ID: 1017919166

View in Genome Browser
Species Human (GRCh38)
Location 6:158856448-158856470
Sequence GCCTGACACCTCCTACCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919166_1017919169 -3 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919169 6:158856468-158856490 GGCAGCGCCGAGCACCGGCTGGG No data
1017919166_1017919168 -4 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data
1017919166_1017919175 22 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919175 6:158856493-158856515 AGACCTCTGGAAGAGCAACTGGG No data
1017919166_1017919174 21 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919174 6:158856492-158856514 CAGACCTCTGGAAGAGCAACTGG No data
1017919166_1017919167 -8 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919167 6:158856463-158856485 TGTCAGGCAGCGCCGAGCACCGG No data
1017919166_1017919171 9 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919171 6:158856480-158856502 CACCGGCTGGGCCAGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919166 Original CRISPR GCCTGACACCTCCTACCTTC TGG (reversed) Intergenic
No off target data available for this crispr