ID: 1017919159

View in Genome Browser
Species Human (GRCh38)
Location 6:158856419-158856441
Sequence TATCTTGCAAAGGGAATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919159_1017919165 5 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919165 6:158856447-158856469 GCCAGAAGGTAGGAGGTGTCAGG No data
1017919159_1017919167 21 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919167 6:158856463-158856485 TGTCAGGCAGCGCCGAGCACCGG No data
1017919159_1017919162 -9 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919162 6:158856433-158856455 TGCAAGATAAACTAGCCAGAAGG No data
1017919159_1017919164 -2 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919164 6:158856440-158856462 TAAACTAGCCAGAAGGTAGGAGG No data
1017919159_1017919163 -5 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919163 6:158856437-158856459 AGATAAACTAGCCAGAAGGTAGG No data
1017919159_1017919169 26 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919169 6:158856468-158856490 GGCAGCGCCGAGCACCGGCTGGG No data
1017919159_1017919168 25 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919159 Original CRISPR TATCTTGCAAAGGGAATATT TGG (reversed) Intergenic
No off target data available for this crispr