ID: 1017918185

View in Genome Browser
Species Human (GRCh38)
Location 6:158849006-158849028
Sequence GTCTTAATACTGTTAATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017918185_1017918187 -10 Left 1017918185 6:158849006-158849028 CCCTCTATTAACAGTATTAAGAC No data
Right 1017918187 6:158849019-158849041 GTATTAAGACTATGCCATGCTGG No data
1017918185_1017918188 -5 Left 1017918185 6:158849006-158849028 CCCTCTATTAACAGTATTAAGAC No data
Right 1017918188 6:158849024-158849046 AAGACTATGCCATGCTGGCCAGG No data
1017918185_1017918189 0 Left 1017918185 6:158849006-158849028 CCCTCTATTAACAGTATTAAGAC No data
Right 1017918189 6:158849029-158849051 TATGCCATGCTGGCCAGGCACGG No data
1017918185_1017918193 30 Left 1017918185 6:158849006-158849028 CCCTCTATTAACAGTATTAAGAC No data
Right 1017918193 6:158849059-158849081 CACCTGTAATCCTAGCACTTTGG 0: 6033
1: 84644
2: 218857
3: 252033
4: 196794
1017918185_1017918190 3 Left 1017918185 6:158849006-158849028 CCCTCTATTAACAGTATTAAGAC No data
Right 1017918190 6:158849032-158849054 GCCATGCTGGCCAGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017918185 Original CRISPR GTCTTAATACTGTTAATAGA GGG (reversed) Intergenic
No off target data available for this crispr