ID: 1017919518

View in Genome Browser
Species Human (GRCh38)
Location 6:158859073-158859095
Sequence ACACACTGCCTGGCACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017919514_1017919518 15 Left 1017919514 6:158859035-158859057 CCTTTCTGTCAGTAGCGCAGGTT No data
Right 1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG No data
1017919512_1017919518 29 Left 1017919512 6:158859021-158859043 CCAATTCTTCACATCCTTTCTGT No data
Right 1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017919518 Original CRISPR ACACACTGCCTGGCACAAAG TGG Intergenic
No off target data available for this crispr