ID: 1017919161

View in Genome Browser
Species Human (GRCh38)
Location 6:158856429-158856451
Sequence CTGGCTAGTTTATCTTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919161_1017919169 16 Left 1017919161 6:158856429-158856451 CCTTTGCAAGATAAACTAGCCAG No data
Right 1017919169 6:158856468-158856490 GGCAGCGCCGAGCACCGGCTGGG No data
1017919161_1017919167 11 Left 1017919161 6:158856429-158856451 CCTTTGCAAGATAAACTAGCCAG No data
Right 1017919167 6:158856463-158856485 TGTCAGGCAGCGCCGAGCACCGG No data
1017919161_1017919171 28 Left 1017919161 6:158856429-158856451 CCTTTGCAAGATAAACTAGCCAG No data
Right 1017919171 6:158856480-158856502 CACCGGCTGGGCCAGACCTCTGG No data
1017919161_1017919165 -5 Left 1017919161 6:158856429-158856451 CCTTTGCAAGATAAACTAGCCAG No data
Right 1017919165 6:158856447-158856469 GCCAGAAGGTAGGAGGTGTCAGG No data
1017919161_1017919168 15 Left 1017919161 6:158856429-158856451 CCTTTGCAAGATAAACTAGCCAG No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919161 Original CRISPR CTGGCTAGTTTATCTTGCAA AGG (reversed) Intergenic
No off target data available for this crispr