ID: 1017919160

View in Genome Browser
Species Human (GRCh38)
Location 6:158856428-158856450
Sequence TGGCTAGTTTATCTTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919160_1017919171 29 Left 1017919160 6:158856428-158856450 CCCTTTGCAAGATAAACTAGCCA No data
Right 1017919171 6:158856480-158856502 CACCGGCTGGGCCAGACCTCTGG No data
1017919160_1017919168 16 Left 1017919160 6:158856428-158856450 CCCTTTGCAAGATAAACTAGCCA No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data
1017919160_1017919165 -4 Left 1017919160 6:158856428-158856450 CCCTTTGCAAGATAAACTAGCCA No data
Right 1017919165 6:158856447-158856469 GCCAGAAGGTAGGAGGTGTCAGG No data
1017919160_1017919167 12 Left 1017919160 6:158856428-158856450 CCCTTTGCAAGATAAACTAGCCA No data
Right 1017919167 6:158856463-158856485 TGTCAGGCAGCGCCGAGCACCGG No data
1017919160_1017919169 17 Left 1017919160 6:158856428-158856450 CCCTTTGCAAGATAAACTAGCCA No data
Right 1017919169 6:158856468-158856490 GGCAGCGCCGAGCACCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919160 Original CRISPR TGGCTAGTTTATCTTGCAAA GGG (reversed) Intergenic
No off target data available for this crispr