ID: 1017919162

View in Genome Browser
Species Human (GRCh38)
Location 6:158856433-158856455
Sequence TGCAAGATAAACTAGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919159_1017919162 -9 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919162 6:158856433-158856455 TGCAAGATAAACTAGCCAGAAGG No data
1017919158_1017919162 17 Left 1017919158 6:158856393-158856415 CCTTGCAGAAGAGGGTGTCATAT No data
Right 1017919162 6:158856433-158856455 TGCAAGATAAACTAGCCAGAAGG No data
1017919157_1017919162 18 Left 1017919157 6:158856392-158856414 CCCTTGCAGAAGAGGGTGTCATA No data
Right 1017919162 6:158856433-158856455 TGCAAGATAAACTAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919162 Original CRISPR TGCAAGATAAACTAGCCAGA AGG Intergenic
No off target data available for this crispr