ID: 1017914212

View in Genome Browser
Species Human (GRCh38)
Location 6:158819190-158819212
Sequence AACCCCGCGCCGCGCCCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017914199_1017914212 15 Left 1017914199 6:158819152-158819174 CCGGCTCAGCTCCACCTGCCCCG 0: 1
1: 1
2: 4
3: 56
4: 497
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1017914198_1017914212 22 Left 1017914198 6:158819145-158819167 CCGCGGGCCGGCTCAGCTCCACC 0: 1
1: 0
2: 0
3: 25
4: 258
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1017914207_1017914212 1 Left 1017914207 6:158819166-158819188 CCTGCCCCGGGGGTGCCGGGCGA 0: 1
1: 1
2: 0
3: 17
4: 172
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1017914210_1017914212 -5 Left 1017914210 6:158819172-158819194 CCGGGGGTGCCGGGCGAGAACCC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1017914205_1017914212 4 Left 1017914205 6:158819163-158819185 CCACCTGCCCCGGGGGTGCCGGG 0: 1
1: 0
2: 2
3: 52
4: 326
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1017914209_1017914212 -4 Left 1017914209 6:158819171-158819193 CCCGGGGGTGCCGGGCGAGAACC 0: 1
1: 0
2: 0
3: 13
4: 84
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1017914208_1017914212 -3 Left 1017914208 6:158819170-158819192 CCCCGGGGGTGCCGGGCGAGAAC 0: 1
1: 0
2: 1
3: 7
4: 64
Right 1017914212 6:158819190-158819212 AACCCCGCGCCGCGCCCCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017914212 Original CRISPR AACCCCGCGCCGCGCCCCCT AGG Intronic