142396607 16:89835528-89835550 CACAGCCTGTAGGGACTGGTTGG + Intronic
1142481289 17:219770-219792 GCCTGCAGGTAGGGGCTGGTCGG - Intronic
1142629642 17:1216489-1216511 TCCAGCCTGAAGGGGCCCGTCGG + Intronic
1143102899 17:4513993-4514015 CCCTGGAGGGAGGGGCTGGTGGG - Intronic
1143307381 17:5958206-5958228 CACAGGAGGAAGGTGCTGGTTGG - Intronic
1143788184 17:9272356-9272378 CCCGGCAGGGAGTGGCTGGTAGG + Intronic
1146642990 17:34555267-34555289 CCCAGCCCGGATGGGCTGGTGGG - Intergenic
1146906862 17:36623607-36623629 CCCAGCCTGAAGGGGAGGGTGGG + Intergenic
1146956400 17:36938625-36938647 CCAAGCTTGAAGGGGCTTCTGGG - Intronic
1148485210 17:47986529-47986551 CCCAGGCTGAAAAGGCTGGTGGG - Intergenic
1148686629 17:49504707-49504729 CCCAGGAAGAAGGGCCTGGAGGG - Intronic
1150209330 17:63433637-63433659 CCCAGCAGGAAGGGGCTGCAAGG + Exonic
1150266923 17:63837930-63837952 CACAGCATGCTGGGGCTGGAAGG - Intronic
1150289503 17:63973286-63973308 GCCAGGATGAGGGGCCTGGTTGG + Intergenic
1151151804 17:72094898-72094920 CCCAAGATGAAGGTGGTGGTTGG - Intergenic
1151342406 17:73480436-73480458 CCCAGGAAGAAGGAGCTGGATGG + Intronic
1151350024 17:73526222-73526244 TTCAGCATGATGGGGCTGGAGGG + Intronic
1151354182 17:73548773-73548795 CCCACCATGCAGAGCCTGGTTGG - Intronic
1151548905 17:74809964-74809986 CTCAGCAACCAGGGGCTGGTCGG - Intronic
1151746642 17:76015167-76015189 CCCAGCATTCAGGGGCGGGTGGG - Intronic
1151834815 17:76575574-76575596 CCCAGAATCAAGGTGCTGGCAGG - Intronic
1152162337 17:78676681-78676703 CCCAGCACGATGCTGCTGGTGGG + Intronic
1152334845 17:79694994-79695016 CCCAGCAGGGATGGGCTGGGTGG - Intergenic
1157856523 18:51110129-51110151 CCCAGCGAGAAGGGGCTAGCAGG + Intergenic
1158539857 18:58343250-58343272 CCCTGCATAAATGGGCGGGTGGG + Intronic
1160894462 19:1396114-1396136 CGACGGATGAAGGGGCTGGTGGG - Intergenic
1161216460 19:3097181-3097203 CCCGGAAGGAAGGGGCTGTTGGG + Intronic
1161414914 19:4140597-4140619 CCCAGCAGGATGGGCCTGGGTGG + Intergenic
1161457131 19:4375089-4375111 CCACGCATGGAGGGGCAGGTGGG - Intronic
1163348083 19:16757356-16757378 CTCCGCATGGAGGGGCTGGTTGG + Intronic
1163826608 19:19527858-19527880 CCCAGGACCAAGGGGGTGGTGGG + Intronic
1165766740 19:38356376-38356398 CCAAGGACGGAGGGGCTGGTGGG + Intronic
1166070041 19:40381614-40381636 CACAGCAAGAAGGGTCTGGATGG - Intronic
1166283563 19:41810367-41810389 CCCAGTAGAAAGGGGCTGGAAGG - Intronic
1166767880 19:45263223-45263245 CCCCGCAGGAAGGGTCAGGTGGG - Intronic
1167418975 19:49391872-49391894 CCCAGTCTGATGGGGATGGTAGG + Intronic
1167724474 19:51201027-51201049 CCCAGCATGCAGGGGTCGGGAGG - Intergenic
1167758279 19:51426826-51426848 CCCAGCATGCAGGGGTCGGGAGG + Intergenic
1167894600 19:52570776-52570798 CCCAGCATGAGGCGGGAGGTGGG - Exonic
925835610 2:7943463-7943485 CCCATCCTGGAGAGGCTGGTGGG + Intergenic
926297912 2:11581930-11581952 TCCAGGATGGAGGTGCTGGTTGG - Intronic
927178058 2:20424250-20424272 GCCAGCATGAGGGGGCAGGCAGG + Intergenic
927720226 2:25377638-25377660 CCCTGCAGGGAGGGGCTGCTAGG + Intronic
927897050 2:26789625-26789647 CTGAGGATGAAGGGGCTGGAGGG - Intronic
931226950 2:60339975-60339997 CCCATCAGGAAGGGGTTGGATGG - Intergenic
932340485 2:70960165-70960187 CCAAGCAGGCAGGGGCTGGCAGG + Intronic
932413191 2:71559208-71559230 CGCAGCACGGAGGTGCTGGTGGG - Intronic
933558184 2:83857865-83857887 TCCAACATCAAGGTGCTGGTAGG - Intergenic
933939778 2:87235563-87235585 CCCGGCATGAAAGGGCTGCAGGG - Intergenic
935278170 2:101493737-101493759 CCCAAGATGAAGGTGCTGGCAGG - Intergenic
936163143 2:110100058-110100080 CCCAGCATAAAGGTGAGGGTGGG - Intronic
936353360 2:111730210-111730232 CCCGGCATGAAAGGGCTGCAGGG + Intergenic
938082337 2:128376835-128376857 TCCAGGATCAAGGGGCTGGCAGG + Intergenic
938315073 2:130319320-130319342 CCCAGCCTGGAGGGGATGGGCGG + Intergenic
938598362 2:132811898-132811920 CCAGGCAGGAAGGGGCTGCTAGG + Intronic
939725246 2:145711860-145711882 AACAGCATGAATGGGCTAGTTGG + Intergenic
941568581 2:167140925-167140947 CCCAGTAAGAAGGGGCAGCTGGG + Intronic
941627347 2:167844609-167844631 CCCAGCAGGAAGGGCCTGTTTGG - Intergenic
948035101 2:234852162-234852184 CACAGCATGAGGGAGCTGGCAGG - Intergenic
948507929 2:238442977-238442999 ACAAGCAAGAAGGGGGTGGTGGG - Intronic
948589260 2:239038903-239038925 CTCAGTGAGAAGGGGCTGGTTGG + Intergenic
1168814417 20:727105-727127 CCCAGGCTGAAGGGGCCGGGTGG + Intergenic
1170775505 20:19371592-19371614 CCCTGTATGTAGGGGGTGGTGGG - Intronic
1170891583 20:20380716-20380738 TCCAGCATGCTGGGGCTGTTAGG + Intergenic
1171139141 20:22725717-22725739 TCCAACATAAAGGTGCTGGTTGG + Intergenic
1171225076 20:23436032-23436054 CCCAGAGTGGAGGGGCTTGTGGG - Intergenic
1172777085 20:37414100-37414122 CCGAGCCTCAAGGGGCGGGTGGG - Intergenic
1172877604 20:38175379-38175401 TCCAGCAAAAAGGAGCTGGTGGG + Intergenic
1172943227 20:38668821-38668843 CCAAGCATGAAGCGGGTGGGTGG - Intergenic
1173253242 20:41375515-41375537 CCCACCATGGAGTGGGTGGTTGG + Intergenic
1175800132 20:61796756-61796778 CCCAGCAGGATGGGGGTGCTGGG - Intronic
1176043420 20:63080145-63080167 CCCAGCACCAAGGTGTTGGTAGG - Intergenic
1176110456 20:63408429-63408451 CCCAGCATGATGGGACGGCTCGG - Exonic
1176254603 20:64145313-64145335 CCAAAAGTGAAGGGGCTGGTGGG - Intergenic
1177782202 21:25633586-25633608 CACAGCATGAATGTGCTTGTGGG + Intergenic
1179580925 21:42343551-42343573 CCCAGGAGGAAGGGGCAGGGAGG + Intergenic
1180083200 21:45496111-45496133 CCCAGCATGGAGGGCTTGGAGGG - Intronic
1180105662 21:45616660-45616682 CCCGGCGGGGAGGGGCTGGTGGG - Intergenic
1180905748 22:19409921-19409943 CCCAGAATCAAGGAGCTGGAAGG - Intronic
1181275762 22:21686706-21686728 CCCAGCCTCATGGGGCTGGCAGG - Intronic
1181282638 22:21730803-21730825 CCCAGAGAGCAGGGGCTGGTGGG - Intronic
1181570821 22:23767125-23767147 CCCATCTTTAAAGGGCTGGTTGG + Intronic
1181631618 22:24154747-24154769 CCCAGGCTGAAGGGGCAGGTTGG + Intronic
1181987412 22:26809916-26809938 ACCAGAATGAAGAGGCTGGGTGG - Intergenic
1182431598 22:30302137-30302159 CTCAGCATAAAGGTGCTGGAGGG + Intronic
1183454092 22:37912145-37912167 CCATGCATGAGGAGGCTGGTGGG - Intronic
1183780483 22:39995652-39995674 CCCAGGAAGTAGGGGCGGGTTGG - Intronic
1184492921 22:44820565-44820587 CCCGGAGGGAAGGGGCTGGTGGG - Intronic
1184727705 22:46356276-46356298 CCGAGCAGGAACTGGCTGGTTGG - Intronic
1185051130 22:48554920-48554942 CACAGCTTGAAGAGGCTCGTAGG - Intronic
1185296970 22:50059127-50059149 CCGACTCTGAAGGGGCTGGTGGG + Intergenic
950997434 3:17518293-17518315 CACAGGATGAAGGGGCAGGGTGG - Intronic
954316797 3:49805846-49805868 CCCAGCCTCCAGGGACTGGTGGG + Intronic
954707106 3:52487028-52487050 CCCAGGATGAGGGCCCTGGTGGG - Intronic
961462947 3:127064520-127064542 CCCAGCTGGAAGGGGCGGGTTGG - Intergenic
962352020 3:134663359-134663381 CCCAGGGTGAAGGGCTTGGTTGG + Intronic
963900115 3:150725707-150725729 CACAGCCGGAAGGGGCTGGGAGG + Intergenic
964879363 3:161406485-161406507 CCCAAGATCAAGGTGCTGGTAGG - Intergenic
966758844 3:183396967-183396989 TCCACCATCAAGGTGCTGGTAGG - Intronic
967082562 3:186063788-186063810 CCAACCTTGAGGGGGCTGGTGGG - Intronic
967558517 3:190889800-190889822 CCCAGCATAAAGGGGCTGAAGGG - Intronic
967910339 3:194537485-194537507 GACAGCATGAGGAGGCTGGTAGG - Intergenic
968605136 4:1531882-1531904 CCCAGCAGGAAGGGGACAGTCGG + Intergenic
969691914 4:8708599-8708621 CCCAGGATGCAGGGCGTGGTGGG - Intergenic
970872529 4:20832746-20832768 CTCAGCATGAAGGATTTGGTAGG + Intronic
972466922 4:39366248-39366270 CCCAGGATGAAGGCGCTGGCTGG + Exonic
975983559 4:80184143-80184165 CCCAGGATGAAGGGGCAGAGGGG - Intronic
981198551 4:141949803-141949825 CTCAGCATGTAGGGCCTGGTGGG + Intergenic
983998545 4:174214218-174214240 CGAAGCCTGAAGAGGCTGGTTGG + Intergenic
984748542 4:183248814-183248836 CCCAGCATCAAGGGTCTGTCTGG - Exonic
985092790 4:186381498-186381520 GCCAGCAGGAATGGGCTGCTCGG - Intergenic
985217865 4:187672349-187672371 GCCAGCAGGAATGGGCTGCTCGG + Intergenic
985381174 4:189396551-189396573 CCCAGCATGAAGGGCTGGGAGGG + Intergenic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987762845 5:22188083-22188105 CCCAGCATGTAGGTGTTGGGAGG + Intronic
988902131 5:35745183-35745205 CCCAGCAGGAATGGGCTGCTTGG - Intronic
989199567 5:38750266-38750288 CCCAGCAGAAAGAGACTGGTGGG - Intergenic
989422665 5:41257773-41257795 TTCAGCATGAGGGGGCTGGGAGG - Intronic
989642812 5:43599859-43599881 CCCAAAATGAAGGGGTTGGCAGG - Intergenic
990976504 5:61565832-61565854 AGGAGCATGAAGAGGCTGGTAGG - Intergenic
991897631 5:71421481-71421503 CCCAGCATGTAGGTGTTGGGAGG + Intergenic
993504610 5:88694143-88694165 CCCAGCGGGTGGGGGCTGGTGGG - Intergenic
994922805 5:106071731-106071753 CACAGCATGAAGTGGCTATTTGG + Intergenic
997370404 5:133356261-133356283 CCATGAATGAAGGGGCTGATTGG - Intronic
997926027 5:138032397-138032419 CCCAGCATGAAGGAAGTGGGCGG + Intronic
998381973 5:141732128-141732150 CCCAGCTTCAAAGGGCTGGGGGG - Intergenic
1001671796 5:173479810-173479832 TCCAGCATGCAGAGGCTGCTTGG + Intergenic
1001746669 5:174098004-174098026 CCCAGCAGAAGGTGGCTGGTAGG + Intronic
1002058508 5:176612261-176612283 GCCAACATGAAGGGACTGGCTGG + Intergenic
1003354742 6:5356976-5356998 CACAGTATGATGGGGCTGTTTGG + Intronic
1006246748 6:32743748-32743770 CCCAGCATGACTGCCCTGGTTGG - Intronic
1006520817 6:34570131-34570153 ACCAGCCGGCAGGGGCTGGTGGG - Intergenic
1006626203 6:35399718-35399740 CCCTGTATGAAGAGGGTGGTAGG - Intronic
1006839066 6:37016493-37016515 CCCTGCATCATGGGGCTGTTAGG - Intronic
1007838570 6:44697006-44697028 CCCAGCATGAAGGGAATGTGTGG - Intergenic
1010877123 6:81120558-81120580 CACAGCAGGAGGTGGCTGGTGGG + Intergenic
1013949863 6:115766899-115766921 CCCAGCAGGAAGACGCTGGCAGG - Intergenic
1017028286 6:150199535-150199557 TCCAAGATGAAGAGGCTGGTGGG - Intronic
1017913987 6:158818472-158818494 CCCAGCATGAAGGGGCTGGTGGG + Intronic
1021345268 7:19519651-19519673 CACAGAATGAAGGGGCAGGAGGG + Intergenic
1022774624 7:33513127-33513149 CCCAGAATGAAGGGGGTAGCCGG - Intronic
1026804923 7:73423786-73423808 CCCAGCACGGCGGGGCAGGTGGG - Intergenic
1031405840 7:121385865-121385887 CCCAGCAACTAGAGGCTGGTGGG - Intronic
1031803037 7:126273429-126273451 CCCAACATCAAGGGGCTTTTGGG - Intergenic
1033820576 7:145129881-145129903 CCTGGCATGAAGAGGCTGCTGGG + Intergenic
1034272753 7:149811309-149811331 CCCAGGATCAAGGTGTTGGTGGG + Intergenic
1034461470 7:151200080-151200102 CCCAGCTGGAAGGGGCTGCAGGG - Intronic
1034973141 7:155431608-155431630 CCCAGCATGCAGCCGCTGGGTGG + Intergenic
1035918900 8:3655593-3655615 CCCTGCCTGAGGGGCCTGGTGGG - Intronic
1038266061 8:26040756-26040778 CTCAGCATGGAGAGGCTGCTTGG - Intronic
1038363845 8:26910500-26910522 CACAGCATGAAGGAGTGGGTGGG + Intergenic
1038558691 8:28549049-28549071 TCCAGGATGAAGGTGCTGGCAGG + Intronic
1039721978 8:40174137-40174159 ACAAGCATTAAGGGGATGGTGGG + Intergenic
1040387836 8:46925541-46925563 ACCAGCAAGCAGGGGCTGCTGGG - Intergenic
1040576790 8:48659430-48659452 CCCAGCATGTTGGAGCAGGTTGG - Intergenic
1041656076 8:60351897-60351919 TCCAAGATCAAGGGGCTGGTAGG - Intergenic
1041847408 8:62346573-62346595 CCCAGTGTGAAGGGGCTGACTGG + Intronic
1044331830 8:90929573-90929595 CCCAGAAGGAAGAGTCTGGTTGG + Intronic
1044966150 8:97575841-97575863 CCCAAAATTAAGGTGCTGGTAGG - Intergenic
1045287398 8:100803934-100803956 CCCATCATGAAGGGGAAGGGAGG - Intergenic
1047361877 8:124176554-124176576 ACCAGCATCAAGGTGTTGGTAGG - Intergenic
1047528066 8:125650617-125650639 CCCAGCATCCTGGGGTTGGTGGG + Intergenic
1048924065 8:139254865-139254887 CCCAGCTTGAAGGCTGTGGTGGG + Intergenic
1052456012 9:28699299-28699321 CCCCGAATGAAGGGACTGGCTGG + Intergenic
1056054807 9:82810220-82810242 CCCATCATGAAGGAGTGGGTTGG - Intergenic
1057761369 9:97877313-97877335 CCCAGCAAGAAGATGCTGATGGG - Intergenic
1058012705 9:99996128-99996150 CCCAACATGGAGGTGCTGGTAGG + Intronic
1058225402 9:102355622-102355644 CCCAGAATGGAGGGACTGGCTGG + Intergenic
1058645825 9:107130835-107130857 CCCAGCGTGACAGGGCTGGAAGG + Intergenic
1058723500 9:107780133-107780155 TCAAGCAGGAAGGGGCTGGTGGG + Intergenic
1058774512 9:108270433-108270455 CCCAGAATGGAGGAGATGGTAGG - Intergenic
1059449440 9:114361150-114361172 CCCATGATGTAGGGGCTTGTGGG - Intronic
1060705715 9:125798416-125798438 ATCAACATCAAGGGGCTGGTGGG - Intronic
1062356939 9:136169504-136169526 CCCTGCATGAGGGGCCTGGGGGG + Intergenic
1185759859 X:2682177-2682199 TCCAAGATCAAGGGGCTGGTTGG + Intergenic
1186399114 X:9240738-9240760 CCCAGCCTGCAGGGGGTGGGGGG - Intergenic
1187109598 X:16283110-16283132 AACACCATGATGGGGCTGGTGGG - Intergenic
1189857268 X:45235928-45235950 TCCACTATGAAGGGGCTGGCAGG - Intergenic
1190064099 X:47228784-47228806 CCCAGCAGGCAGCGGCTGGAGGG + Exonic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1197953612 X:131923428-131923450 CCAAGCAGGAATGGGCTGCTTGG - Intergenic
1198857360 X:141032602-141032624 CCCCGCATGGAGGGACTGGCTGG - Intergenic
1198905336 X:141554764-141554786 CCCTGCATGGAGGGACTGGCTGG + Intergenic
1199967926 X:152835078-152835100 CCCAGCAGGAAGGAGGAGGTTGG + Intronic
1200213005 X:154355207-154355229 CCCAGCTTGGAGGGGCAGGGCGG - Intronic
1200214935 X:154364017-154364039 CTCACCCTGAAGGGGCTGTTGGG + Exonic
1201175759 Y:11307606-11307628 CCCCGCATGCCGGGGCAGGTTGG - Intergenic
1201614399 Y:15881346-15881368 CCAAGCAAGAATGGGCTGCTTGG + Intergenic
1201615969 Y:15898429-15898451 CCAAGCAAGAATGGGCTGCTTGG - Intergenic