ID: 1017914207

View in Genome Browser
Species Human (GRCh38)
Location 6:158819166-158819188
Sequence TCGCCCGGCACCCCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017914207_1017914212 1 Left 1017914207 6:158819166-158819188 CCTGCCCCGGGGGTGCCGGGCGA 0: 1
1: 1
2: 0
3: 17
4: 172
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017914207 Original CRISPR TCGCCCGGCACCCCCGGGGC AGG (reversed) Intronic
900109733 1:1000387-1000409 GGGCCCGGGACCCCCGGGGCTGG + Intergenic
900139783 1:1134852-1134874 TCGCCAGGCTCCCTGGGGGCTGG + Intergenic
900350739 1:2233307-2233329 ACGCCCGGCCCCCTCGGAGCAGG - Intronic
901670221 1:10851669-10851691 TCGCTCCTCACCCCAGGGGCTGG - Intergenic
901848322 1:11998905-11998927 GCTCCCAGCACCCCCTGGGCAGG + Intronic
901928022 1:12579247-12579269 GCTCCCTGCACGCCCGGGGCTGG + Intronic
905891529 1:41521400-41521422 CCTCCCTGCACCCCCGTGGCGGG - Intronic
910145681 1:84077923-84077945 AGGCCCGGGACCCCGGGGGCGGG - Intergenic
911647385 1:100351657-100351679 TCGCCCCGCCCCTCCGGGACCGG + Intergenic
912502338 1:110130577-110130599 TCGCCTGACACCCCCGGGAACGG + Intergenic
914678961 1:149925898-149925920 TCGGCAGGAACCCCAGGGGCAGG - Exonic
920037602 1:203076038-203076060 TCCCCCGTCAGACCCGGGGCGGG - Intronic
920353416 1:205352713-205352735 TCACTCGGCACTCCTGGGGCAGG + Intronic
924238673 1:242021004-242021026 TAGCCGGGCACCGCCGTGGCTGG - Intergenic
924502806 1:244653005-244653027 GCGCCAGGCGCCCCGGGGGCGGG - Exonic
1064067633 10:12196160-12196182 TCGGCGGGCACTTCCGGGGCCGG + Exonic
1066186088 10:33012107-33012129 TCCCCCTGCACCCCCGTGCCAGG - Intergenic
1067671772 10:48330641-48330663 TAGGCAGGCACACCCGGGGCAGG + Intronic
1069840780 10:71338067-71338089 GCGCCTGGCACCCCTGGGCCAGG + Intronic
1070895621 10:79981549-79981571 TCGCCTCGCTCCCCCTGGGCTGG - Intronic
1075999856 10:126905758-126905780 CCGACCCGCATCCCCGGGGCTGG - Intronic
1076005111 10:126942594-126942616 TGGCTCGGCTCCCTCGGGGCTGG - Intronic
1076258375 10:129046338-129046360 GCGCCCGGCTCCCCGGGGCCGGG + Intergenic
1076690793 10:132223041-132223063 TAGCCCGCCACCCCCAGGCCAGG + Intronic
1076792680 10:132785512-132785534 CCGCCCCGCACCCCCCGCGCGGG + Intronic
1076912999 10:133401712-133401734 CCGCTGAGCACCCCCGGGGCAGG + Intronic
1076944969 10:133640543-133640565 TCCTCCCGCGCCCCCGGGGCTGG + Intergenic
1077098485 11:810156-810178 TCGCCCGGCGGCCCCGGGATGGG + Intronic
1077121575 11:911152-911174 TCTCCCGGCACCGCCGAGCCGGG - Intronic
1077204640 11:1336666-1336688 TCGCCGGGCGCCCGCGTGGCGGG - Intergenic
1077273228 11:1691570-1691592 TGGCCCCGCACCCCTGGGGCAGG + Intergenic
1078594684 11:12675293-12675315 GCGCCGGGTACCCCCGAGGCCGG + Intronic
1078616451 11:12870556-12870578 TCCCCCGCCCCCCCCGGGGTTGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081799444 11:45847748-45847770 TCGCCGGTCACCCCAGGGTCAGG - Intronic
1084146289 11:67266898-67266920 GCGACCTGGACCCCCGGGGCCGG + Intronic
1085444491 11:76591472-76591494 TCTCCCGGCACCCGGGAGGCAGG - Intergenic
1089729471 11:120511538-120511560 TCGCCCGGGAGCCCAGGCGCGGG - Intergenic
1091750890 12:3020674-3020696 GCCCCCGGCACCCCCATGGCAGG + Exonic
1096489987 12:52007874-52007896 TCGCAGGGCGCCCGCGGGGCAGG + Intronic
1096648280 12:53049786-53049808 TCACCCGGCCCCACCGGGGGTGG + Intronic
1097712622 12:62933346-62933368 TGGCCCGGATACCCCGGGGCAGG - Intronic
1102370895 12:112381886-112381908 TCGCCCGGCACCCCCGGGTCGGG - Intronic
1102679984 12:114684734-114684756 CCGCCCGGCTCGCCCGGGGCGGG - Intergenic
1104037192 12:125105635-125105657 TAGCCCGACACCCCAGGGGCTGG + Intronic
1104589775 12:130075015-130075037 TCCCCCTCCACCCCCGAGGCGGG + Intergenic
1104739785 12:131164179-131164201 TCTCCCGCCAGCCCTGGGGCAGG + Intergenic
1104980491 12:132571213-132571235 TCACCTGGCACTCCCGGGGTCGG - Intronic
1106665447 13:31846706-31846728 TCGCCCGGCGCGCACGGGGCGGG + Intergenic
1118571537 14:67199888-67199910 TCGGCAGGAACCCCAGGGGCAGG + Intronic
1119522180 14:75294393-75294415 TCGCCCAGCATTCCAGGGGCGGG - Intergenic
1122792104 14:104188339-104188361 TGGCCCGCCGCCCCTGGGGCTGG - Intergenic
1122835265 14:104427665-104427687 TCCCCCTGCACCCCAGGGCCTGG + Intergenic
1122931120 14:104933474-104933496 TCCCCCGGCAGCCTCGGGGCGGG - Exonic
1123705102 15:22945377-22945399 TCCTCCTGCACACCCGGGGCTGG - Intronic
1125155401 15:36579646-36579668 TCCACCGGCACCTCCGCGGCGGG - Exonic
1128075695 15:64824040-64824062 GCCCACGACACCCCCGGGGCCGG - Exonic
1128133966 15:65249304-65249326 TCCCCAGGCAGCCCCTGGGCGGG + Intronic
1128247795 15:66144672-66144694 TCCCCCAGCCACCCCGGGGCTGG + Intronic
1128326798 15:66729249-66729271 TCCCCCGGCACCCCTGAGGCCGG + Intronic
1129270698 15:74417883-74417905 ACGCCCGGCACCCCAGCTGCTGG - Exonic
1130348138 15:83067357-83067379 ACTCCCGGCAGCCCCAGGGCAGG + Intergenic
1131175230 15:90205098-90205120 CCGCCCGGCACTTCTGGGGCAGG - Intronic
1131692803 15:94845059-94845081 TCGCCCGCCGCCCCCTGGCCAGG + Intergenic
1131832087 15:96360613-96360635 CCGCCCCGCACCCCCGGCCCAGG + Intergenic
1132365285 15:101252159-101252181 CCGCCCGGCGCCCGCGGGGCCGG + Intergenic
1132465386 16:75200-75222 TTGCCCAGCACTCCCGGGGCTGG + Intronic
1132519956 16:382300-382322 TCGGCCGGGACCTCCGTGGCAGG + Intronic
1132604644 16:788600-788622 GCGCCCGGCACGCTCGGGGCGGG + Exonic
1132669094 16:1095414-1095436 TCGTCCGGAGCCCCCAGGGCAGG + Intronic
1132678151 16:1129208-1129230 CCGCCCGGCCTCCTCGGGGCAGG - Intergenic
1132915132 16:2340114-2340136 GCGCCCGGCATCCCTGCGGCCGG + Intronic
1133110945 16:3548103-3548125 CCGCCCTGCAGCCCCTGGGCAGG + Intronic
1133131658 16:3679823-3679845 TCACCCGGCTCCCCAGGTGCTGG - Intronic
1136141839 16:28293215-28293237 GCGCCCTGAGCCCCCGGGGCCGG + Exonic
1136242161 16:28951233-28951255 GCCCCCGGAGCCCCCGGGGCCGG + Exonic
1137645064 16:50066432-50066454 GCGGCCGGCACTCCCGGGCCTGG + Exonic
1137665390 16:50246340-50246362 CCGCCGGGCACCCGCGAGGCCGG - Intronic
1138343961 16:56308729-56308751 TGAACCGGCACCCACGGGGCTGG + Intronic
1142156271 16:88534115-88534137 GCCCCCGGGACCCCCTGGGCCGG + Exonic
1142230971 16:88900157-88900179 ACTCCCTGCACCCGCGGGGCCGG - Intronic
1142233935 16:88912634-88912656 ACGCCCGTCTCCCCCAGGGCAGG + Intronic
1143778811 17:9218639-9218661 CCGCCCCCCACCCCCGGGGTGGG + Intronic
1144770384 17:17756158-17756180 TGGCCAGGCACCCCCGTGCCAGG - Intronic
1147160990 17:38569347-38569369 GTGCCAGGCACCCCCGGGCCAGG - Intronic
1147931510 17:43984166-43984188 GCTCCCCGCATCCCCGGGGCTGG - Intronic
1148912277 17:50949426-50949448 TCCCCCAGCACCCCCAAGGCTGG + Intergenic
1150549040 17:66192104-66192126 CCGCCCAGCAGCCCGGGGGCGGG + Intergenic
1150612831 17:66747911-66747933 TGGCCCGGCACCCCCCGGCCTGG - Intronic
1152181169 17:78822650-78822672 GCGCCAGGCAGCCCCGGGTCCGG - Intronic
1152627202 17:81393281-81393303 TCCGCCTGCACCCGCGGGGCCGG + Intergenic
1152690702 17:81716524-81716546 TCCCCCAGGACCCCGGGGGCTGG + Intronic
1154160901 18:11980767-11980789 CTCCCCGGCACCTCCGGGGCTGG + Intergenic
1156275570 18:35580972-35580994 GCGACCCGCACCGCCGGGGCAGG - Intergenic
1159670088 18:71212343-71212365 TCCCCCTGCAGCCCCGGTGCAGG - Intergenic
1160712096 19:556852-556874 ACGCCTGGCGCCCCCGGAGCTGG - Intergenic
1160813923 19:1026800-1026822 GCCCCCGGCACCTCCCGGGCAGG + Intronic
1160830365 19:1101874-1101896 TCACCCGGCACTGCCAGGGCGGG + Intergenic
1160834463 19:1117997-1118019 TCTCCCGTAACCCCCAGGGCCGG - Intronic
1161039137 19:2100744-2100766 TCCCCAGGAGCCCCCGGGGCAGG - Intergenic
1161266155 19:3365785-3365807 TCACCCAGCACCCAAGGGGCAGG - Intronic
1161283217 19:3456686-3456708 TCGCCCTGAGCCCCCCGGGCCGG - Intronic
1161320356 19:3638095-3638117 TCACCCTGCACCCCCTGGGAAGG - Intronic
1161574506 19:5048184-5048206 GCACCCGGCACCTCCCGGGCAGG - Intronic
1161938330 19:7386047-7386069 CTCCCCGCCACCCCCGGGGCTGG + Intronic
1162043004 19:7981769-7981791 GCGGCCGGCACCCACGGGACTGG - Intronic
1162044008 19:7987100-7987122 CCCCCCGGCACCCCCCGGTCAGG - Intronic
1162895977 19:13764859-13764881 GCGCCCCGCACCTGCGGGGCAGG - Exonic
1163313587 19:16528155-16528177 TGGCCCGGGGCCCCGGGGGCCGG + Exonic
1163762648 19:19145909-19145931 TCGCCGGGGCCCCCGGGGGCCGG + Exonic
1165312040 19:35034291-35034313 CAGCGCGGCTCCCCCGGGGCAGG - Intronic
1166319114 19:42005627-42005649 GGGCCAGGCACCCCCGAGGCAGG - Intronic
1166669887 19:44703542-44703564 TGGCCCGGCCCACACGGGGCGGG + Exonic
1168152408 19:54456095-54456117 TCGACCGGCACCCCCAGCCCCGG - Exonic
931602662 2:64019430-64019452 CCGCGCGGCTCCGCCGGGGCGGG + Intergenic
934763819 2:96869642-96869664 CAGCCCCGCAGCCCCGGGGCCGG - Intronic
946219967 2:218217557-218217579 TCCCCCGCCACCCCCGGCCCCGG - Intronic
948046770 2:234951700-234951722 CCGCCCGGCATCCTCGGGTCTGG - Intergenic
948601817 2:239111754-239111776 TAGCCCTGCAGCCCAGGGGCGGG - Intronic
948639589 2:239366833-239366855 ACGCAGGGCACCCCCAGGGCAGG + Intronic
948726283 2:239936020-239936042 ACTCCCGGCTCCCCCAGGGCTGG + Intronic
1168806932 20:676939-676961 TTGCCCAGCACCCTCTGGGCAGG - Intergenic
1172118525 20:32584900-32584922 GCGCCCGGCGCCCTCGGGGGCGG + Intronic
1175254221 20:57629201-57629223 TCCACCTGCAGCCCCGGGGCAGG + Intergenic
1175485991 20:59346645-59346667 TGGCCCGGCACCACGAGGGCCGG + Intergenic
1175989941 20:62783613-62783635 TGCCCCGGCTCCCCCTGGGCAGG + Intergenic
1178103859 21:29298356-29298378 ACGCCCACCACCCCCAGGGCAGG + Intronic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1179021663 21:37646569-37646591 TCGCCCGGCACACCGGCTGCTGG - Intronic
1179605591 21:42513688-42513710 CCGCCCGGTGGCCCCGGGGCTGG + Intronic
1180079946 21:45482080-45482102 TCACCAGGCACCCCCGGACCCGG - Intronic
1184783879 22:46662543-46662565 TCGCCAGGCACCCCCAGCCCAGG + Intronic
1184865025 22:47197455-47197477 TGTCCCGGCACCCACAGGGCGGG - Intergenic
1185027571 22:48424515-48424537 TGGGCCGGGACCCCGGGGGCAGG + Intergenic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
961551503 3:127672722-127672744 CCGCCCGCCGCCCGCGGGGCCGG - Exonic
961754787 3:129121452-129121474 TCGTCCGGGTCCCCCGGGCCTGG + Exonic
961827552 3:129606803-129606825 TCGCCGCGCAGCCCGGGGGCGGG + Exonic
964482845 3:157159760-157159782 GCGCCCGGCCGGCCCGGGGCCGG + Intronic
966355049 3:179071363-179071385 TCCCCCGACTCCCACGGGGCGGG + Intronic
968482952 4:844884-844906 CTGCCCGGCACACCTGGGGCTGG + Intergenic
968514907 4:1011839-1011861 CCGCCCCGCGCCCCCGGGCCCGG - Intronic
969213013 4:5702031-5702053 TTTCCAGGCACCCCCGTGGCAGG - Intronic
969682229 4:8649754-8649776 CTGCCCGGGGCCCCCGGGGCCGG + Intergenic
978514596 4:109557503-109557525 GCGGCCGGCACCCCCGGCCCGGG + Intergenic
985062418 4:186092489-186092511 CAGCCGGGCACCCACGGGGCGGG - Intergenic
985448351 4:190041052-190041074 TCCTCCCGCGCCCCCGGGGCTGG + Intergenic
985622436 5:962637-962659 TGGCCAGGCATCCCTGGGGCAGG + Intergenic
990557630 5:56951847-56951869 TCGCCCGGCCCGACCGGGGCCGG + Intronic
1002082159 5:176743572-176743594 AGCCCCCGCACCCCCGGGGCTGG + Intergenic
1002281209 5:178131031-178131053 TCGCCCCGCAGCCCCGGCCCCGG - Exonic
1003911460 6:10747643-10747665 GCGCCCTGCATCCCGGGGGCGGG - Intergenic
1007181831 6:39934307-39934329 TCGCGCGGACTCCCCGGGGCAGG + Intronic
1007371199 6:41427920-41427942 TGGCCCGGGGCCCCCGAGGCTGG - Intergenic
1015440550 6:133241773-133241795 TCCCCCGGGAGCCCTGGGGCGGG - Intronic
1015799270 6:137044466-137044488 GCTCCCTGCAGCCCCGGGGCTGG + Intronic
1017696498 6:157021382-157021404 TCGCCCAGCGCCTCCGCGGCAGG - Intronic
1017914207 6:158819166-158819188 TCGCCCGGCACCCCCGGGGCAGG - Intronic
1018013619 6:159693368-159693390 ACGCAGGGCACCCCCGGGGTTGG - Intronic
1018613031 6:165662102-165662124 TCCCCCGGCTTCCCCGGCGCCGG - Intronic
1019333589 7:472101-472123 TCCCCAGGGACTCCCGGGGCAGG + Intergenic
1019730091 7:2624741-2624763 GCTCCCGGCACCCCCAGAGCAGG + Intergenic
1019923158 7:4175440-4175462 TCTCCCGGTCACCCCGGGGCAGG - Intronic
1024615076 7:51105151-51105173 TAGGCAGGCACACCCGGGGCAGG - Intronic
1029168767 7:98616782-98616804 TCGCGAGCCACCCCCGCGGCAGG - Intergenic
1030168580 7:106579137-106579159 GCGCCCGGCACCCCCCCGCCCGG - Intergenic
1034433810 7:151053655-151053677 TCACCCCTCACCCCTGGGGCAGG - Intergenic
1035110614 7:156478659-156478681 TCGGCTGGCAGCCCCGAGGCTGG - Intergenic
1035229776 7:157458019-157458041 TGGCCCTGCAGCCTCGGGGCTGG - Intergenic
1035641600 8:1188658-1188680 CCGCCCAGCACTCCGGGGGCAGG + Intergenic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1037879176 8:22564883-22564905 TCCCCCGCCACCCCAGGGACCGG - Intronic
1041689994 8:60679097-60679119 TCGCCCGGCGCCCCCGGGAGGGG + Intronic
1044306401 8:90645749-90645771 TCGCCCCGCCCCCGCGGGGAAGG + Exonic
1044856682 8:96482832-96482854 TCGCATGGCACCCCCCCGGCTGG - Intergenic
1049207933 8:141372029-141372051 TCACCCAGCACCTCCTGGGCTGG - Intergenic
1049664661 8:143837588-143837610 TCCCCAGCCACCCCCCGGGCCGG + Intronic
1049769649 8:144373968-144373990 TCGCCCACCGCCCACGGGGCGGG + Intronic
1053825000 9:42013415-42013437 TAGCCTGGAACCCCAGGGGCAGG - Exonic
1054605570 9:67173948-67173970 TAGCCTGGAACCCCAGGGGCAGG + Intergenic
1057219258 9:93247234-93247256 GCTCCCAGCGCCCCCGGGGCTGG - Intronic
1060087268 9:120714174-120714196 TCGCCCCGCAACCCGGGGCCCGG + Exonic
1060979784 9:127785604-127785626 TCGCCCGGCCGCCCCGGGCCCGG + Intergenic
1061616685 9:131784931-131784953 TGGCCCGGCAGCCCTGGGGAAGG + Intergenic
1061828312 9:133275220-133275242 CCGCCCGGCGGCCCTGGGGCGGG + Intergenic
1062353427 9:136150133-136150155 TCTCTCTGCAGCCCCGGGGCTGG + Intergenic
1062610587 9:137371678-137371700 AGGCCAGGCACCCCCGGGGCTGG + Intronic
1187173118 X:16870519-16870541 TCGCCCGGCGCTCCCAGGGCCGG + Intergenic
1189446573 X:41085985-41086007 TTGCCGGTCACCCCCGGGCCTGG + Exonic
1190385289 X:49878667-49878689 TAGCCCGGCCCCCCCGGAGCTGG + Intergenic
1195269381 X:103215301-103215323 CCGCACGGCTCCCCCGGGGTGGG - Intronic