ID: 1017914207

View in Genome Browser
Species Human (GRCh38)
Location 6:158819166-158819188
Sequence TCGCCCGGCACCCCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017914207_1017914212 1 Left 1017914207 6:158819166-158819188 CCTGCCCCGGGGGTGCCGGGCGA 0: 1
1: 1
2: 0
3: 17
4: 172
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017914207 Original CRISPR TCGCCCGGCACCCCCGGGGC AGG (reversed) Intronic