ID: 1017919168

View in Genome Browser
Species Human (GRCh38)
Location 6:158856467-158856489
Sequence AGGCAGCGCCGAGCACCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919166_1017919168 -4 Left 1017919166 6:158856448-158856470 CCAGAAGGTAGGAGGTGTCAGGC No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data
1017919160_1017919168 16 Left 1017919160 6:158856428-158856450 CCCTTTGCAAGATAAACTAGCCA No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data
1017919159_1017919168 25 Left 1017919159 6:158856419-158856441 CCAAATATTCCCTTTGCAAGATA No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data
1017919161_1017919168 15 Left 1017919161 6:158856429-158856451 CCTTTGCAAGATAAACTAGCCAG No data
Right 1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919168 Original CRISPR AGGCAGCGCCGAGCACCGGC TGG Intergenic
No off target data available for this crispr